ID: 1169674086

View in Genome Browser
Species Human (GRCh38)
Location 20:8133999-8134021
Sequence CTGGAAGCGCAAACGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169674082_1169674086 20 Left 1169674082 20:8133956-8133978 CCAATTACTTAGCTGAGTGCGTC 0: 1
1: 0
2: 2
3: 5
4: 49
Right 1169674086 20:8133999-8134021 CTGGAAGCGCAAACGGAACTTGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169674086 Original CRISPR CTGGAAGCGCAAACGGAACT TGG Intronic
1063640031 10:7819867-7819889 GTGGAAGCGGGAACGAAACTTGG - Intronic
1071251360 10:83823031-83823053 CTGGATGGGCAAACAGAACATGG + Intergenic
1072304872 10:94097505-94097527 CTGGAAGCTCAAAGGGAAGGAGG - Intronic
1074127244 10:110538693-110538715 CTGGGAAGGCAAAGGGAACTGGG + Intergenic
1076277156 10:129210988-129211010 CGGGAATCCCAAAGGGAACTGGG + Intergenic
1086943347 11:92820631-92820653 CTGGAAGCTCAAATGGAGGTTGG - Intronic
1088018561 11:105090590-105090612 CTGGAAGCTCAAATGAAAATTGG + Intronic
1090320894 11:125842723-125842745 CTGCAGGAGCAAAGGGAACTTGG - Intergenic
1091232491 11:133997847-133997869 AAGGAAGCCCAAAAGGAACTGGG - Intergenic
1107608477 13:42087111-42087133 CTTGAAGCTCATACAGAACTAGG + Intronic
1115762829 14:36592324-36592346 CTGTAAGAGCTAAAGGAACTTGG - Intergenic
1140519618 16:75569866-75569888 CTGGAAAGGCAAATGGGACTTGG - Intronic
1140691396 16:77487829-77487851 CTGAAAGCGTGAACAGAACTGGG - Intergenic
1166852009 19:45765664-45765686 CTGGAAGCGGAAAAGGGGCTGGG - Exonic
1167038470 19:47008263-47008285 CTGGAAGGCAAAATGGAACTGGG - Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
935599392 2:104907162-104907184 AAGGAAGCACAAACGGAACGGGG - Intergenic
936731054 2:115382080-115382102 CGGGAAGCTCCAACTGAACTGGG - Intronic
944589224 2:201201638-201201660 CTAGAAGTGCAAAGGGGACTGGG + Intronic
948772476 2:240258706-240258728 GTGGAAGCTGGAACGGAACTTGG + Intergenic
1169674086 20:8133999-8134021 CTGGAAGCGCAAACGGAACTTGG + Intronic
1173164415 20:40676530-40676552 CTGGGAGCCCAAACGTATCTGGG - Intergenic
1173322195 20:41998184-41998206 CTGGAAGCGAGAAAGGAATTGGG + Intergenic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1182322704 22:29488888-29488910 CTGGAAGCGAGAAAGGAATTGGG - Exonic
1183618995 22:38961870-38961892 CTGGAAGTGGAAGCAGAACTTGG + Intronic
1183624197 22:38991806-38991828 CTGGAAGTGGAAGCAGAACTTGG + Intronic
1183639958 22:39086783-39086805 CTGGAAGTGGAAGCAGAACTTGG + Intronic
950941373 3:16896369-16896391 CTGAAAGCACAAAAGGAGCTGGG + Intronic
954694367 3:52413030-52413052 GTGGAAGCACACACGGAGCTGGG + Intronic
964090279 3:152867887-152867909 CTAGAAGGGCAAAAGAAACTTGG + Intergenic
966356352 3:179083396-179083418 CTGGAAGGAAAAACTGAACTAGG + Intergenic
967754320 3:193151675-193151697 ATGGAAGAGCAAAAGGCACTAGG - Intergenic
969051784 4:4378451-4378473 ATGGAAGCGGAAACGGAGGTGGG + Intronic
973377226 4:49295048-49295070 CTGGAAGAGCTCACGGCACTCGG - Intergenic
973378146 4:49301184-49301206 CTGGAAGAGCTCACGGCACTCGG - Intergenic
974516811 4:62925926-62925948 CTGGAAGCTCAAAAGCAAATAGG + Intergenic
986248113 5:6029433-6029455 CTGGAAGAGCAAAGGCAGCTGGG + Intergenic
997878481 5:137569708-137569730 CTGGAAGCCCCAAGGGAAGTAGG + Intronic
998848906 5:146336362-146336384 CTGGAAGCCCAAAGGGAAAAGGG - Intronic
1005899008 6:30201399-30201421 CTGGAAGCACTAATGGATCTAGG + Intronic
1017103325 6:150866485-150866507 CGGGAAGGGCAAGCGGAGCTCGG + Intronic
1020408713 7:7866467-7866489 CTGGAAGGGCAAATTGAAATAGG + Intronic
1027188623 7:75985736-75985758 CTTGAAGGGCAGGCGGAACTGGG - Exonic
1029481723 7:100817398-100817420 CAGGAAGAGCAACAGGAACTTGG - Intronic
1030281708 7:107782709-107782731 CTGAAAGCACAAACTAAACTAGG - Intronic
1047947334 8:129894769-129894791 CTGGAAGAGCAAAAGGAACAAGG - Intronic
1054597076 9:67078090-67078112 CTGAAAGAGCAAACAGTACTAGG - Intergenic
1058394017 9:104528881-104528903 CTGGAAGCACAAAAGGAATGGGG + Intergenic
1059138628 9:111831297-111831319 CTGGAAGCGCAAAATCAAGTTGG + Intergenic
1186581166 X:10820255-10820277 CTGGCAGGGCAAACCGAACTGGG + Intronic
1193674818 X:84437567-84437589 CTGGAAGCTCTAGTGGAACTAGG - Intronic