ID: 1169673964

View in Genome Browser
Species Human (GRCh38)
Location 20:8133214-8133236
Sequence GAACCCTCTTGGCGCTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169673962_1169673964 6 Left 1169673962 20:8133185-8133207 CCTGAAGTTCAAAACACTTTAGT 0: 1
1: 0
2: 2
3: 14
4: 198
Right 1169673964 20:8133214-8133236 GAACCCTCTTGGCGCTTTTGTGG 0: 1
1: 0
2: 0
3: 6
4: 59
1169673960_1169673964 27 Left 1169673960 20:8133164-8133186 CCCGATTTCAAGAAGGAAGGACC No data
Right 1169673964 20:8133214-8133236 GAACCCTCTTGGCGCTTTTGTGG 0: 1
1: 0
2: 0
3: 6
4: 59
1169673961_1169673964 26 Left 1169673961 20:8133165-8133187 CCGATTTCAAGAAGGAAGGACCT 0: 1
1: 0
2: 1
3: 11
4: 346
Right 1169673964 20:8133214-8133236 GAACCCTCTTGGCGCTTTTGTGG 0: 1
1: 0
2: 0
3: 6
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169673964 Original CRISPR GAACCCTCTTGGCGCTTTTG TGG Intronic
915556041 1:156661322-156661344 GAGCCCTCCTGCCGCTCTTGGGG - Intergenic
916694669 1:167222099-167222121 GAGGCCTCTGGGCGCTTCTGGGG - Intronic
917075954 1:171205204-171205226 GAACCCTCTTGATATTTTTGGGG - Intronic
922446428 1:225701803-225701825 GAACCCTCTTTCCCCATTTGGGG + Intergenic
1069582608 10:69575962-69575984 GAACCAACTTGGAGCTTTTTTGG + Intergenic
1075080442 10:119379955-119379977 GAACCCTCTTGGCTATTGAGTGG + Intronic
1075243070 10:120795193-120795215 CAACCCTCTTGGAGCTTCTTTGG + Intergenic
1078003477 11:7515541-7515563 GATCCCTCCTGGGGTTTTTGAGG + Intronic
1086059292 11:82683587-82683609 GCACCCTCTTGGAGCTAATGAGG - Intergenic
1089135352 11:116244920-116244942 TATCCCTCTTGGCTCTTGTGTGG - Intergenic
1101917275 12:108905466-108905488 GAATCGTCTTGGCACTTTTGTGG + Intergenic
1103697645 12:122829820-122829842 GCATTCTCTTGGCACTTTTGGGG - Intergenic
1105502815 13:20988087-20988109 TGTCCCCCTTGGCGCTTTTGCGG + Exonic
1110710400 13:78644573-78644595 GAACTCTCTGGGCTTTTTTGGGG + Intronic
1114351861 14:21861518-21861540 GAGCTCTCTTGGGGCTTTTGTGG + Intergenic
1116631056 14:47334140-47334162 AAACCTTCTTGGCTTTTTTGTGG + Intronic
1118075317 14:62291832-62291854 GAACCATCTTGGCACACTTGGGG + Intergenic
1124309767 15:28612385-28612407 AAACCGTCTTGCCGCATTTGTGG + Intergenic
1127008623 15:54597565-54597587 GTACTCTCTTGCCCCTTTTGCGG - Intronic
1127882623 15:63171570-63171592 AGACCCTCTTGGGGTTTTTGAGG + Intergenic
1133977109 16:10607185-10607207 GACCCCTCTCTGCCCTTTTGTGG - Intergenic
1135492891 16:22925254-22925276 GAGCCCTCGTGGAGCTTTGGTGG - Intergenic
1137490199 16:48926010-48926032 CATCCCTCTTGGTGCTGTTGTGG + Intergenic
1151237574 17:72732500-72732522 GGACCATCTTGGCAGTTTTGAGG + Intronic
1152060476 17:78070465-78070487 GAAGCCTCCTGGCTCTTCTGTGG + Intronic
1155507246 18:26546562-26546584 TAACTCTCTTGGTGCTTTTTGGG - Intronic
1159407455 18:68023214-68023236 AAACCCTTTTGGTGGTTTTGAGG + Intergenic
1162173559 19:8811718-8811740 GAATCCTCTTGTGGCTTTTGAGG + Exonic
1165134610 19:33659969-33659991 GAATCCTCCTGAAGCTTTTGGGG + Intronic
933984177 2:87576759-87576781 GACCCCTATTGGCCCTTTAGGGG - Intergenic
936309676 2:111374037-111374059 GACCCCTATTGGCCCTTTAGAGG + Intergenic
936484762 2:112916432-112916454 GAACCCTCTGAGCACTGTTGTGG + Intronic
939819780 2:146943722-146943744 GAACACTCTTGGCTCTTTGCTGG + Intergenic
941806460 2:169715852-169715874 GAATGCTCTTGGCTCTTTGGAGG - Intronic
946491612 2:220154175-220154197 CCACCCTCTTGTAGCTTTTGTGG + Intergenic
1169673964 20:8133214-8133236 GAACCCTCTTGGCGCTTTTGTGG + Intronic
1169974628 20:11310860-11310882 GCACAGTCTTGGCGCTTTTGTGG - Intergenic
1171161871 20:22933389-22933411 AAACCCTCCTGGCTCTTCTGAGG - Intergenic
1175043977 20:56085768-56085790 CAATACTCTTGGTGCTTTTGTGG - Intergenic
1175858084 20:62133486-62133508 GAACCTTCTGGACGCTTTGGTGG + Intronic
949791867 3:7801616-7801638 GAACCAGCTTGGCACCTTTGAGG - Intergenic
952483795 3:33789167-33789189 GAAGCTTCTTAGCTCTTTTGAGG - Intergenic
956843421 3:73160698-73160720 GAACCCTCCTAGGGCTATTGTGG + Intergenic
962357548 3:134707902-134707924 GAACCCTCCCAGCTCTTTTGGGG - Intronic
964188230 3:153972814-153972836 GTACCCTCCTGGCGCCTTCGTGG - Intergenic
964877570 3:161385694-161385716 GAGCCCTCTTTGTGCTTTGGGGG + Intergenic
967472011 3:189872700-189872722 CAACACTCTTGGCCCTTTTGTGG - Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
975860339 4:78670375-78670397 CATCCCTCTTGGTGCTGTTGTGG + Intergenic
978486205 4:109256638-109256660 TAACACTCATGGAGCTTTTGTGG + Intronic
990364363 5:55054807-55054829 GAACCCTCATGCCCCTTTTCTGG - Intergenic
991177583 5:63707947-63707969 GAACCCTTTCGTCACTTTTGGGG + Intergenic
996806042 5:127455051-127455073 GAGCCCTCTTGGTGCTCCTGGGG + Intronic
1001444150 5:171770300-171770322 GAGCCCTCATGGGGCATTTGAGG - Intergenic
1002154823 5:177268595-177268617 GAACACTGTTGGTACTTTTGAGG + Intronic
1002818065 6:697178-697200 GACGCCTCTTGGAGCTTATGAGG + Intergenic
1006565938 6:34957227-34957249 GAACTCTTTTGGCACTGTTGTGG + Intronic
1011243342 6:85296151-85296173 CAATCCTCTTGGCCCTTTTCAGG - Intergenic
1018730018 6:166642049-166642071 GAATCCTCCTGGGGATTTTGGGG - Intronic
1023288045 7:38639499-38639521 GAATGATCTTGGCACTTTTGTGG - Intergenic
1031657652 7:124378330-124378352 GAACCTTCTTGGAGCTTATGAGG - Intergenic
1038351110 8:26777138-26777160 GAACCCTCCTGGGGTTTATGTGG + Intronic
1041627223 8:60044364-60044386 GAACCCTCCTGGGTCTTGTGGGG + Intergenic
1058448052 9:105071106-105071128 GTACCTTCTTGGCTCTGTTGGGG - Intergenic
1197271996 X:124434878-124434900 GAACCCTCTCAGCCCTTCTGGGG + Intronic
1198912542 X:141630518-141630540 GTACCCTCTTGGTGCATGTGTGG + Intronic