ID: 1169675289

View in Genome Browser
Species Human (GRCh38)
Location 20:8146171-8146193
Sequence TGCAATATTGAAGTGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169675289 Original CRISPR TGCAATATTGAAGTGTCATG GGG Intronic
904444349 1:30555879-30555901 TGGAATATTGAAGAGTCTTGTGG + Intergenic
904571489 1:31469362-31469384 GGCAATATTGGAGTGTTATAGGG + Intergenic
904701973 1:32363047-32363069 TGCAAGATGAAAGTGGCATGAGG + Intronic
907144847 1:52222560-52222582 GGCAATATTGGAGTGTTATAAGG + Intronic
909627133 1:77730166-77730188 TGCATTTTTGAAAAGTCATGGGG - Intronic
911908298 1:103597384-103597406 TGGAAAATTGAAATGTTATGTGG + Intergenic
911910664 1:103630432-103630454 TGGAAAATTGAAATGTTATGTGG + Intergenic
911914620 1:103682082-103682104 TGGAAAATTGAAATGTTATGTGG - Intronic
911918079 1:103724557-103724579 TGGAAAATTGAAATGTTATGTGG + Intronic
917613062 1:176709527-176709549 TGAAATATTAAAGTATCACGGGG - Intronic
918738857 1:188102193-188102215 TGCAATTTTAAAGAGTTATGAGG + Intergenic
1064864206 10:19860960-19860982 TGCAGTAATTAAGTGTCTTGGGG - Intronic
1070944790 10:80380964-80380986 TTCAATATTGTTGTGTCTTGGGG + Intergenic
1073719860 10:106155950-106155972 TGCAATTTTAAAGTGACATAGGG - Intergenic
1079185048 11:18229147-18229169 TGCAAGAGTGAAGAGTAATGTGG + Intronic
1083375655 11:62218220-62218242 GGCAATATTGGAGTGTTATAAGG - Intergenic
1083985426 11:66211660-66211682 TGCAGTATTAACGTGTAATGGGG - Intronic
1086068626 11:82773664-82773686 TCCAATATGGTAGTGACATGTGG - Intergenic
1087978549 11:104581760-104581782 TAAAATATTTAAGTGTCTTGTGG + Intergenic
1088363671 11:109017184-109017206 TGCATTATTAAAGTGAGATGTGG + Intergenic
1088556050 11:111062306-111062328 TGCACTATTGTAGTATCATTTGG - Intergenic
1090476737 11:127028991-127029013 TGAAATATTGAGGGGCCATGTGG + Intergenic
1093311162 12:17587189-17587211 TACAACATTGAAGTGTAAAGTGG - Intergenic
1099335841 12:81356151-81356173 TTCAATATTGTTGTGTCTTGGGG + Intronic
1101087110 12:101247710-101247732 TGCATTTTTAAAGTGTTATGAGG + Intergenic
1102564616 12:113787528-113787550 TGCAGTATTGTAATTTCATGGGG + Intergenic
1102721010 12:115016062-115016084 TCCAACAGAGAAGTGTCATGTGG - Intergenic
1104326837 12:127806717-127806739 AGCAATATGCAAGTGTGATGTGG - Intergenic
1106145791 13:27048820-27048842 TGCAAAATTGAATAGTCATTGGG - Intergenic
1106310337 13:28548700-28548722 TGCAATATGGAGGTGTTAAGCGG + Intergenic
1106763483 13:32891072-32891094 TGTAATATTGAAGTTTCTAGGGG - Intergenic
1107204048 13:37760393-37760415 TGTAAAATTGAACTGTCATTGGG + Intronic
1110428135 13:75392486-75392508 TGCGATATTAAAGTGGAATGAGG - Intronic
1111300983 13:86350041-86350063 TGCAATATTGATATCTCATGAGG - Intergenic
1111575664 13:90151185-90151207 TGCAATATTGAGGTGGTCTGGGG - Intergenic
1113087468 13:106582904-106582926 TACATTATTCAGGTGTCATGAGG + Intergenic
1114394763 14:22347777-22347799 TGGACTATTGAAGTGACATTAGG - Intergenic
1116327654 14:43552246-43552268 TGCAAGATTTTAGTGTTATGTGG - Intergenic
1116688316 14:48071984-48072006 TGCTATATTGAAGTGGAATAAGG + Intergenic
1119858082 14:77916005-77916027 TGGAATTTTGTGGTGTCATGTGG + Intronic
1120528689 14:85606967-85606989 TGTAGTATTAAAATGTCATGAGG - Intronic
1120768169 14:88350711-88350733 TGCAATATTGAAAGCTCAAGTGG - Intergenic
1122327463 14:100891180-100891202 TGCAAGATTGAAGGGTCCCGGGG - Intergenic
1124095082 15:26641770-26641792 TGCACTAATGAAGTGGCATCAGG + Intronic
1127025453 15:54800277-54800299 TACAATATTGTTGTGTCTTGGGG - Intergenic
1131872108 15:96773926-96773948 TGCAATATCCAAGAGTCCTGGGG + Intergenic
1133910938 16:10066044-10066066 TGGACTATGGAAGTGTCAGGAGG - Intronic
1136415319 16:30099538-30099560 GGCAATATTGGAGTGTTATAAGG - Intergenic
1137532917 16:49294410-49294432 GTAAATATTGAACTGTCATGAGG - Intergenic
1137537804 16:49340680-49340702 TGCAATTTTCAAGTGTCAGAAGG + Intergenic
1138742731 16:59329660-59329682 TCCAATTTTGAACTGTCAAGGGG - Intergenic
1140177099 16:72673155-72673177 TGCATCATGGAAGTGTCAGGAGG + Intergenic
1140428570 16:74882131-74882153 TGCTATTATAAAGTGTCATGCGG - Intronic
1144000892 17:11053983-11054005 TGCTTTATGGAAGTGTCATGTGG + Intergenic
1144446754 17:15338104-15338126 TGAAATATTGAAATATAATGTGG - Intronic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1153375017 18:4366548-4366570 TGTGATATTAAAGTGTCATTGGG + Intronic
1153924352 18:9822500-9822522 TGAAATATTGAGGTGTGAAGAGG + Intronic
1155281437 18:24244646-24244668 TGCCATATTGAAGTGGTTTGAGG - Intronic
1155902414 18:31407528-31407550 TGCAATATTTAGGTTTCATGGGG + Intronic
1156774021 18:40765467-40765489 TGGAATATACAAGCGTCATGGGG - Intergenic
1164707045 19:30327469-30327491 TCCAAAATTGAAGTCTTATGTGG - Intronic
1165323260 19:35099250-35099272 TGCAAGTTTGAAGTGGCCTGTGG + Intergenic
924965837 2:75747-75769 TATAATATTCAAGTGTAATGAGG - Intergenic
925778294 2:7356369-7356391 TGTAATATTAAAATATCATGGGG - Intergenic
926909047 2:17832476-17832498 TGCAATATTCAAATATAATGGGG + Intergenic
926966765 2:18423496-18423518 TTCAACATTGAAGTGTCAGCAGG + Intergenic
931910280 2:66891617-66891639 TGAAATATAAAAATGTCATGTGG - Intergenic
938675991 2:133634540-133634562 TGCAAATTTTAAGTGTCAAGTGG - Intergenic
938864238 2:135401878-135401900 TTCAATATTTAAGAGACATGAGG + Intronic
940672107 2:156683331-156683353 AACAATATTGAAGTGTAATGAGG + Intergenic
946101137 2:217324971-217324993 TGAAATATGGAAGTGTAATTTGG + Intronic
1169675289 20:8146171-8146193 TGCAATATTGAAGTGTCATGGGG + Intronic
1174428761 20:50452231-50452253 TACAAGATTCAAGTGTTATGTGG - Intergenic
1174835075 20:53849443-53849465 TGTGGTATTGAAGTATCATGGGG + Intergenic
1175142602 20:56872116-56872138 TCCCAAATTGAGGTGTCATGCGG - Intergenic
1175154551 20:56961249-56961271 GTAAATATTGAAATGTCATGTGG - Intergenic
1175549448 20:59807801-59807823 TGTATCATTGAAATGTCATGAGG + Intronic
1178049558 21:28732925-28732947 TGCAATATTGAAGCTTCACTGGG + Intergenic
1178123198 21:29490449-29490471 TGCTAAATTGAAGTGACCTGGGG + Intronic
1180516536 22:16149719-16149741 GGCAATATTGAGGTGTTATAAGG - Intergenic
1184064752 22:42111873-42111895 GGCAATATTGGAGTGTTATACGG + Intergenic
1184574454 22:45351083-45351105 AGCAATATTAAAGAGTCATCTGG - Intronic
1184992024 22:48176971-48176993 TGCAATAAAGAAATGTAATGTGG - Intergenic
950495500 3:13331699-13331721 TGCAACATGTAAGTGTCCTGTGG + Intronic
952020677 3:29015812-29015834 TGCAATAATGAAATCTCATTTGG - Intergenic
952424028 3:33156692-33156714 TGGAATGCTGAGGTGTCATGTGG + Intronic
957989665 3:87612716-87612738 GGCAATATTGGAGTGTTATAAGG + Intergenic
959140898 3:102485773-102485795 TGCAATATGAAAATGTCCTGTGG - Intergenic
959883816 3:111476032-111476054 TGCAATATTGGGGGGTCCTGGGG - Intronic
960193084 3:114730688-114730710 TCCAATACTGAGGTGTCATCAGG - Intronic
964191512 3:154007557-154007579 TGCAAAAATGAAGTGTCTTTAGG + Intergenic
964226945 3:154414545-154414567 TGTAATTTTTAAGTGTCTTGTGG - Intronic
965938914 3:174151489-174151511 TGAAATGTTGAATTGTCCTGAGG + Intronic
968043168 3:195605138-195605160 TGCACTGTAAAAGTGTCATGTGG + Intergenic
979844783 4:125494310-125494332 TGAAATATTGAAGTGACATATGG + Intergenic
980833604 4:138161744-138161766 TACAATATTGATTTGTCATACGG + Intergenic
981668426 4:147257190-147257212 GTCAATTTTGAAGTGTGATGTGG - Intergenic
982036196 4:151348513-151348535 TTCAATATTGTTGTGTCTTGGGG - Intergenic
982353322 4:154440492-154440514 TGTAATATTAAAATTTCATGCGG - Intronic
982663893 4:158237341-158237363 TGCAGTATTAAAGTGGCATCAGG - Intronic
983246696 4:165295949-165295971 TGCATTATAGAAATATCATGAGG + Intronic
983356062 4:166658639-166658661 TGTATTTTTGAACTGTCATGTGG + Intergenic
984458388 4:180000593-180000615 GGCAATATGGAAGTCTCTTGTGG - Intergenic
984785316 4:183562398-183562420 AGCAATATTAAAAGGTCATGAGG + Intergenic
987263419 5:16226791-16226813 TTGAATATTGCAGTGTGATGTGG + Intergenic
988151706 5:27391357-27391379 TGAAATGTTGAAATGTAATGGGG - Intergenic
988270800 5:29013872-29013894 TGCAATAGTAAAGTTTCATCTGG - Intergenic
990442778 5:55863220-55863242 TGCAGAATTAAAATGTCATGAGG + Intronic
992006638 5:72484777-72484799 TACAATAAGGAAGTGTGATGGGG - Intronic
993519581 5:88884027-88884049 TGCAATAAAGAATTGTCATTAGG - Intronic
995829292 5:116335723-116335745 TGCATTATAGAAGTGTCAGAGGG + Intronic
995843636 5:116468994-116469016 TGCAATATTACAGTCTCCTGGGG - Intronic
997230007 5:132235448-132235470 TCCAAGATTGAGGTGTCATCAGG - Intronic
997293059 5:132751512-132751534 TGCAATGTGGAAATCTCATGGGG + Exonic
997824568 5:137095002-137095024 TTCAATATTGTTGTGTCATAAGG + Intronic
999651456 5:153771515-153771537 TGCAAGAATGTAGTGGCATGAGG - Intronic
1000123589 5:158221887-158221909 TGCAACATGGAATTGTTATGAGG - Intergenic
1000365269 5:160484868-160484890 TGGCATATGGAAGGGTCATGAGG + Intergenic
1000655075 5:163867769-163867791 TGTAATCTTGAACTGTCCTGTGG + Intergenic
1003291090 6:4778529-4778551 TGCCATATGGAGGTTTCATGGGG + Intronic
1005574889 6:27181540-27181562 GGCAATATTGGAGTGTTATAAGG - Intergenic
1005780650 6:29188234-29188256 AGTAATATATAAGTGTCATGTGG + Intergenic
1009309183 6:62127783-62127805 GGGAATCTTGAAGTGTTATGTGG - Intronic
1009461072 6:63914152-63914174 TTCAATATTGTTGTGTCTTGGGG - Intronic
1010163589 6:72889101-72889123 TACAATTTTTAGGTGTCATGAGG + Intronic
1013180858 6:107715968-107715990 AGCAATATTGAACAGTCATTTGG + Intronic
1015244364 6:131061505-131061527 TGCAATCTTGAATTGTGATAAGG - Intronic
1016015300 6:139177907-139177929 TGCACTGTTGAAGTGTCATTTGG + Exonic
1016303515 6:142657916-142657938 TCCAAGATTGAAGTGTCAGTAGG + Intergenic
1016706515 6:147114988-147115010 TCCATGAATGAAGTGTCATGAGG - Intergenic
1021077413 7:16322029-16322051 TCCAAAATTGAGGTGTCATCAGG - Intronic
1021678125 7:23101614-23101636 TGCAATATTGTTGTGTCTGGAGG - Intergenic
1022676452 7:32504103-32504125 TTCAATATTGAAATTTCATGAGG - Intronic
1028018424 7:85742884-85742906 GGCAATATTGGAGTGTTATAAGG + Intergenic
1029004338 7:97191935-97191957 TTGAATATTGATGTTTCATGGGG + Intergenic
1029897435 7:103998819-103998841 ACCAATATTCAAATGTCATGAGG + Intergenic
1030997788 7:116379364-116379386 TGCAATATGAAAGAGCCATGAGG + Intronic
1031041606 7:116844031-116844053 TGCAATTTTGATGTTTAATGGGG - Intronic
1031417147 7:121508128-121508150 GGCAATATTGCAGTGTTATAAGG + Intergenic
1033890773 7:146010679-146010701 TGCAAAATTTAAGTGTATTGTGG - Intergenic
1035738358 8:1906182-1906204 TGGAATATTGTAGTGAGATGAGG + Intronic
1036428417 8:8667407-8667429 TGCCTTATTCCAGTGTCATGAGG + Intergenic
1037648091 8:20811972-20811994 TGTGATATTAAAATGTCATGGGG - Intergenic
1038866899 8:31448867-31448889 TGCAATATGGTAGTGACATAAGG + Intergenic
1041174611 8:55181577-55181599 TGCATTTTAGAAGGGTCATGTGG + Intronic
1042104001 8:65304800-65304822 TGTAAAATGGAAGTCTCATGTGG - Intergenic
1042758556 8:72245615-72245637 TGCAATGTTGCAGTGTTATTGGG + Intergenic
1043450516 8:80361649-80361671 TGCAATTATGAACTCTCATGGGG + Intergenic
1043821468 8:84870894-84870916 TGAGATATTGAAGTGTGATGAGG + Intronic
1046021555 8:108671494-108671516 TGCAATATTGATGTGTTAAGAGG + Intronic
1046718844 8:117596433-117596455 TGGAAGATTAAAGTTTCATGGGG + Intergenic
1051392463 9:16580915-16580937 AGCAATATTAACATGTCATGAGG + Intronic
1053705787 9:40751561-40751583 GGCAATATTGAGGTGTTATAAGG + Intergenic
1054415863 9:64875165-64875187 GGCAATATTGAGGTGTTATAAGG + Intergenic
1055270144 9:74549030-74549052 TGCAATATCGCATTTTCATGTGG - Intronic
1057242177 9:93420949-93420971 TCCATTATTACAGTGTCATGTGG + Intergenic
1186285375 X:8038123-8038145 TCCAAGTTTGAAGGGTCATGAGG + Intergenic
1187134220 X:16530967-16530989 CGCATTATCGAAGTGTCTTGAGG + Intergenic
1192609017 X:72548958-72548980 TGCAGTATTAAAATGTTATGGGG - Intronic
1194573170 X:95577505-95577527 TACCATATTGAAGTTTCATATGG + Intergenic
1194602903 X:95945053-95945075 AGCAATATTGAATTATCATTAGG + Intergenic
1198493878 X:137170746-137170768 AGCAAAATTGAAGACTCATGAGG - Intergenic
1200801989 Y:7395244-7395266 GGCAATATTGGAGTGTTATAAGG - Intergenic