ID: 1169676010

View in Genome Browser
Species Human (GRCh38)
Location 20:8155952-8155974
Sequence TTGACTAAGCAGCAGCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169676007_1169676010 7 Left 1169676007 20:8155922-8155944 CCTTGGCCTGGAGCAGTGTGTCA 0: 1
1: 0
2: 4
3: 92
4: 1007
Right 1169676010 20:8155952-8155974 TTGACTAAGCAGCAGCATCTGGG 0: 1
1: 0
2: 1
3: 8
4: 177
1169676008_1169676010 1 Left 1169676008 20:8155928-8155950 CCTGGAGCAGTGTGTCAGTCATT 0: 1
1: 0
2: 0
3: 12
4: 167
Right 1169676010 20:8155952-8155974 TTGACTAAGCAGCAGCATCTGGG 0: 1
1: 0
2: 1
3: 8
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169676010 Original CRISPR TTGACTAAGCAGCAGCATCT GGG Intronic
900577873 1:3393255-3393277 TTGCTTAAGCGACAGCATCTAGG - Intronic
902596905 1:17515934-17515956 TTGATTTAGAAGCAGTATCTGGG - Intergenic
903335403 1:22621171-22621193 TTGAGTAAGCAACCCCATCTTGG - Intergenic
906947807 1:50310377-50310399 TTGACAAAGCAGCTGCATTGGGG - Intergenic
907031660 1:51178230-51178252 TGGACCAATCAGCAGGATCTGGG + Intergenic
907397837 1:54204329-54204351 ATGACTGAGCAGCATGATCTCGG - Intronic
907596516 1:55725363-55725385 TTGAGTAAGAAGCAGAATCTTGG - Intergenic
908207832 1:61869527-61869549 GTGACTAAGCAGCAAGTTCTAGG - Intronic
908765994 1:67555103-67555125 TCCAATAGGCAGCAGCATCTAGG - Intergenic
908770955 1:67595076-67595098 TAAACTAAGAAGCAGCCTCTGGG + Intergenic
909867468 1:80692289-80692311 TTGACTAAACAGCAGACTGTGGG + Intergenic
910087093 1:83416305-83416327 TTGAGTAAGCAATTGCATCTAGG + Intergenic
911080551 1:93925396-93925418 GTGACTAAGCATTATCATCTAGG + Intergenic
912396452 1:109348349-109348371 GTGAGTAAACAGCAGCATCCTGG + Intronic
914678891 1:149925244-149925266 TCTATTAAGCAGCAGCATCAAGG + Intronic
918268851 1:182875267-182875289 TTCAGTAGGCTGCAGCATCTGGG + Intronic
918381380 1:183959112-183959134 TTGGCTTCTCAGCAGCATCTTGG + Intronic
918585971 1:186188716-186188738 TTGACTATGCTGCAGTAACTTGG - Intronic
922162742 1:223090288-223090310 TATCCTAAGCAGCAGCTTCTAGG - Intergenic
1063077238 10:2729617-2729639 GTGATTAAGTTGCAGCATCTTGG - Intergenic
1063692299 10:8298149-8298171 TGGATTAAGCTGCTGCATCTTGG + Intergenic
1066045040 10:31587423-31587445 TGGACCAATCAGCAGCATGTGGG - Intergenic
1066590450 10:36988848-36988870 TGGACTAATCAGCAGGATGTGGG - Intergenic
1066598322 10:37076761-37076783 TGGACTAATCAGCAGGATGTGGG + Intergenic
1067470151 10:46530707-46530729 TTGACTACTGAGCAGCATTTTGG + Intergenic
1068155747 10:53195877-53195899 TTGGCTAAGGAGCCGTATCTTGG + Intergenic
1071054231 10:81490626-81490648 TGGACCAATCAGCAGCATGTGGG + Intergenic
1072422888 10:95304291-95304313 TTGACTTTTCAGCAGCATTTAGG - Intergenic
1075331877 10:121579942-121579964 TTGTCCCAGCAGCAGCTTCTAGG - Intronic
1075375896 10:121977842-121977864 TTGACCAATCAGCAGGATGTGGG - Intergenic
1081006745 11:37753785-37753807 TTGAAGTAGCAGCAGTATCTTGG - Intergenic
1081046293 11:38278255-38278277 TGGACCAATCAGCAGCATGTGGG - Intergenic
1082270310 11:50163473-50163495 TGGACCAATCAGCAGGATCTGGG - Intergenic
1083394444 11:62380311-62380333 TTGACTTTTGAGCAGCATCTCGG + Intronic
1086819943 11:91423360-91423382 TTGACTTAGCATCTGCTTCTAGG + Intergenic
1086862059 11:91936076-91936098 ATGACTAAGAAGATGCATCTCGG + Intergenic
1089765032 11:120757054-120757076 CTGACACAGCAGCAGCATCGTGG + Intronic
1091216470 11:133905378-133905400 TTGACGAAACAGTAGCTTCTAGG - Intergenic
1107791952 13:44011597-44011619 TTAACTAAACATCAGCATCAGGG - Intergenic
1108686832 13:52826861-52826883 TGGACCAATCAGCAGCATGTGGG + Intergenic
1111221036 13:85205669-85205691 TGGACCAATCAGCAGCATGTGGG + Intergenic
1114216469 14:20661087-20661109 TTTAGAAAGCAGCAGCCTCTGGG - Intergenic
1115607642 14:35020490-35020512 TTGATAAAGCAGCAGCAGCAGGG - Intronic
1115824836 14:37257981-37258003 TTGGCTAAGCTGCAGAATTTGGG + Intronic
1119896109 14:78221157-78221179 TTGACTATGCAGCCTCTTCTAGG + Intergenic
1122711464 14:103661605-103661627 TTGACTAATCAGCAAAATGTAGG + Intronic
1123138893 14:106056021-106056043 TTGACCAAGCAGAAACACCTGGG + Intergenic
1124211379 15:27767739-27767761 TGGACTAATCAGCAGGATGTGGG + Intronic
1125529046 15:40399573-40399595 TGGACCAATCAGCAGGATCTGGG + Intergenic
1125907978 15:43411032-43411054 GTGACTCAGCAGTAGAATCTTGG - Intronic
1128212877 15:65914591-65914613 TAGACTAAGCATCAGCATGGAGG - Intronic
1129518858 15:76173114-76173136 TTGAGGAGGCAGCGGCATCTTGG + Intronic
1131198357 15:90375338-90375360 TGGACTAATCAGCAGGATGTGGG + Intergenic
1132044331 15:98550532-98550554 TGGACCAATCAGCAGCATGTGGG + Intergenic
1133451933 16:5911065-5911087 TTGACTTAGCATCTGCTTCTAGG + Intergenic
1133841914 16:9417570-9417592 TTGCCTAAGCAGTAGGTTCTGGG - Intergenic
1134291481 16:12905330-12905352 TTGAATAAACATCAGGATCTGGG + Intronic
1135674251 16:24401955-24401977 TTTACTAAGCAAGAGCACCTTGG - Intergenic
1138433751 16:56985750-56985772 CTCACTAAGCAGGAGCATCATGG + Intergenic
1140878839 16:79178937-79178959 TTGACTATGCAGGACCTTCTAGG + Intronic
1141105353 16:81228978-81229000 TGGACAAAGCAGCAGAAACTTGG - Intergenic
1144792551 17:17868806-17868828 TTCCCTAAGCAGCAGCATTCCGG + Intronic
1148966950 17:51443571-51443593 TTGACTAAGCTGAGGCTTCTGGG + Intergenic
1150775956 17:68081687-68081709 TGGACCAATCAGCAGCATGTGGG + Intergenic
1153486166 18:5600796-5600818 TTGACTCTGCAGCGGCAGCTTGG - Intronic
1157115209 18:44856028-44856050 TGGATTAAGCAACAGCTTCTAGG - Intronic
1157261974 18:46183741-46183763 TTGTCTATGCTGCAGCTTCTTGG + Intronic
1163919966 19:20279164-20279186 TTGACTTTTGAGCAGCATCTTGG - Intergenic
1165606901 19:37113564-37113586 TTGACTTTTGAGCAGCATCTTGG + Intronic
1168148330 19:54431533-54431555 CTCACTAAGCGGCAGCCTCTAGG - Intronic
1168271165 19:55250585-55250607 TTGAGTAAGCACTAGCAGCTGGG - Intronic
924990720 2:310592-310614 TTTACTAAGCAGCAGAATCAAGG + Intergenic
925058895 2:876067-876089 CTGGCTAAGACGCAGCATCTGGG - Intergenic
925949203 2:8895204-8895226 TTGACCAATCAGCAGGATGTGGG - Intronic
925950283 2:8902919-8902941 TTGACCAATCAGCAGGATGTGGG - Intronic
928988106 2:37200428-37200450 TTGAGTATCCAGTAGCATCTTGG - Intronic
932598280 2:73107651-73107673 TTGCTTGAGCAGCAGCGTCTTGG - Intronic
934085247 2:88503920-88503942 TGGACCAATCAGCAGCATGTGGG + Intergenic
936384539 2:112017123-112017145 TGGACTAATCAGCAGGATGTGGG - Intronic
939124286 2:138157027-138157049 TTGTCTAAGCATCCGCTTCTGGG - Intergenic
939568974 2:143817907-143817929 TTTAATAAGCAGCAGCTTCCTGG + Intergenic
940572398 2:155455065-155455087 ATTACTAAGAAGCAGCATCACGG + Intergenic
940973017 2:159914006-159914028 TTAATAAAGCAGCAGCATCTAGG + Intergenic
942300756 2:174559379-174559401 TTGACTAAGATGCAGATTCTCGG + Intergenic
944686467 2:202122166-202122188 TTGCCTAAACAGCAGCATTTTGG - Intronic
947937413 2:234020039-234020061 TGGACCAAGCAGCAGCAGCATGG - Intergenic
1169676010 20:8155952-8155974 TTGACTAAGCAGCAGCATCTGGG + Intronic
1172711307 20:36926340-36926362 TTGATTAAGCAGAATCATATAGG - Intronic
1173313716 20:41924594-41924616 CTGAATTAGCAGCAGCATGTAGG + Intergenic
1174021666 20:47535277-47535299 TTGACTCCATAGCAGCATCTAGG + Intronic
1174162768 20:48563670-48563692 TGGACCAATCAGCAGCATGTGGG - Intergenic
1174976268 20:55339011-55339033 TAGACTAAGCAGTCGCTTCTTGG + Intergenic
1176007176 20:62872151-62872173 TTGGTTAAGAAACAGCATCTGGG - Intergenic
1176872119 21:14092422-14092444 TGGACCAATCAGCAGCATGTGGG - Intergenic
1181993995 22:26860488-26860510 TTGACCAATCAGCAGGATGTGGG + Intergenic
1184742060 22:46434321-46434343 CTGAGTCAGCAGCAGCAGCTGGG + Intronic
950942497 3:16907496-16907518 TTAACAAAGCAACAGCATTTGGG - Intronic
955493941 3:59511675-59511697 TGGACCAATCAGCAGGATCTGGG + Intergenic
955509617 3:59666127-59666149 TTTACCCAGCAGCAGCATTTAGG - Intergenic
956528457 3:70190341-70190363 TTGACCAGGCAGCAGCATGCAGG - Intergenic
958539154 3:95447747-95447769 CTGACTAAGCGGCAGGATGTAGG + Intergenic
958810629 3:98857428-98857450 TGGACTAATCAGCAGAATGTGGG - Intronic
960064106 3:113352236-113352258 TGGACCAATCAGCAGCATGTGGG + Intronic
960868450 3:122226556-122226578 TGGACTAATCAGCAGGATGTGGG - Intronic
961350246 3:126295896-126295918 ATGACTAAGAAGAAGCATCAGGG - Intergenic
969415374 4:7054263-7054285 GTGGCTGAGCAGCAGCAGCTGGG + Exonic
970604406 4:17665902-17665924 AAGACTAAGAAGCAGCAACTGGG - Intronic
971865264 4:32162067-32162089 TTAAATAAGCAGCAGGATTTAGG + Intergenic
973044619 4:45520110-45520132 TGGACCAATCAACAGCATCTGGG - Intergenic
975349242 4:73327636-73327658 TTGACTAACCAACAGCCACTTGG - Intergenic
975900271 4:79143080-79143102 TTGATAAAGCAGCAGCAGCAGGG - Intergenic
976690475 4:87863124-87863146 TGGACTAATCAGCAGGATGTGGG - Intergenic
976736157 4:88312494-88312516 TGGACTAATCAGCAGGATGTGGG - Intergenic
977331943 4:95647401-95647423 TTTGGTAAGCAGCAGCATCTAGG - Intergenic
978710699 4:111777125-111777147 CTGACTACGCCCCAGCATCTAGG + Intergenic
979154735 4:117370201-117370223 TTGACTATGCAGAAGCTTTTTGG + Intergenic
982024409 4:151236922-151236944 TGGACCAATCAGCAGCATGTGGG + Intronic
983215440 4:164998166-164998188 TTGACTTTTGAGCAGCATCTTGG - Intergenic
984095547 4:175428416-175428438 TGGACCAAACAGCAGCATGTGGG + Intergenic
984329919 4:178301264-178301286 TGGACTCAGCAGCAGAATCCAGG + Intergenic
984728796 4:183046172-183046194 TGGACTAATCAGCAGGATGTGGG + Intergenic
985024076 4:185721692-185721714 TTGACTATGCAGAAAGATCTGGG - Intronic
985979313 5:3449133-3449155 TTGACTAAGTTGCAGCATCTGGG + Intergenic
986577780 5:9230336-9230358 TTGACGAAGAACCAGCATGTTGG + Intronic
987095768 5:14548025-14548047 TTGATAAAGCAGCAGCAGCAGGG - Intergenic
988488674 5:31688908-31688930 TTTCCCAAGCAGCAGCATCAAGG + Intronic
989292462 5:39785589-39785611 TGGACCAATCAGCAGCATGTGGG - Intergenic
990537758 5:56739786-56739808 TTGTTTGAGCACCAGCATCTAGG + Intergenic
991107455 5:62860905-62860927 TAGAGTAACAAGCAGCATCTTGG - Intergenic
991207516 5:64066381-64066403 TTCTTTAAGCAGCAGCCTCTTGG + Intergenic
991702661 5:69330881-69330903 TTGACTTGGCAGCAGTATGTAGG - Intronic
993663928 5:90671484-90671506 TTCACTGAGCAGCAGCAACCTGG - Intronic
994239987 5:97407997-97408019 TGGACCAATCAGCAGGATCTGGG + Intergenic
1003909877 6:10733562-10733584 TGGACCAATCAGCAGCATGTGGG - Intergenic
1004669792 6:17785028-17785050 GAGAATAAGCAGCAGCAGCTAGG + Intronic
1008147730 6:47911949-47911971 TAGACTGAGAAGCAGCATCCAGG + Intronic
1011978407 6:93337767-93337789 TGGAAAAAGCAGCAGCATCCTGG + Intronic
1014446290 6:121531915-121531937 GTCACAAAGCAGCAGCATATCGG + Intergenic
1014904219 6:127006835-127006857 TTGTGTAATTAGCAGCATCTTGG - Intergenic
1016021036 6:139236311-139236333 CTGACTCCACAGCAGCATCTAGG - Intergenic
1018487484 6:164256687-164256709 TTGACTAAGTCTCAGGATCTAGG + Intergenic
1021567520 7:22029569-22029591 TGGACCAAGCAGCAGGATGTGGG + Intergenic
1021763575 7:23924975-23924997 TTGGAAATGCAGCAGCATCTAGG - Intergenic
1023396078 7:39753404-39753426 TGGACCAATCAGCAGCATGTGGG - Intergenic
1023444649 7:40218860-40218882 TGGACCAATCAGCAGCATGTGGG + Intronic
1024643598 7:51352744-51352766 TTTTCCAAGCAGCAGCATGTGGG + Intergenic
1024811395 7:53217020-53217042 TGGACCAATCAGCAGCATGTAGG + Intergenic
1026101291 7:67386590-67386612 GTGAATAGGCCGCAGCATCTGGG + Intergenic
1029206212 7:98870492-98870514 TTGAATGAGGAGTAGCATCTCGG - Intronic
1033649235 7:143328208-143328230 TTTGCTAATCAGCAGCATATAGG + Intronic
1034261579 7:149760053-149760075 TTGAAAAGGCAGCAGCAACTTGG + Intergenic
1035234362 7:157487051-157487073 ATTTCTAAGCAGCAACATCTGGG - Intergenic
1044329061 8:90895053-90895075 TTGACTAAGCTGCTGCTTATGGG + Intronic
1049985095 9:942997-943019 TTCACTAAGCAGCATCATATAGG - Intronic
1050313674 9:4379060-4379082 TTGCCTAACCTGCAGCCTCTCGG + Intergenic
1050768933 9:9172494-9172516 TAGATTAAGCAGCATTATCTCGG + Intronic
1054948319 9:70821157-70821179 TTAACTCAGTAGCAGCATCATGG - Intronic
1055702349 9:78959100-78959122 TTGAATGAGCAGAAGCATCGTGG + Intergenic
1055819386 9:80243572-80243594 TTGACTAATCAGCTCCAGCTTGG + Intergenic
1056799646 9:89682001-89682023 TGGACTAATCAGCAGGATGTGGG + Intergenic
1057457879 9:95230813-95230835 TGGACTAATCAGCAGGATGTGGG - Intronic
1060478404 9:124001597-124001619 TTTTAAAAGCAGCAGCATCTGGG - Intergenic
1061049976 9:128189517-128189539 TAGAATCAGGAGCAGCATCTTGG + Intronic
1061334290 9:129920964-129920986 TTGAGTAATCTGCAGCTTCTTGG - Intronic
1061576132 9:131507743-131507765 TGGACTTTGCAGCAGCATCTGGG - Intronic
1062487519 9:136787191-136787213 TTGACTTTTGAGCAGCATCTTGG + Intergenic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1194960381 X:100228498-100228520 TTGACCAACCAGCAGCCACTTGG + Intergenic
1197408330 X:126083830-126083852 TTGACTCAGAAGCAGCAGCTCGG - Intergenic
1199434097 X:147793878-147793900 ATGACTAAGAAGAAGAATCTAGG - Intergenic
1200852836 Y:7903568-7903590 TTGACTGTTCAGCAGCACCTAGG - Intergenic
1200960110 Y:8988719-8988741 TGGACTAATCAGCAGGATGTGGG + Intergenic