ID: 1169670821

View in Genome Browser
Species Human (GRCh38)
Location 20:8099850-8099872
Sequence ACTAAGAATTCACTTACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169670818_1169670821 23 Left 1169670818 20:8099804-8099826 CCAGCTCACACTGTCTTGCAAAG No data
Right 1169670821 20:8099850-8099872 ACTAAGAATTCACTTACTTCAGG No data
1169670820_1169670821 0 Left 1169670820 20:8099827-8099849 CCAGTTGGATGCATCTCTTCATG No data
Right 1169670821 20:8099850-8099872 ACTAAGAATTCACTTACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169670821 Original CRISPR ACTAAGAATTCACTTACTTC AGG Intergenic