ID: 1169670823

View in Genome Browser
Species Human (GRCh38)
Location 20:8099874-8099896
Sequence TGGCAACTTGCAGTCACCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169670820_1169670823 24 Left 1169670820 20:8099827-8099849 CCAGTTGGATGCATCTCTTCATG No data
Right 1169670823 20:8099874-8099896 TGGCAACTTGCAGTCACCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169670823 Original CRISPR TGGCAACTTGCAGTCACCAA TGG Intergenic
No off target data available for this crispr