ID: 1169676587

View in Genome Browser
Species Human (GRCh38)
Location 20:8161269-8161291
Sequence ATGTATGTATATATGTAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1184
Summary {0: 1, 1: 2, 2: 8, 3: 95, 4: 1078}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169676587 Original CRISPR ATGTATGTATATATGTAGCA CGG (reversed) Intronic
901309056 1:8254990-8255012 ATATATATATATATATATCAGGG - Intergenic
902149610 1:14432615-14432637 ATGTAGGTATACATGTGCCATGG + Intergenic
902440520 1:16426552-16426574 ATATATATATATATATAGCCGGG - Intronic
902913705 1:19622184-19622206 GTGTATACATATACGTAGCAGGG + Intronic
903482481 1:23664049-23664071 ATATATATATAAATGTAACAAGG - Intergenic
904336183 1:29799955-29799977 ATATATATATATATGTATAAAGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
904984355 1:34532613-34532635 ATGTATTTATATATAGAGCTAGG + Intergenic
905411244 1:37769992-37770014 GTGTATGTATATATGTATTAGGG - Intergenic
905642603 1:39601588-39601610 ATATATATATATATATGGCACGG + Intergenic
905767182 1:40610845-40610867 AAGTATGAAAATATGTTGCAAGG + Intergenic
905836137 1:41123218-41123240 ATGTATGTATGTATGTATTGAGG - Intronic
906768795 1:48463336-48463358 ATGTATGTGTATAGGTAGGGGGG + Intronic
906978361 1:50600506-50600528 TTGTGTGTGTATATGTGGCAAGG - Intronic
907362870 1:53934474-53934496 ATGTCTGTATTTATCTAGCTTGG + Intronic
908382877 1:63613090-63613112 TTGTTTGTGTATATGGAGCATGG + Intronic
908384906 1:63632362-63632384 ATGTATGTGTATAGGTTTCAGGG - Intronic
908891290 1:68850959-68850981 ATATATATATATATGCACCATGG - Intergenic
908965364 1:69755406-69755428 ATATATATATATATTTTGCAAGG + Intronic
909107164 1:71426043-71426065 ATGTATGCATATATGTATGTAGG - Intronic
909208792 1:72795638-72795660 ATATATATATATATGTGCCAGGG + Intergenic
909258528 1:73456041-73456063 ATGTATGTATGTATGTATACTGG - Intergenic
909607834 1:77524354-77524376 ATGTATGTATATGTGTAGTATGG - Intronic
909717968 1:78733104-78733126 ATGTATGTATATTTTTAGGAGGG - Intergenic
909909545 1:81245074-81245096 ATATATGTATACATGTGCCATGG - Intergenic
910054707 1:83018889-83018911 ATGTATACACATATATAGCAGGG - Intergenic
910153224 1:84180196-84180218 ATATATATATATATGTATGATGG + Intronic
910325015 1:85996827-85996849 ATGTGTGTATGTTTGCAGCATGG + Intronic
911086540 1:93982452-93982474 ATATATATATATATATATCATGG - Intergenic
911428371 1:97751480-97751502 ATATATATATATATATGGCAGGG + Intronic
911688942 1:100809174-100809196 ATTTATGTTTATGTGTAGCTTGG - Intergenic
911761516 1:101622651-101622673 ATGTATGTGTATATATATCCAGG + Intergenic
911908450 1:103599464-103599486 ATATATATATATATATAGCAAGG - Intergenic
911914470 1:103680000-103680022 ATATATATATATATATAGCAAGG + Intronic
911941677 1:104055425-104055447 ATATATATATATATATGGCAAGG - Intergenic
912053448 1:105562871-105562893 ATATATATATATATGCAACAAGG - Intergenic
912325586 1:108757144-108757166 TTGTATGTATATATGAAGATGGG + Intronic
912604623 1:110976544-110976566 TTGTATGTGTATATGTAAAAGGG + Intergenic
912732960 1:112126060-112126082 ATATATGTATATATTTATAAAGG + Intergenic
912774652 1:112497966-112497988 ATATAGGTATACATGTACCATGG + Intronic
912897213 1:113604955-113604977 ATATATGTATATTTATATCAGGG - Intronic
913365225 1:118030477-118030499 ACATAGGTATATATGTACCATGG + Intronic
913962396 1:143350496-143350518 ACATATGTATATATGTGCCATGG - Intergenic
914056751 1:144176072-144176094 ACATATGTATATATGTGCCATGG - Intergenic
914122395 1:144790290-144790312 ACATATGTATATATGTGCCATGG + Intergenic
914689630 1:150014090-150014112 ATATATATATATATATAGTAGGG + Intergenic
914739278 1:150450309-150450331 ATGTATTTATTTATTTAGCCGGG + Intronic
914977486 1:152379678-152379700 AAGTGTGTATATATCTATCAGGG + Intergenic
915174939 1:154006811-154006833 ATATATATATATATATGGCATGG - Intronic
915683953 1:157611897-157611919 ATGTGTATATATATATAACATGG + Intergenic
915698897 1:157772034-157772056 ATATATATATATATTTAGCAGGG + Intronic
915870429 1:159554320-159554342 AGGTATTTATATATGTAACAGGG - Intergenic
916188416 1:162155217-162155239 ATGTATATATATATGTATAAAGG - Intronic
916320006 1:163493368-163493390 ATGTATGTATGTATGTATTATGG + Intergenic
916392502 1:164345897-164345919 ATATATATATATATATAGCCAGG + Intergenic
916765213 1:167853667-167853689 CTGTATATATCTGTGTAGCACGG + Intronic
917372359 1:174308210-174308232 ATGTATGTGTATATGTATACAGG + Intronic
917682148 1:177378136-177378158 ATGTATGTATGTATGTAAAGGGG - Intergenic
917715204 1:177728291-177728313 ACGTATGTATACATGTGCCATGG - Intergenic
917899215 1:179525476-179525498 ATGTATGTATGTATGTATGTAGG - Intronic
918485026 1:185019671-185019693 TTGGATGAATAAATGTAGCAGGG + Intergenic
918658149 1:187054437-187054459 ATTTATGCATATCTGTAGCTTGG - Intergenic
918681686 1:187362967-187362989 ATATATATATATATGTATAAAGG - Intergenic
918717591 1:187809660-187809682 ATGTATGTATGTAGGTAGGTAGG - Intergenic
918717592 1:187809664-187809686 TTGTATGTATGTATGTAGGTAGG - Intergenic
918721341 1:187856041-187856063 ATATATGTATATATATATGAAGG - Intergenic
918760291 1:188396135-188396157 ATGTATATATATATATAACATGG + Intergenic
918966962 1:191363367-191363389 GTGTATGTATGTATGTATCCAGG + Intergenic
919065779 1:192691469-192691491 AACTATGTACATATGTAGCTAGG - Intergenic
919067156 1:192707009-192707031 TTGTATGTAAATAGGTACCATGG - Intergenic
919090243 1:192970268-192970290 TTGTATGTATATATGTATGTAGG - Intergenic
919111508 1:193225241-193225263 ATATATATATATATATATCATGG - Intronic
919244001 1:194953621-194953643 ATATATATATATATATACCATGG + Intergenic
919337559 1:196257455-196257477 ACGTATATAAATATGTAACATGG - Intronic
919495416 1:198260079-198260101 ATGGATTTTTATATGTAGAAAGG + Intronic
919548965 1:198960881-198960903 ATGTATCTATATATATATGATGG - Intergenic
920939671 1:210469886-210469908 ATATAGGTATACATGTACCATGG + Intronic
921688827 1:218123533-218123555 ATATATATATATATATAGTATGG - Intergenic
921790076 1:219279709-219279731 ATGTTTGTTTAATTGTAGCATGG + Intergenic
921889012 1:220335155-220335177 ATCTAAATATATATGTAGCCAGG - Intergenic
921973121 1:221172801-221172823 TAGTATGTATGTATGTGGCATGG + Intergenic
922091757 1:222402020-222402042 ATGCATGTATGTATGTATGAAGG - Intergenic
922094310 1:222429575-222429597 ATATATATATATATATACCATGG + Intergenic
922181835 1:223241946-223241968 ATGTATGTATGTATGAGACAGGG + Intronic
922282926 1:224143095-224143117 ATATATGTATTTATTTAGCTGGG - Intronic
922736542 1:227985945-227985967 CTATATATATATATGTAGCAAGG + Intergenic
922997008 1:229972139-229972161 ATGCATGTATATATGTAGTGTGG - Intergenic
923218105 1:231868722-231868744 ATATATATATATATTTAGCTGGG + Intronic
923722421 1:236478484-236478506 ATATATGTATATATATATGATGG + Intronic
924551752 1:245084493-245084515 GTGTATGCATATATGTATGATGG - Intronic
924621192 1:245662461-245662483 GTGTGTGTATATATGTATCATGG - Intronic
924807586 1:247373556-247373578 ATATATATATATATTTAGCCGGG + Intergenic
924865426 1:247974364-247974386 ATGTAGGTATACATGTACCATGG - Intronic
1063307243 10:4915682-4915704 ATATATATATATATGTAGGCTGG - Intergenic
1063438268 10:6051812-6051834 ATATATATATATATATAGCTGGG - Intronic
1063456681 10:6187994-6188016 ATATATATATATATGTAGGTAGG - Intronic
1063661892 10:8040101-8040123 ATATATGTATATATATATCCTGG - Intergenic
1063776389 10:9269953-9269975 ATGTATGTATATATGATGTGTGG - Intergenic
1063859706 10:10294496-10294518 GTGTGTGTGTGTATGTAGCAGGG + Intergenic
1064434717 10:15301339-15301361 ATATATATATATATATAGCTGGG - Intronic
1065364313 10:24920315-24920337 GTGTATATATATATATACCATGG + Intronic
1065692826 10:28353075-28353097 GTGTATGTGTGTGTGTAGCAGGG + Intergenic
1065874737 10:29987292-29987314 ATATATGTATATATATACCATGG - Intergenic
1066351327 10:34639970-34639992 ATCTATGTTTGTATGTAACATGG - Intronic
1066562508 10:36685492-36685514 ATATATGTATATATATATAATGG - Intergenic
1066598521 10:37078401-37078423 ATGTATGTTTAGAGGTAGAATGG + Intergenic
1067125135 10:43509465-43509487 ATATATATATATATATATCATGG + Intergenic
1067901254 10:50244029-50244051 AAGTATGAAAATATGTTGCAAGG + Intronic
1068249285 10:54416122-54416144 GTGTATATATATATTTAGCTTGG - Intronic
1068292632 10:55023862-55023884 ATACATGTATATATATAGGAAGG - Intronic
1068292640 10:55024075-55024097 ATATATATATATATATAGGAAGG + Intronic
1068292644 10:55024123-55024145 ATATATATATATATATAGGAAGG + Intronic
1068319062 10:55386663-55386685 ATGCAAGTATTTATGTAGGATGG - Intronic
1068468360 10:57426216-57426238 ATTTGTTTACATATGTAGCATGG + Intergenic
1068514877 10:58013105-58013127 ATGTTTATATGCATGTAGCAAGG + Intergenic
1069245459 10:66199760-66199782 ATATATATATATATATAGCCAGG - Intronic
1069306588 10:66978555-66978577 ATATATATATATATATAGTATGG + Intronic
1069506011 10:68998722-68998744 ATGTATGTATGTATGTAGTGGGG - Intronic
1069649382 10:70033692-70033714 TTGTAAGTATATATATTGCAGGG + Intergenic
1069998295 10:72356878-72356900 ATATATATATATATGCACCAAGG + Intergenic
1070245508 10:74727978-74728000 ATATATATATATATTTAGCCAGG + Intergenic
1070478925 10:76861640-76861662 GTGTATGTATATATGTTATATGG - Intergenic
1071054286 10:81491131-81491153 GTGTGTGTATATATATATCATGG - Intergenic
1071390917 10:85174667-85174689 GTGAATGTAGATAGGTAGCAGGG + Intergenic
1071703011 10:87962573-87962595 ATGTATGTATGTATGTATATTGG + Intronic
1071812008 10:89192568-89192590 ATGTGTGTATATATATATAAAGG + Intergenic
1072220322 10:93321795-93321817 ATGTATGTATATGTATAGCTTGG + Intronic
1072464047 10:95646795-95646817 ATGTGTGTACAGATGTGGCATGG + Intronic
1072501799 10:96025205-96025227 ATATATATATATATATAGCTGGG + Intronic
1072567449 10:96628914-96628936 ATATATATATATATATGGCAAGG + Intronic
1072761299 10:98059169-98059191 ATTTATGTAGTAATGTAGCATGG + Intergenic
1072969763 10:100007177-100007199 GTGTATGTATATGTGTGGTAGGG - Intronic
1073653635 10:105388427-105388449 TTGTGTGTATATATGTATGAAGG - Intergenic
1074119126 10:110480234-110480256 GTGTATGTATATATATAGTCTGG - Intergenic
1074980756 10:118618397-118618419 ATGTATGTGTATATGTATTTCGG + Intergenic
1075411147 10:122228963-122228985 ATATATATATATATGAAGTAAGG - Intronic
1076926938 10:133495808-133495830 ATATATGTATATATGTAAATGGG + Intergenic
1077941372 11:6847144-6847166 ATGTTTGTTGATATTTAGCATGG + Intergenic
1077975822 11:7247458-7247480 ATATATGTATATATATATGATGG - Intronic
1078343544 11:10521787-10521809 ATGTCTGTGTATATGTAACCAGG + Intronic
1078481210 11:11677280-11677302 ATGTATGTATGTATGTGAGATGG - Intergenic
1078481899 11:11684504-11684526 ATATATGTATACATGTAGAATGG - Intergenic
1078684958 11:13520726-13520748 ATATAGGTATATATGTGCCATGG - Intergenic
1079188183 11:18255756-18255778 ATGTATATATATATGTATATTGG + Intergenic
1079376165 11:19893978-19894000 ATGGATGGATATATATAGAATGG - Intronic
1079634451 11:22718296-22718318 TTGTGTGTATATATGTATCATGG + Intronic
1079681975 11:23308626-23308648 CTGTATGTATATTTGTATAAGGG + Intergenic
1079919491 11:26414687-26414709 ACATATGTATACATGTACCATGG - Intronic
1080480416 11:32643074-32643096 ATGGATTTATATATGTAATATGG - Intronic
1080522960 11:33083604-33083626 ATATAAATTTATATGTAGCAAGG - Intronic
1080670834 11:34376043-34376065 AAATATGTATGTATGTGGCAGGG - Intergenic
1080713648 11:34775307-34775329 CGGGATGTATATATGGAGCAGGG + Intergenic
1080884262 11:36350897-36350919 ATATATATATATATTTACCATGG - Intronic
1081068591 11:38579865-38579887 ATGTAAGTATACATGTGCCATGG + Intergenic
1082119350 11:48361663-48361685 ATGTATGTATGTATGTATGTAGG + Intergenic
1082251105 11:49981186-49981208 AAGTATGTATATATTAAGCCAGG + Intergenic
1082934672 11:58644417-58644439 ATATATATATATATATAGAATGG - Intronic
1083366463 11:62144500-62144522 ATATATGTATACATATAGTATGG + Intronic
1083602426 11:63957187-63957209 ATATATATATATATATATCAAGG - Exonic
1083980652 11:66165717-66165739 ATTTATATATATATGTATTAAGG + Intronic
1084498481 11:69519945-69519967 ATATATATATATATATAGCTGGG + Intergenic
1084544362 11:69807125-69807147 ATATATGTATATATATATAAAGG - Intergenic
1085028325 11:73253475-73253497 GTGTATGTATGTATGTATCCAGG - Intergenic
1085028327 11:73253520-73253542 ATATATATATATATATAGTAGGG + Intergenic
1085819940 11:79781496-79781518 GTGTGTGTATATATTTGGCAGGG + Intergenic
1086409855 11:86534097-86534119 ATATATATATATATGTAAAATGG + Intronic
1086797197 11:91121213-91121235 ATGTATGTATATACATACAATGG - Intergenic
1087291795 11:96328141-96328163 ATGTGTGTATATATGTGTGATGG + Intronic
1087308684 11:96514329-96514351 ACATATGTATACATGTACCATGG - Intergenic
1087450551 11:98316350-98316372 ATATATATATATATGCACCAGGG + Intergenic
1087737254 11:101848939-101848961 ATCTATGTATATGTGTATCTAGG - Intronic
1088495385 11:110426793-110426815 ATGTATATATATATGGACCTAGG - Intergenic
1088968393 11:114749280-114749302 GTGTATGTATATATGCATAATGG - Intergenic
1088999175 11:115035365-115035387 ATCTACATATATATTTAGCAAGG - Intergenic
1089264249 11:117246978-117247000 GTGTATGTATATATGCATGAGGG + Intronic
1089819891 11:121215342-121215364 ATATATCTATATATGTGCCATGG + Intergenic
1090102445 11:123814000-123814022 ATATATATATATATGCAGAAAGG - Intergenic
1090284005 11:125483115-125483137 AAGTATGTATATATACACCAGGG + Intronic
1090341811 11:126029547-126029569 ATATATATATATATGTTACATGG - Intronic
1090470291 11:126974916-126974938 ATGTATGTATTTATTTATGATGG + Intronic
1090705542 11:129333097-129333119 ATATATATATATATTTAGCCAGG + Intergenic
1091025058 11:132134700-132134722 ATATATATATATATATACCATGG - Intronic
1091199288 11:133761161-133761183 ATATATGTATATATTTTGTAAGG + Intergenic
1091670010 12:2446173-2446195 ATGGATGGATATATGTAGGTGGG + Intronic
1092311640 12:7362070-7362092 ATGTATGTGTATATATACAATGG - Intronic
1092598871 12:10036879-10036901 ATGAATGCATATATGTATGACGG - Intronic
1092759904 12:11800339-11800361 ATGTATGTATACATGTGGACTGG + Intronic
1093218550 12:16391204-16391226 ATGTAGGTATACATGTACCACGG + Intronic
1093390629 12:18615371-18615393 ATGTGTATATATATATATCACGG + Intronic
1093625492 12:21341927-21341949 GTGTATGTATAAATGAGGCATGG + Intronic
1095256225 12:40039953-40039975 ATGTGTGAATGTATGGAGCATGG - Intronic
1095356954 12:41285930-41285952 ATGTAGGTATACATGTGCCATGG - Intronic
1095404717 12:41855338-41855360 AGGTATGTATACATGTGCCATGG - Intergenic
1095536065 12:43249234-43249256 ATATATGTATATATACACCATGG + Intergenic
1096055466 12:48647272-48647294 ATGTATGTAAATATGTATGTAGG - Intergenic
1096957242 12:55539129-55539151 ATATATATATATATGTAAAAAGG - Intergenic
1097417842 12:59335322-59335344 CTCTTTGTATATATGTAGGATGG - Intergenic
1097487150 12:60218076-60218098 GTGTGTGTATATATGTAAAATGG - Intergenic
1097585282 12:61507819-61507841 ATGTATGTATATATACTGTATGG + Intergenic
1097592341 12:61588794-61588816 ATTCATGTATATATTTAGTAGGG - Intergenic
1097933260 12:65214401-65214423 ATATATATATATACGTAGGAAGG + Intronic
1097967179 12:65593935-65593957 ATATCTGTATATATGTATAATGG + Intergenic
1098011874 12:66061838-66061860 ATATATATATATATATAGGAGGG + Intergenic
1098179009 12:67825818-67825840 TCATATGTATACATGTAGCAAGG - Intergenic
1098254640 12:68604708-68604730 ATGTATGTATATATAGTGTATGG - Intergenic
1098561745 12:71881051-71881073 ATGATGGTATATATGTAGAAAGG - Intronic
1098708734 12:73726227-73726249 ATGCATGCATATTGGTAGCAGGG + Intergenic
1098761208 12:74427580-74427602 ATGTAGGTACACATGTGGCATGG + Intergenic
1098782452 12:74703974-74703996 ATGTATGTATGTATATAGTTGGG - Intergenic
1098794096 12:74866496-74866518 ATATATATATATATATAGCCAGG - Intergenic
1099033160 12:77554260-77554282 ATGTATTTATATATGCACTAGGG + Intergenic
1099418605 12:82424546-82424568 ATATATATATATATGTATAAAGG + Intronic
1099552585 12:84066740-84066762 ATGTATGTATGTATATATGATGG + Intergenic
1099725887 12:86427210-86427232 ATTTATGTGTAAATGTAGAATGG - Intronic
1099792505 12:87353732-87353754 ATGTTTGTATTTGTGTAACATGG - Intergenic
1100062430 12:90597060-90597082 ATATATGTATATATATATAATGG - Intergenic
1100074669 12:90765435-90765457 CTGTATGTGTATATGTATTAGGG - Intergenic
1100175416 12:92024770-92024792 ATATATATATATATATGGCATGG + Intronic
1100394927 12:94177247-94177269 ATATATGTATATATATATGAGGG + Intronic
1100545414 12:95597471-95597493 TTATATATATATATGTAGCTGGG + Intergenic
1101244046 12:102868188-102868210 ATATATATATATATATATCAGGG + Intronic
1101411887 12:104475772-104475794 ATATATGCATATATATGGCAGGG - Intronic
1101907955 12:108841846-108841868 ATATATATATATATATAGCTAGG + Intronic
1102064350 12:109961146-109961168 GTGTGTGTATATATGTATAAAGG + Intronic
1102265851 12:111484169-111484191 CTGTAGGTATATATAAAGCAAGG + Intronic
1102897289 12:116608652-116608674 GTGTGTGTATATATGTCACATGG + Intergenic
1103509282 12:121463400-121463422 ATATAGGTATACATGTGGCATGG - Intronic
1103538038 12:121646885-121646907 ATGTATGTATATATTTATTTGGG - Intergenic
1105591110 13:21793859-21793881 ATATATGTATATATATATAAAGG + Intergenic
1106079973 13:26492157-26492179 ATAGATGTATATATGAAGGAGGG + Intergenic
1106292020 13:28372586-28372608 ATATATATATATATATAGCTGGG + Intronic
1106663025 13:31822260-31822282 ATATATGTGTTTATGAAGCAAGG - Intergenic
1107396819 13:40026689-40026711 ATATATGTATATATTATGCAGGG + Intergenic
1107741763 13:43457917-43457939 ATGTGTATATGTATGTACCAAGG + Intronic
1107920729 13:45204209-45204231 ATATATGTATATGTGTGGAATGG + Intronic
1108008925 13:45983392-45983414 ATATATATATATAAGTAGAAGGG - Intronic
1108043698 13:46362958-46362980 ATATATATATATATATATCAGGG + Intronic
1108115481 13:47123077-47123099 ATGTATATATGTATATAGTATGG + Intergenic
1108163048 13:47662792-47662814 GTGTATGTATGTATGTAGGCAGG - Intergenic
1108327262 13:49346107-49346129 ATATATATATATATATATCATGG + Intronic
1108444697 13:50496213-50496235 ATGTATGTATCTATGTGTCTAGG + Intronic
1108551073 13:51545384-51545406 ACGTAGGTATATATGTGCCATGG + Intergenic
1108666715 13:52640108-52640130 ATGTGTGTATTTTTGTAGAAAGG + Intergenic
1108822089 13:54364311-54364333 ATATATATATATATGTAGAAAGG + Intergenic
1108826025 13:54413607-54413629 ATATATATATATATGAAGGATGG + Intergenic
1108995244 13:56723473-56723495 ATGTATGTATATATGTGTATTGG - Intergenic
1109066065 13:57693328-57693350 ATATATATATATATATATCAAGG + Intronic
1109215179 13:59581574-59581596 ATGTATGTATTTAAGCATCAGGG + Intergenic
1109347157 13:61127574-61127596 ATATATATATATATATGGCAAGG + Intergenic
1109413891 13:62010136-62010158 ATGTGTATATATATATATCAAGG + Intergenic
1109471965 13:62819675-62819697 ATATATCTATATATTTAGAAAGG - Intergenic
1109633820 13:65086454-65086476 AAGTATCTATAAATGTAGAAAGG + Intergenic
1109664259 13:65510017-65510039 ATGAATGTAGAAATATAGCATGG + Intergenic
1109996999 13:70141837-70141859 ATGTATGTATATATGTGTGTTGG - Intergenic
1110165529 13:72438243-72438265 ATATATGTAAATATGCAGGATGG - Intergenic
1110165562 13:72438762-72438784 ATATATGTATATATGTATGTGGG - Intergenic
1110165565 13:72438829-72438851 ATATATGTATATATGTATGTGGG + Intergenic
1110620063 13:77585274-77585296 ATGTAGGGATGTATATAGCATGG + Intronic
1110755801 13:79172325-79172347 ATGTATATATATATATACCATGG - Intergenic
1110921990 13:81099813-81099835 ATTACTGTGTATATGTAGCAAGG - Intergenic
1110929810 13:81200645-81200667 ATATATAAATATATGTAGCCTGG - Intergenic
1111082190 13:83325167-83325189 ATGTTTGTGTGTATGTGGCAGGG - Intergenic
1111116695 13:83787704-83787726 GTGTATGTATATATATAAAATGG - Intergenic
1111151472 13:84259654-84259676 GTGTGTGTATATATATATCAAGG - Intergenic
1111378863 13:87419294-87419316 ACGTATGTGTATATATATCAGGG - Intergenic
1111517174 13:89350180-89350202 ATATATTTATATATATAGCCGGG + Intergenic
1111884200 13:93998764-93998786 ATGTGTGTATATATATATAATGG + Intronic
1111908269 13:94281242-94281264 ATGTAGGTATACATGTGCCATGG + Intronic
1112112454 13:96317378-96317400 ATATATATATATATATATCATGG + Intronic
1112112455 13:96317402-96317424 ATATATATATATATATATCATGG + Intronic
1112124004 13:96444664-96444686 ATGTAGGAATATATTTAGTAGGG + Intronic
1112150965 13:96763328-96763350 ATATATTTATATAACTAGCAGGG + Intronic
1112665289 13:101564570-101564592 ATGTACATATATATGTATCCTGG + Intronic
1112704131 13:102047263-102047285 ATGTATGTGTATGTGTGGGATGG - Intronic
1112907389 13:104441477-104441499 ATGTATCTATATATTTAGATAGG - Intergenic
1112945872 13:104926274-104926296 ATGTATATATATATATATGATGG + Intergenic
1112953079 13:105026531-105026553 ATGTATATTTATATGTGGGAAGG - Intergenic
1113015014 13:105818923-105818945 ACGTATTTGTGTATGTAGCAGGG - Intergenic
1114329624 14:21623485-21623507 ATGTATGTATGTATGTATGATGG + Intergenic
1114591709 14:23871147-23871169 ACGTAAGTATACATGTATCATGG - Intergenic
1115019876 14:28664559-28664581 ATATATATATATATGTATGATGG + Intergenic
1115190118 14:30739116-30739138 ATGTATGTATGTATGAGACAGGG + Intergenic
1115271233 14:31555831-31555853 ATGTATGTATCTTTGTAGATGGG - Intronic
1115480263 14:33853637-33853659 ATATATATATATATGTGGCTTGG + Intergenic
1115533528 14:34350825-34350847 ATGTATTTATATATGTCAAAAGG + Intronic
1115680940 14:35737436-35737458 ATGTATTTTTATATGCAGCTGGG - Intronic
1115987747 14:39119968-39119990 AAGGATGTATGTATGTAGTAGGG + Intronic
1116115071 14:40637520-40637542 ATGTATATATATATGTATATTGG + Intergenic
1116332871 14:43616971-43616993 ACATAGGTATATATGTTGCATGG - Intergenic
1116678036 14:47930639-47930661 ATGTAGGTATATATGAAGCCAGG - Intergenic
1116682334 14:47988405-47988427 ATGTATGTGTATAAATAGAAAGG + Intergenic
1117125738 14:52623170-52623192 ATGAATGTACAGATGTGGCAGGG - Intronic
1117784888 14:59272649-59272671 ATGTATGTATGTATGTATGTAGG + Intronic
1118297391 14:64583050-64583072 ATATATATATATATATAGCTGGG - Intronic
1118407653 14:65442510-65442532 ATGTATGTATGTATTTATGATGG - Intronic
1119129936 14:72162832-72162854 ATGTGTGTATATATATATGATGG + Intronic
1119586430 14:75840289-75840311 ATGTAGGTATACATGTGCCATGG + Intronic
1120009008 14:79392055-79392077 ATGTAGGTATACATGTGCCATGG + Intronic
1120045903 14:79805682-79805704 ATGTATATATATATTTTCCATGG + Intronic
1120355942 14:83434040-83434062 ATATATGTATATATATATGATGG - Intergenic
1120569753 14:86102116-86102138 ATGTATATATATATATACCAGGG + Intergenic
1121483649 14:94297054-94297076 ATGTGTGTGTGTATGTTGCAAGG - Intergenic
1121596108 14:95164028-95164050 ATGTATATATATGTGTATTAGGG - Intergenic
1121866124 14:97364322-97364344 AAGTATGAAAATATGTTGCAAGG - Intergenic
1122003210 14:98681722-98681744 ATGTATGTATGTATGTACAGAGG - Intergenic
1123184121 14:106498296-106498318 GTGTGTGTATATATTTACCATGG - Intergenic
1123584924 15:21750641-21750663 ATGTATGTATGTATGTATGTAGG + Intergenic
1123723185 15:23077991-23078013 ATGTATGTATGTATTTATGATGG + Intergenic
1123896425 15:24834763-24834785 ATATATATATATATATAGCCAGG + Intronic
1124016329 15:25879082-25879104 ATGTAGGTATACATGTGCCATGG - Intergenic
1125074240 15:35594372-35594394 ATGTATGGATTTATGATGCATGG - Intergenic
1125180267 15:36874945-36874967 ATATATATATATATGTAGTTGGG + Intergenic
1125220292 15:37324915-37324937 ATTTTTGTATATATGGAGTAAGG - Intergenic
1125587445 15:40830875-40830897 ATGCATGTAAACATTTAGCATGG + Intergenic
1126035387 15:44540230-44540252 ATATATATATATATATAGCCAGG - Intronic
1126139029 15:45421606-45421628 GTGTATGTGTATATGTACAAGGG - Intergenic
1126430194 15:48575349-48575371 ATGTATGTATGTATGTATTTAGG + Intronic
1126469570 15:48993687-48993709 ATATATATATATATATAGCTTGG + Intronic
1126576572 15:50203025-50203047 ATATATATATATATATAGCCAGG + Intronic
1126596693 15:50390418-50390440 ATATATATATATATATAGCATGG + Intergenic
1127348272 15:58124042-58124064 ATGTGTGTATATATGTATAAAGG + Intronic
1127425349 15:58850592-58850614 ATTTATTTATATATGAAACAGGG + Intronic
1127565464 15:60184042-60184064 ATGTATGTATGTATACATCATGG - Intergenic
1127749530 15:62019943-62019965 ATGTATATATATATATAGGCTGG - Intronic
1127934472 15:63623620-63623642 ATGTTTTTATAAATGTAGCAAGG - Intronic
1127956937 15:63862056-63862078 GTGTATGTGTGTGTGTAGCAAGG + Intergenic
1128042830 15:64590686-64590708 ATGTATATATATATGTATCTGGG + Intronic
1128164274 15:65448910-65448932 ATATATATATATATTTAGCCTGG + Intronic
1128551258 15:68599421-68599443 ATGTATTTATATTTTTTGCATGG + Intronic
1129017152 15:72478434-72478456 ATGTAACTATATAAGTAGCTAGG + Intronic
1130244311 15:82230149-82230171 ATGTATATATCTATGTAAAAAGG + Intronic
1130271837 15:82455715-82455737 ATGTGTGTATATATATATGAGGG - Intergenic
1130456141 15:84110977-84110999 ATGTATATATCTATGTAAAAAGG - Intergenic
1130464188 15:84183094-84183116 ATGTGTGTATATATATATGAGGG - Intergenic
1130488499 15:84411731-84411753 ATGTGTGTATATATATATGAGGG + Intergenic
1130500078 15:84490437-84490459 ATGTGTGTATATATATATGAGGG + Intergenic
1130730669 15:86488680-86488702 AGGTATGTATATATGTAGGGAGG - Intronic
1131068944 15:89452177-89452199 ATGCATGTATAAATGTATCATGG - Intergenic
1131371363 15:91884822-91884844 ATATATGAAAATATGCAGCATGG - Intronic
1131924514 15:97367461-97367483 ATGTGTGTATATATATATGAAGG - Intergenic
1131942037 15:97577565-97577587 ATGTAGGTATATGTGTGCCATGG + Intergenic
1132111338 15:99104524-99104546 ATATATATATATATGGAGCCTGG - Intronic
1132262301 15:100436568-100436590 ATATATGTATACATGTGCCATGG - Intronic
1133332496 16:4983579-4983601 ATATATGTATACATGTGGCCAGG + Intronic
1133422523 16:5658713-5658735 ATATATGTATGTATGTATGATGG - Intergenic
1133484658 16:6208052-6208074 ATGTGTGTATATATATAGTCTGG + Intronic
1133652441 16:7825401-7825423 ATTTATATATATATGGAGGAAGG - Intergenic
1133796240 16:9048873-9048895 GTGTGTGTATATATATAGAATGG + Intergenic
1133814519 16:9186401-9186423 ATGTATGTATGTATGTATGGAGG + Intergenic
1133942414 16:10321522-10321544 ATGTATGTATATTTGAGACAGGG + Intergenic
1134192697 16:12134847-12134869 ATGTATGTATATCTCTAGAAAGG + Intronic
1134351865 16:13444977-13444999 ATATATATATATATATAGCTAGG - Intergenic
1134833206 16:17340155-17340177 ATGGATGGATATATGTTGGATGG - Intronic
1134994370 16:18727897-18727919 ATATATATATATATTTAGCTGGG - Intergenic
1134996222 16:18740680-18740702 ATATATATATATATATATCAGGG - Intergenic
1135199847 16:20427901-20427923 AAGTATGTGAATATATAGCATGG + Intronic
1135218857 16:20595709-20595731 AAGTATGTGAATATATAGCATGG - Intergenic
1135459802 16:22632002-22632024 ATATATATATATATATAGTATGG - Intergenic
1135814198 16:25617202-25617224 ATGTAGGTATACATGTGCCATGG + Intergenic
1135824295 16:25713111-25713133 AGGTATGTATACATGTGCCATGG + Intronic
1136911136 16:34145545-34145567 ATATATATATATATATAGCCAGG - Intergenic
1137033565 16:35547617-35547639 ATGTATGTATGTATTTCCCAGGG + Intergenic
1138201778 16:55094017-55094039 ATGTATGTATTTATTTAGGTTGG - Intergenic
1138296252 16:55887818-55887840 AAGTATGAAAATATGTTGCAAGG + Intronic
1138890180 16:61132301-61132323 ATGTAGCTATATATCTAGCTAGG - Intergenic
1138976667 16:62215855-62215877 GTGTGTGTGTATATGTGGCAGGG + Intergenic
1139002238 16:62526366-62526388 AAGTATGTATATATGGTGGATGG - Intergenic
1139069899 16:63367635-63367657 ATGTATGTATAAATTTAGGCAGG + Intergenic
1139185655 16:64803617-64803639 ATATATATATATATATAGCCAGG + Intergenic
1139314106 16:66053490-66053512 ATGTATGTATATAGGTAGGTAGG - Intergenic
1139314117 16:66053602-66053624 ATGTGTCTATGTATGTAGCTAGG - Intergenic
1139331161 16:66191611-66191633 ATGTATGTATACATGAGGAATGG - Intergenic
1140559087 16:75956185-75956207 ACGTAGGTATATATGTATCATGG - Intergenic
1140842916 16:78858382-78858404 ATGTATCTGTATATGTATAATGG + Intronic
1141216414 16:82028866-82028888 ATGTGTGTATATATATAGATGGG - Intergenic
1141216417 16:82028930-82028952 ATGTGTGTATATATGTAGATGGG - Intergenic
1141358141 16:83368879-83368901 ATATATATATATATATAACATGG - Intronic
1142023406 16:87798854-87798876 ATATATATATATATATAGCCAGG + Intergenic
1142515536 17:425724-425746 ATATATATATATATATGGCATGG + Intergenic
1142543264 17:678625-678647 ATATATATATATATTTAGCCAGG - Intronic
1142778454 17:2161038-2161060 TTGTATGTATGTATGTAGGTAGG + Intronic
1142778455 17:2161042-2161064 ATGTATGTATGTAGGTAGGTAGG + Intronic
1143043432 17:4057032-4057054 ATGAATGTGTATTTGTAGCTTGG - Intronic
1143656800 17:8299404-8299426 ATCTATATATATATATATCAGGG + Intergenic
1144066466 17:11628867-11628889 ATGTATGTATATATTTATTTTGG + Intronic
1144222403 17:13112062-13112084 ATATATATATATATATAGCTGGG - Intergenic
1144365044 17:14535459-14535481 ATATATATATATATATAGCTGGG - Intergenic
1144456234 17:15421079-15421101 AGGTATGTATACATGTACCATGG - Intergenic
1144549735 17:16229317-16229339 ATGTATGTATATATACACAATGG - Intronic
1144822249 17:18083482-18083504 AAGTATGTATATATGGGGCTGGG - Intergenic
1146135725 17:30319262-30319284 ATATATATATATATATAGCTGGG + Intronic
1146750867 17:35378511-35378533 ATATATGTATATATACACCACGG - Intergenic
1146834709 17:36101024-36101046 ATATATATATATATATATCATGG - Intergenic
1146942438 17:36852902-36852924 ATGTAGGTATACATGTGCCATGG - Intergenic
1147023832 17:37563432-37563454 TTAAATGTATATATTTAGCAGGG - Intronic
1147112262 17:38272013-38272035 ATATATATATATATATAGCTGGG - Intergenic
1147503603 17:40991264-40991286 ATGTGTGTATATATATATAAGGG + Intergenic
1148861825 17:50608521-50608543 ATATATATATATATATATCATGG - Intronic
1148939629 17:51197104-51197126 ATATATATATATATGGAGGACGG + Intronic
1148960966 17:51392469-51392491 GTGTGTGTATATCTGGAGCAGGG + Intergenic
1149133607 17:53338658-53338680 ATGTATGTATATGTGTATTTAGG - Intergenic
1149178604 17:53905358-53905380 ATGTAGGTATACATGTGCCATGG - Intergenic
1149236425 17:54595574-54595596 ATATATATATATATGTATAAAGG + Intergenic
1149381473 17:56098395-56098417 TTGTGTGTATGTGTGTAGCAGGG - Intergenic
1149413475 17:56433460-56433482 ATATATGTATATATATATGATGG + Intronic
1149949798 17:60973595-60973617 ATATATATATATATGTATGAAGG + Intronic
1150359895 17:64522629-64522651 ATGTATGTATGTATATAAAATGG + Intronic
1150570436 17:66381624-66381646 ATGAATGTACTTATGTAGCATGG + Intronic
1150766356 17:68005205-68005227 ATGTATGTATGTATTTGGCCCGG + Intergenic
1150836840 17:68572028-68572050 ATATATATATATATGTAGCAGGG + Intronic
1150889655 17:69132849-69132871 ATGTATGTATATATGTATGTAGG - Intronic
1150895929 17:69210784-69210806 ATATATGTATATATATACAATGG + Intronic
1150941113 17:69695707-69695729 AAGTATGAAAATATGTTGCAAGG + Intergenic
1151111654 17:71685225-71685247 ATATATATATATATATACCATGG + Intergenic
1151753074 17:76052857-76052879 ATATAGGTATATATGTGCCATGG - Intronic
1153075947 18:1161764-1161786 AGGTCTGGATATATTTAGCAGGG - Intergenic
1153131689 18:1861024-1861046 ATATATGTATGTATGTATAAAGG - Intergenic
1153156688 18:2158079-2158101 ATGTAGGTATACATGTGCCACGG - Intergenic
1153383181 18:4460976-4460998 TTGTATATATTTATGGAGCATGG + Intergenic
1153628081 18:7040758-7040780 ATGAATGGATATATGAAACATGG + Intronic
1154068048 18:11127681-11127703 ATATATGTATATATATATAAAGG - Intronic
1154223490 18:12478586-12478608 ATGTATGTGTGTGTGTAGCTAGG + Intronic
1155320695 18:24615999-24616021 ATGTAGGTATACATGTGCCATGG - Intergenic
1155633223 18:27920239-27920261 ATATATGTATATATATATCAGGG + Intergenic
1155633225 18:27920267-27920289 ATATATGTATATATATATCAGGG + Intergenic
1155633227 18:27920295-27920317 ATATATGTATATATATATCAGGG + Intergenic
1155633229 18:27920323-27920345 ATATATGTATATATATATCAGGG + Intergenic
1155638775 18:27987139-27987161 ATGTATGTATGTATGTATATTGG - Intronic
1155802741 18:30129856-30129878 ATATATGTATATATTTGACAAGG - Intergenic
1155846494 18:30714383-30714405 ATCCATGTATACATATAGCAAGG - Intergenic
1156429629 18:37058021-37058043 AAGTATGGATATATGTTGCAGGG + Intronic
1156542519 18:37929067-37929089 GTGTATATATATATATACCATGG - Intergenic
1156739625 18:40308784-40308806 ATGTATGTATGTATGTATGTAGG + Intergenic
1156770941 18:40724119-40724141 TTGGAAGTATATATATAGCATGG - Intergenic
1156778894 18:40826223-40826245 ACGTAGGTATATATGTGCCATGG - Intergenic
1156830718 18:41487700-41487722 ATATAGGTATATATGTGCCATGG + Intergenic
1157199246 18:45644910-45644932 ATATAGGTATATATGTGCCATGG + Intronic
1157356269 18:46937557-46937579 AAGCATGTATATATGCAGCTTGG - Intronic
1158272063 18:55726959-55726981 ATATATATATATATGTCACAGGG - Intergenic
1158297677 18:56016458-56016480 ATATATATATATATGCACCATGG - Intergenic
1158480305 18:57816131-57816153 ATATATTTATATATATAACAAGG + Intergenic
1158639024 18:59187118-59187140 ATATACGTATATATGTGCCATGG + Intergenic
1159322868 18:66876477-66876499 ATATATATATATATATATCAGGG + Intergenic
1159473353 18:68884649-68884671 ATGTGTGTATATATATACGATGG - Intronic
1160271636 18:77391447-77391469 ACATATGTATATATATAACAAGG - Intergenic
1162234139 19:9292763-9292785 ATGTATGTATATCTATATCTAGG - Intergenic
1162281514 19:9701792-9701814 ATGTGTATATATATATAGCCGGG + Intergenic
1164901245 19:31926804-31926826 ATATATATATATATATAGCCAGG + Intergenic
1165042054 19:33075628-33075650 ATGTATTTATATTTATGGCAAGG - Intergenic
1165302627 19:34980586-34980608 ATGTATGTATGTATGTACGCTGG - Intergenic
1165717733 19:38057356-38057378 ATATATGTATATATATGGGAAGG + Intronic
1165807120 19:38587258-38587280 ATATATATATATATGTCTCAAGG + Intronic
1165931205 19:39360359-39360381 ATGAATGAATATATGAATCAAGG + Intronic
1166595679 19:44047571-44047593 ATGTATGAGTTTATGTATCATGG + Intergenic
1166615511 19:44241073-44241095 ATGTATGTATCTCAGAAGCAAGG - Intronic
1167794063 19:51697733-51697755 ATATATGTATATATAAACCATGG + Intergenic
1202696234 1_KI270712v1_random:128755-128777 ACATATGTATATATGTGCCATGG - Intergenic
925426777 2:3755687-3755709 ATGGATGCATATATGTTGTATGG + Intronic
925529208 2:4841094-4841116 ATGTATGAATTTAATTAGCAAGG + Intergenic
925938486 2:8791017-8791039 AAGTCTGTATATATAAAGCAAGG - Intronic
926032342 2:9602887-9602909 ATATATATATATATATAGTAGGG + Intronic
926236316 2:11047347-11047369 ATGTATGTATATATATATACAGG + Intergenic
926293135 2:11546496-11546518 ATGTATGTATATATTTTATAAGG - Intronic
926719007 2:15944974-15944996 ATGTATGTATGTATGTATGGGGG + Intronic
926960501 2:18353385-18353407 ATGTATGTATATATATTTCTTGG - Intronic
927012621 2:18921650-18921672 ATATATGTGTATATATATCATGG + Intergenic
927227179 2:20779541-20779563 ATTTATATATATGTATAGCATGG - Intronic
927337083 2:21937559-21937581 ATTTGTGTATATGTGTATCAGGG - Intergenic
928052866 2:28018894-28018916 ATATAGGTATATATGAACCAGGG + Intronic
928268066 2:29829242-29829264 ACATATGTATACATGTACCATGG - Intronic
928504261 2:31933367-31933389 ATATATATATATATATAGAAAGG + Intronic
928780603 2:34813850-34813872 ATATATATATATATATAGCCGGG - Intergenic
928826086 2:35422917-35422939 ATATATATATATATGAAACATGG - Intergenic
928895988 2:36264071-36264093 ATGTTTGTCTTTATGTAGCTTGG - Intergenic
929039437 2:37729319-37729341 ATATATATATATATATAGAAAGG + Intronic
929401942 2:41593602-41593624 AAGTATGTACTTATATAGCACGG + Intergenic
929756276 2:44768338-44768360 ATATATATATATATATATCATGG - Intronic
930340472 2:50107512-50107534 ATATATATATATATGTAGTCTGG - Intronic
930623327 2:53667596-53667618 ATGTAGGTATACATGTGCCATGG - Intronic
930769263 2:55115448-55115470 ATCTATATATATAGGTAACAGGG + Intergenic
931234614 2:60402699-60402721 ATGTGTGTGTATGTGGAGCAGGG - Intergenic
931499089 2:62844301-62844323 AGATATGTATCTATTTAGCAGGG - Intronic
932007887 2:67945891-67945913 ATTTATATATATATATATCACGG - Intergenic
932086516 2:68767411-68767433 ATGTATGTGTGAATGTGGCAGGG + Intronic
932227583 2:70054918-70054940 ATGTATGTATGTATGTATGATGG - Intergenic
932440958 2:71734722-71734744 ATGTATGTGTGTATATATCAGGG - Intergenic
932898892 2:75675286-75675308 TTGTATGTATATATTTAAAATGG + Intronic
933048952 2:77577356-77577378 ATATATATATATATGCACCATGG + Intronic
933050939 2:77601454-77601476 ATATATATATATATATAGTAGGG + Intergenic
933486522 2:82931691-82931713 ATGTATGTATAAATGCAAAATGG + Intergenic
933919284 2:87028292-87028314 AAGTATGAAAATATGTTGCAAGG - Intergenic
933988462 2:87614411-87614433 ATGTTTGCATAAATGTTGCAGGG + Intergenic
934003710 2:87741615-87741637 AAGTATGAAAATATGTTGCAAGG + Intergenic
934277400 2:91585786-91585808 ACATATGTATATATGTGCCATGG - Intergenic
935028489 2:99299899-99299921 GTGTGTGTATATATGTAGGGAGG - Intronic
935766217 2:106370327-106370349 ATGTATGTATATATGTATATAGG + Intergenic
935790593 2:106586618-106586640 ATTTATGTATGTATGTAAGAGGG + Intergenic
935918089 2:107979546-107979568 ACATATGTATATATGTGCCATGG - Intergenic
936305378 2:111336400-111336422 ATGTTTGCATAAATGTTGCAGGG - Intergenic
936665836 2:114594361-114594383 ATATATATATATATGTAAAAGGG - Intronic
936745016 2:115565141-115565163 ATGTGTGTATATATGTATGTAGG + Intronic
936784677 2:116080089-116080111 ATATATATATATATCCAGCAAGG - Intergenic
937212066 2:120280647-120280669 ATGTAGGTATACATGTGCCATGG - Intronic
937662621 2:124447699-124447721 ATGTATTTATATAGGAAACAGGG + Intronic
937668060 2:124509395-124509417 ATGTATGTATGTATGAGGAAAGG + Intronic
937741240 2:125357054-125357076 ATGTAGGTATACATGTTCCATGG - Intergenic
937775651 2:125772524-125772546 ATGTATGTATATATTTATATAGG + Intergenic
937843490 2:126551877-126551899 GTGTATGTATATATATATAAAGG + Intergenic
937859066 2:126694105-126694127 ATGTATATATATATTTACCCAGG - Intronic
938752922 2:134351822-134351844 ATGTATGTATGTATATATAAGGG - Intronic
938861815 2:135377246-135377268 ATATATGTACATGTATAGCAGGG - Intronic
939143002 2:138377899-138377921 ATGTAGGTATGTATGTGCCATGG + Intergenic
939312178 2:140495183-140495205 ATGTATGTATGTATGGTGGAGGG + Intronic
939319045 2:140591778-140591800 ACTTATGTATATATGTAAAATGG - Intronic
939397620 2:141651270-141651292 AAGTCTGTAAACATGTAGCAAGG + Intronic
939414433 2:141875823-141875845 ATGTATGCGTATGTGTAGCGAGG + Intronic
939426499 2:142044895-142044917 AGGTATTTTTATATTTAGCAAGG - Intronic
939688989 2:145234560-145234582 ATGTGTGTGTGTGTGTAGCAGGG + Intergenic
939728815 2:145756496-145756518 ATATATATATATATATATCAGGG + Intergenic
939773048 2:146348478-146348500 ATGTATGTACATATGTACTTTGG - Intergenic
939968215 2:148631782-148631804 AGGTATGTTTATATCTTGCAAGG + Intergenic
940054015 2:149494321-149494343 ATGTAGGTATACATGTGCCATGG + Intergenic
940796377 2:158083785-158083807 ATGTATATATATATACACCATGG - Intronic
940937585 2:159515211-159515233 ATGTATGTATATATGTATTATGG - Intronic
940966890 2:159848184-159848206 ATGTATGTATATATATATGATGG + Intronic
940999581 2:160187045-160187067 ACGTAGGTATATATGTGCCATGG - Intronic
940999644 2:160188256-160188278 ATGTATGTATGTGTGTACAAGGG + Intronic
941356125 2:164494605-164494627 GTGTATGCATAAATGTAGCTGGG + Intronic
941580256 2:167288262-167288284 ATGAATGTATAAATGTTACATGG - Intergenic
941619215 2:167757689-167757711 ATATATGTATATATATATAAAGG + Intergenic
941758577 2:169215573-169215595 ATCTATTTATTTACGTAGCAAGG - Intronic
941845877 2:170131991-170132013 ATGTAGGTATACATGTGCCATGG - Intergenic
942405824 2:175653784-175653806 GTGTATATATATATATACCATGG + Intergenic
942557171 2:177183818-177183840 ATGTATCTATATATGTATGGTGG - Intergenic
943229261 2:185225460-185225482 ATCTATGTATATATATTTCATGG - Intergenic
943296635 2:186148359-186148381 ACATAGGTATATATGTACCACGG - Intergenic
943937071 2:193933402-193933424 GTGTATATACATATGTATCATGG + Intergenic
944544779 2:200788367-200788389 ATGTATGTGTATGTGTCTCATGG - Intergenic
944772384 2:202927403-202927425 ATGTATGTATATATCCTGGATGG + Intronic
944959304 2:204852323-204852345 TTGTATGTATATATGTATATAGG + Intronic
945117601 2:206423670-206423692 ATATATATATATATTTAGAATGG + Intergenic
945330479 2:208534177-208534199 ATATATATATATATATAGTAAGG + Intronic
945738736 2:213634953-213634975 GAGTATATATATATGTACCATGG - Intronic
946083555 2:217148892-217148914 AGGTATATGTGTATGTAGCAGGG + Intergenic
946294910 2:218776389-218776411 ATGTATTCATATAAGGAGCAAGG + Intergenic
946526372 2:220524972-220524994 ATGTATGTATATATGTGTCAAGG - Intergenic
946624798 2:221599852-221599874 ATGTGTGTGTATATGTGCCATGG + Intergenic
947181335 2:227413920-227413942 ATGTATTTATTTATTTTGCAAGG + Intergenic
947466487 2:230352860-230352882 ATGTGTGTATATATGTATAATGG + Intronic
947520381 2:230841365-230841387 AATTATGTATATATTTAGCTGGG - Intergenic
947677353 2:231994567-231994589 ATGTATGTAACTATAAAGCAGGG - Intronic
1168859165 20:1033327-1033349 ATGTATCTTCATATGTAACATGG - Intergenic
1168919493 20:1519390-1519412 ATGTATGTTTAAATGGATCATGG + Intergenic
1169457082 20:5761352-5761374 ATGTAGGTATACATGTGCCATGG - Intronic
1169627108 20:7583320-7583342 ATGTATGTATATATATATTTAGG - Intergenic
1169676587 20:8161269-8161291 ATGTATGTATATATGTAGCACGG - Intronic
1169896218 20:10507901-10507923 ATGTATATATATATATATAAAGG - Intronic
1169932078 20:10844435-10844457 ATATATGTATGTATGTAGGAAGG - Intergenic
1169997314 20:11572623-11572645 ATGTAGGTATACATGTGCCATGG - Intergenic
1170265211 20:14459510-14459532 ATGTGTGTATGTATGTAGGTAGG + Intronic
1170338365 20:15296051-15296073 AAGTATGAAAATATGTTGCAAGG - Intronic
1170803407 20:19609464-19609486 ATATAGGTATACATGTACCATGG + Intronic
1170947950 20:20908925-20908947 AGGTATGAAAATATGTTGCAAGG + Intergenic
1171130509 20:22648502-22648524 ATATATATATATATGTACCACGG + Intergenic
1172051854 20:32123643-32123665 ATGTATATATAAATGTATAAGGG - Intronic
1172395667 20:34602623-34602645 ATGTATGTATGTAAGTAGAAGGG + Intronic
1172458592 20:35097716-35097738 ATATATGTATATATGTATATAGG - Intergenic
1172491973 20:35346612-35346634 ATATATATATATATGTCACATGG - Intronic
1172531652 20:35635161-35635183 ATATATGTATATATAAAACAGGG - Intronic
1172680735 20:36712554-36712576 ATATATATATATATATAGCCGGG - Intronic
1173093381 20:39998539-39998561 ATATATATATATATATATCATGG + Intergenic
1173236601 20:41251836-41251858 ATATATATATATATATAACATGG + Intronic
1173379050 20:42521047-42521069 ATGTATGTATATAGGTAGGTGGG - Intronic
1173379052 20:42521051-42521073 ATGTATGTATGTATATAGGTAGG - Intronic
1173547405 20:43909456-43909478 GTGTGTGTATGTATGTAGGAAGG + Intergenic
1173686398 20:44926519-44926541 ATATATATATATATGTAGGCTGG - Intronic
1173759068 20:45543860-45543882 ATGGAGGTATAGAGGTAGCACGG - Intronic
1173863809 20:46301513-46301535 ATATATGTATATATATGGCTGGG + Intronic
1175020660 20:55845345-55845367 ATGTATGTATATAGAGAGAAGGG - Intergenic
1176967837 21:15231398-15231420 ATTAATGAATATAAGTAGCAAGG + Intergenic
1177081851 21:16649527-16649549 ATTTAAGTTTATATTTAGCAGGG + Intergenic
1177082396 21:16656461-16656483 ATCTATGGATTTATGTGGCACGG - Intergenic
1177547317 21:22575663-22575685 ATATATATATATATTTAACAGGG - Intergenic
1177607654 21:23402173-23402195 ATATATGTATATATATCCCAAGG + Intergenic
1177876478 21:26638116-26638138 ATATATATATATATATACCATGG - Intergenic
1178370659 21:32024365-32024387 ATATACGTATATATGTATAAAGG + Intronic
1178957224 21:37034166-37034188 ATATATATATATATATATCAGGG + Intergenic
1179314689 21:40232353-40232375 ATGTATGAATCTACGGAGCATGG + Intronic
1179623794 21:42635956-42635978 ATGAATGTATATATGTAGCTTGG - Intergenic
1182034221 22:27185184-27185206 ATATATATATATATCTTGCAGGG + Intergenic
1182698717 22:32213818-32213840 ATATATCTATATATATAGCAGGG + Intergenic
1182849382 22:33459058-33459080 AGGTTTGTATATATGTGCCATGG + Intronic
1183425706 22:37738291-37738313 ATGAATGGATAGATGTGGCATGG + Intronic
1184659055 22:45957232-45957254 ATGTATGTAAAAATGCATCAAGG + Intronic
1184822496 22:46920073-46920095 ATGTATGTATGTATGAATGAAGG + Intronic
949190721 3:1245320-1245342 ATATATATATATATATAGCATGG + Intronic
949288946 3:2440995-2441017 ATGTGTGTATATATATATAAAGG + Intronic
949426465 3:3922434-3922456 ATGTGTGTAAATGTGTAGTATGG + Intronic
949593201 3:5515182-5515204 ATGTAGGTATATGTGTGCCATGG - Intergenic
950255015 3:11497379-11497401 ATATATATATATATTTAGCCAGG + Intronic
951375342 3:21908164-21908186 ATCTATCTATATATGTATAAAGG + Intronic
951681206 3:25296516-25296538 ATACATGAATATATTTAGCATGG + Intronic
951884909 3:27514750-27514772 ATGTACGTATGTATGTAAAAAGG - Intergenic
951921384 3:27858578-27858600 ATGTATGTATATATCTCCAATGG + Intergenic
952035003 3:29189595-29189617 ATGTATGTATCTCTGTACTAAGG + Intergenic
952094335 3:29930481-29930503 ATATATGTATATATGGACCAGGG + Intronic
952121321 3:30248083-30248105 ATATATATATATATTTAGCTAGG + Intergenic
952431471 3:33228205-33228227 ATCTATGGATTTATGTGGCATGG - Intergenic
952775917 3:37046572-37046594 ATATATGTATATATATATGAAGG - Intronic
953257990 3:41307821-41307843 ATGTATGTATGTATGAAACGGGG - Intronic
953288780 3:41640705-41640727 TTCTAGATATATATGTAGCAAGG + Intronic
953489812 3:43339861-43339883 ATATATATATATATGTTACATGG + Intronic
954526745 3:51278620-51278642 ATATATATATATATGTACCCTGG + Intronic
954768785 3:52946662-52946684 ATTCATGTATGTATGTACCAAGG - Intronic
955023342 3:55142830-55142852 ATGTTTGTGTATATGGAGAATGG + Intergenic
955253992 3:57311016-57311038 ATGTATCTATCTATCTAGAAAGG + Intronic
955394230 3:58545690-58545712 ATATGTATATATATATAGCAAGG - Intergenic
955563450 3:60218856-60218878 ATGTATGTATGTATGTATGTAGG - Intronic
955950943 3:64241457-64241479 ATGTATATATGTAAGTAACATGG + Intronic
956141438 3:66150638-66150660 ATATATATATATATATATCATGG + Intronic
956186264 3:66565306-66565328 AAGTATGAAAATATGTTGCAAGG + Intergenic
956248051 3:67205755-67205777 AAGTATGAAAATATGTTGCAGGG - Intergenic
956348300 3:68305445-68305467 ATATATATATATAGGTAGAAGGG + Intronic
956732716 3:72211353-72211375 ATGTGTGTATATATGTATTAGGG - Intergenic
957313986 3:78553761-78553783 ATGTATATATATATATATAAAGG - Intergenic
957585197 3:82123874-82123896 ATGTATGTATGTATGGTTCATGG + Intergenic
958471766 3:94530360-94530382 ATGTATAGAAATATGTAGAATGG + Intergenic
958538571 3:95436944-95436966 ACGAATGTTTACATGTAGCATGG + Intergenic
958683582 3:97363165-97363187 ATATATATATATATATTGCAGGG - Intronic
958946321 3:100366401-100366423 AGGTATATATATATATAGTAGGG - Intronic
959017831 3:101155875-101155897 GTGTGTGTGTTTATGTAGCAGGG + Intergenic
959216175 3:103453040-103453062 ATGTATTTAAGTATGTAGCTTGG - Intergenic
959434052 3:106291284-106291306 ATGTATGCATATATGCAGCAAGG - Intergenic
959610536 3:108289659-108289681 ATATATGCATATATGTATTAAGG - Intergenic
960015120 3:112878330-112878352 ATGTAGGTATACATGTGCCATGG - Intergenic
960512341 3:118565918-118565940 ATGTGTGTATATATATATGAAGG + Intergenic
960804063 3:121565835-121565857 ATGTGTGTATATATATAGCTGGG + Intergenic
961691474 3:128673184-128673206 ATATAGATATATATGTAGCTGGG - Intronic
961790199 3:129370434-129370456 ATATATGTATGTATGTGGTATGG + Intergenic
961835193 3:129652239-129652261 GTGTATGCATATATGTGTCAAGG + Intronic
962867447 3:139459460-139459482 ATATATATATATATTTAGCCAGG + Intronic
962956693 3:140273308-140273330 ATGTAGGTATACATGTGCCATGG - Intronic
963028071 3:140939754-140939776 ATGTAGGTATACATGTGCCATGG - Intergenic
963408071 3:144893817-144893839 ATGTATATATATTGTTAGCAAGG + Intergenic
963641127 3:147862918-147862940 AAGTATGAAAATATGTTGCAAGG - Intergenic
963654714 3:148031921-148031943 ATGTATGTATAAATCCACCACGG - Intergenic
964060181 3:152512625-152512647 GTGTATATATATATATAGTAGGG - Intergenic
964190428 3:153994182-153994204 ATATATGTATATATATACGATGG + Intergenic
964694276 3:159489903-159489925 ATGTATGTAATTTTGTAGAAAGG + Intronic
964853835 3:161123762-161123784 ACGTAGGTATATATGTGCCATGG - Intronic
964933698 3:162056087-162056109 ATGTATGTTTAAATGTAACCAGG - Intergenic
965002966 3:162981657-162981679 AGGTATGTATACATGTGCCATGG + Intergenic
965340864 3:167489373-167489395 GTATATGTATATATGTGACATGG - Intronic
965607951 3:170515336-170515358 ATATATGTATATATATATTATGG + Intronic
966032659 3:175369637-175369659 ATGTGTGTGTATGTGTAGCAGGG + Intronic
966440256 3:179937064-179937086 ATGTATATATATATATATGAGGG - Intronic
966447938 3:180024339-180024361 ATATATATATATATTTAGTAGGG - Intronic
966691338 3:182744809-182744831 ATATATGTATATATGCAACTAGG - Intergenic
967639943 3:191850518-191850540 ATATGTGTATATATATATCAAGG + Intergenic
967697523 3:192550328-192550350 ATGTATGCACATATATAGGAAGG - Intronic
967866724 3:194196167-194196189 ATGTATGTATATATATCTCAAGG - Intergenic
968080868 3:195846166-195846188 ATTGTTGTATATATGCAGCATGG + Intergenic
968558887 4:1265817-1265839 CCGGATGTATTTATGTAGCAGGG - Intergenic
969944531 4:10769808-10769830 AGGTATGTATATATATATCCGGG + Intergenic
970213933 4:13739178-13739200 AGGTATGTATACATGTGCCATGG + Intergenic
970288760 4:14549033-14549055 ATGTAGGTATACATGTGCCATGG - Intergenic
970401005 4:15717758-15717780 AAGTATGAAAATATGTTGCAAGG + Intronic
970422589 4:15919314-15919336 AAGTATGAAAATATGTTGCAAGG + Intergenic
970499176 4:16659695-16659717 ATGTATGTATATATGTAACAAGG + Intronic
970621400 4:17823252-17823274 ATATATGGAAATATGTAGAAGGG - Intronic
971006267 4:22377084-22377106 TTGTATGTTTATATGTAAAAGGG + Intronic
971211096 4:24617155-24617177 ATATATGTATATATGGTACAAGG + Intergenic
971240954 4:24888255-24888277 ATCTATGTATATATTCAGCTTGG - Intronic
971298977 4:25426364-25426386 GTGTATTTATATATGTATTAGGG + Intergenic
971330880 4:25680526-25680548 ATATATGTAAATATTTAGCCAGG + Intergenic
971534321 4:27729569-27729591 ATGTATGTATGTATGTATTTGGG - Intergenic
971947430 4:33299424-33299446 ATGTATTTACATATACAGCATGG - Intergenic
972129987 4:35820701-35820723 ACATATGTATATATGTGCCATGG + Intergenic
972183836 4:36503408-36503430 ATGCTTGTATATATGTAAAATGG + Intergenic
972280559 4:37598019-37598041 GTGTATATATATATGTAGGCTGG - Intronic
972408796 4:38771071-38771093 ATCTATATATATATATTGCAAGG - Intergenic
972462666 4:39319742-39319764 ATGTAAGTATATATATAGTTTGG - Intronic
972516946 4:39817875-39817897 ATATATATATATATATAGCTGGG - Intergenic
972846050 4:42990822-42990844 ATGCATATATATATGTAAAAAGG - Intronic
972916678 4:43889982-43890004 ATGTATGTATGTATGTATGTAGG - Intergenic
973027071 4:45285251-45285273 ATGTATGCATTTATGGAACATGG - Intergenic
973255002 4:48101666-48101688 GTGTATGTGTATATAAAGCATGG - Intronic
973832312 4:54774027-54774049 ATGTATGAAAATACATAGCATGG - Intergenic
973835520 4:54805702-54805724 ATATATATATATATGTATGATGG + Intergenic
974641009 4:64630900-64630922 ACGTAGGTATACATGTGGCATGG + Intergenic
974655521 4:64814628-64814650 ATATATATATATATGTACCTTGG + Intergenic
974724807 4:65784807-65784829 ATGTATGTATGTATGTATTATGG - Intergenic
975006549 4:69295939-69295961 ATATATATATATATATACCATGG - Intronic
975462507 4:74670942-74670964 ATGAATGAATATATGAAGAAAGG + Intergenic
975704969 4:77102865-77102887 ATATATATATATATATAGCGGGG - Intergenic
975920108 4:79376030-79376052 ATGTATGTATAAATGTATGTAGG + Intergenic
975983011 4:80180333-80180355 ATATATATATATATGAGGCAAGG - Intergenic
976056612 4:81076798-81076820 ATGTATGTATATATGTGGGTGGG - Intergenic
976119531 4:81764199-81764221 ATGTATGTATAAAGAGAGCAGGG + Intronic
976415095 4:84763477-84763499 ATGTATGTATACATGTGCCATGG - Intronic
976992645 4:91386772-91386794 ATACATGTATATATGTGGGAAGG - Intronic
977085832 4:92597683-92597705 ATGTCTGTATGTATGGTGCATGG + Intronic
977892181 4:102325054-102325076 AAGTATGTATGTATATATCAGGG - Intronic
978103208 4:104868799-104868821 ATGTATATATATATGAGACAAGG + Intergenic
978150554 4:105428748-105428770 ACGTAGGTATATATGTGCCATGG - Intronic
978338213 4:107692780-107692802 ATATATATATATATATATCATGG + Intronic
978418032 4:108499377-108499399 ATATATATATATATATAGCTGGG - Intergenic
978660447 4:111119981-111120003 ATGTATGTATACATGTGCCATGG - Intergenic
979066159 4:116136445-116136467 ATATATATATATATATTGCAGGG + Intergenic
979140730 4:117171026-117171048 ATATATGTATATATTTATAATGG - Intergenic
979145900 4:117247870-117247892 ATGTATGTATATATGTCTGTAGG + Intergenic
979325972 4:119379924-119379946 ATGTATATATATATATATGATGG - Intergenic
979336108 4:119464671-119464693 ATGTATGTATATATTTCTAAGGG - Intergenic
979394990 4:120177280-120177302 TTGTATTTATATATGTTGAATGG + Intergenic
979863141 4:125719558-125719580 ATATATATATATATGTAACTTGG + Intergenic
980272770 4:130608112-130608134 ATGTATGTATAATTGTTGGAAGG - Intergenic
980317876 4:131228261-131228283 GTGTATGTATATATCAAGTAAGG + Intergenic
980364513 4:131783083-131783105 ATGTACGTGTGTATGTGGCAGGG + Intergenic
980459643 4:133091313-133091335 CTGTAGATATATATGTAGAATGG - Intergenic
980741351 4:136953645-136953667 ATGTAAGTATATAGATGGCATGG + Intergenic
980855669 4:138436218-138436240 ATATAGGTATATACGTACCATGG - Intergenic
981133368 4:141183598-141183620 ATATATGTATACATGTGCCATGG + Intronic
981217362 4:142186177-142186199 ATTTATGTAAATATATAGAAAGG - Intronic
981346257 4:143680226-143680248 ATATATGTATATATGGAATAGGG + Intronic
981541140 4:145847247-145847269 GTGTACGTATATATTTACCAAGG - Intronic
981752687 4:148107943-148107965 ATGTAGGTATACATGTGCCATGG - Intronic
981797115 4:148608200-148608222 ATGTATGTATATATGTATATAGG + Intergenic
981885577 4:149668588-149668610 ATATATGTATACATGTGCCATGG - Intergenic
982812310 4:159841255-159841277 ATATATATATATATATACCATGG - Intergenic
982825437 4:159998537-159998559 ATATATATATATATATACCATGG - Intergenic
982846565 4:160260151-160260173 ATATAGGTATATATGTGCCATGG + Intergenic
982875942 4:160649851-160649873 AAGTATGAAAATATGTTGCAAGG + Intergenic
983069020 4:163247421-163247443 ATGTATGTATATATATATATAGG - Intergenic
983129826 4:164004226-164004248 ATGTATGTAAACATGTGCCATGG - Intronic
983617729 4:169726253-169726275 ATGTATGTATATATATATGTAGG - Intergenic
983711646 4:170724081-170724103 TTGTATGTGTACATGTAGGAGGG + Intergenic
983864015 4:172741739-172741761 AAGTTTAAATATATGTAGCAGGG - Intronic
984236866 4:177169775-177169797 ATATATGTATATATATATAAAGG + Intergenic
984563210 4:181295785-181295807 ATGTATGTATGTATATATTAGGG + Intergenic
984611134 4:181839388-181839410 ATGTATATATATATGTATATAGG - Intergenic
984718215 4:182945336-182945358 ATCTCTGTATTCATGTAGCATGG + Intergenic
984890250 4:184485703-184485725 AAGTATGAAAATATGTTGCAAGG + Intergenic
985205651 4:187532796-187532818 ATGTATGTACATATATAACCAGG + Intergenic
985262901 4:188131516-188131538 ATATATATATATATTTAGCTAGG - Intergenic
985352200 4:189076195-189076217 ATGTAGGTATACATGTGCCATGG - Intergenic
986506122 5:8453820-8453842 ATATATATATATATATAGAAGGG + Intergenic
986624309 5:9709121-9709143 ATGTAGGTATACATGTGCCATGG - Intronic
986995060 5:13597503-13597525 ATGTATATATATATATAGCAAGG - Intergenic
987223556 5:15816273-15816295 ATATATATATATATGTGCCATGG + Intronic
987792665 5:22588019-22588041 ATGTGTGTATATATATAATATGG - Intronic
987904943 5:24064286-24064308 ATATATGTATGTATGTATCTTGG - Intronic
987966371 5:24881538-24881560 GTGTATGTATATATGTATTTTGG + Intergenic
988164551 5:27568644-27568666 ATATATATATATATATATCAAGG + Intergenic
988311397 5:29562964-29562986 ATATATGTATATATTTATTATGG + Intergenic
988311398 5:29562997-29563019 ATATATGTATATATTTATTATGG + Intergenic
988561696 5:32287530-32287552 ATGTATGTGTATATATATAAAGG - Intronic
989022296 5:37022724-37022746 ATGTATGTATATATATAAACAGG + Intronic
989041804 5:37237230-37237252 GTGTGTATATATATGTATCATGG + Intronic
989224339 5:39008642-39008664 TTTTATGTATATATATAGCCAGG - Intronic
989373161 5:40731355-40731377 GTGTGTGTGTATGTGTAGCAGGG - Intronic
990014511 5:51043332-51043354 ATGTATGTATGTATATAGTATGG + Intergenic
990398710 5:55413376-55413398 ATGTATGTATGTATGAGACAGGG - Intronic
990603579 5:57385160-57385182 GTGTGTGTATGTGTGTAGCAGGG + Intergenic
990630292 5:57661502-57661524 CTGTATCTTTATATGTAGGAGGG + Intergenic
991137446 5:63198704-63198726 AAGTATGTAAATATGAAGAATGG + Intergenic
991328944 5:65470418-65470440 TTGTATGTATATGTGTATTATGG - Intronic
991678914 5:69118319-69118341 ATATATGTATATATATATGAAGG + Intronic
991905774 5:71509243-71509265 ATATATATATATATCTAGTAAGG - Intronic
992383088 5:76257810-76257832 ATATATGGGTATATGTAGTATGG + Intronic
992383116 5:76258052-76258074 ATATATGTGTTTATGTAGTATGG + Intronic
992725348 5:79601608-79601630 ATATATATATATATCTAGCCAGG - Intergenic
992977152 5:82132315-82132337 AGGTATGTATACATGTGCCATGG + Intronic
993219176 5:85068571-85068593 ATATATGTATATATACAGCCAGG + Intergenic
993318958 5:86448178-86448200 ATGTCTTTATAAATTTAGCATGG + Intergenic
993335943 5:86659094-86659116 ATGTAGGTAAATATGTGCCATGG + Intergenic
993582012 5:89674665-89674687 ATATATACATATATGTACCAAGG + Intergenic
993825439 5:92679907-92679929 ATGTACGTTTCTATATAGCAGGG - Intergenic
994014871 5:94953788-94953810 ATATATGTATATATATGCCATGG - Intronic
994123102 5:96139485-96139507 GTGTATATATATATGTTACAAGG - Intergenic
994247250 5:97492383-97492405 ATATATATATATATTTAGCTGGG - Intergenic
994488775 5:100414727-100414749 ATGTGTTTGTATAAGTAGCATGG + Intergenic
994679166 5:102864155-102864177 ATATATATATATATGAAGAAGGG - Intronic
994842685 5:104947074-104947096 ATATATATATATATGTATAATGG - Intergenic
994888401 5:105597326-105597348 ATGTATATGTATATGTATGATGG + Intergenic
995014657 5:107296339-107296361 ATTTATGCATATATTTGGCATGG + Intergenic
995034803 5:107521451-107521473 ATATATATATATATATAGCCAGG - Intronic
995766739 5:115627008-115627030 ATATATATATATATATAGCCTGG + Intronic
995875947 5:116789939-116789961 AGGTATGCATATAAGAAGCAGGG - Intergenic
995901160 5:117068034-117068056 ATGTATGTACATATGTATTTTGG - Intergenic
995920830 5:117309250-117309272 CTATATGGATATATGTAGAATGG + Intergenic
996234775 5:121112141-121112163 ATGTATGTGTGTGTGTGGCAGGG + Intergenic
996245658 5:121261329-121261351 GTGCATATATATATTTAGCATGG + Intergenic
996431452 5:123383275-123383297 ATGTATGCGTGTATTTAGCAGGG - Intronic
996448763 5:123592740-123592762 CTATATATATATATATAGCATGG + Intronic
996882064 5:128310357-128310379 ATATATATATATATGTGCCAAGG - Intronic
997127133 5:131238547-131238569 ATATAGGTATATATGTACCATGG - Intergenic
997287594 5:132692660-132692682 TTGTATGTATACATGCAGCATGG - Exonic
997437649 5:133886504-133886526 ATGTATGTATATATAAAACAAGG - Intergenic
997729710 5:136159137-136159159 ATGTATGTATATATGAATACTGG + Intronic
997763702 5:136477246-136477268 ATATATGTATATATATATAATGG + Intergenic
997966689 5:138362523-138362545 ATATATGTATATATATATCCTGG - Intronic
998285845 5:140860159-140860181 ATATATGTATATATATATGATGG + Intronic
998305059 5:141067744-141067766 ATGTATGTATTTATAGAGAAAGG + Intergenic
998454175 5:142258006-142258028 ATATATATATATATCTATCATGG - Intergenic
998524715 5:142831865-142831887 ATGTAGGTAGCTATGTTGCAAGG - Intronic
998564932 5:143208453-143208475 CTGTATATATATAAATAGCATGG - Intronic
998725888 5:145014204-145014226 ATGTGTGTTTCTATTTAGCAGGG + Intergenic
998894203 5:146781127-146781149 ATATATATATATATATATCATGG - Intronic
998931186 5:147183262-147183284 ACGTATGTATACATGTGCCACGG + Intergenic
999188344 5:149729499-149729521 ATGTATGTATGTATATACCTAGG - Intergenic
999432921 5:151539308-151539330 ATGTATTTATGTGTGTTGCAAGG + Intronic
999461423 5:151760090-151760112 ATGTATGTATATATTTATGCAGG - Intronic
999856742 5:155603036-155603058 AAGTATGCCTATATGAAGCAAGG - Intergenic
1000219465 5:159198967-159198989 ATGTATGTATGTACGTGACAGGG - Intronic
1000334812 5:160234341-160234363 AAGTATGAAAATATGTTGCAAGG - Intronic
1000345576 5:160311313-160311335 ATCTATGTGTATATCTAGAATGG - Intronic
1000471362 5:161646065-161646087 ATATATATATATATATAGCTGGG + Intronic
1000810943 5:165860271-165860293 GTGGATGAATATATGCAGCAGGG + Intergenic
1001090133 5:168733725-168733747 ATGTAGGTATACATGTGCCATGG - Intronic
1002191595 5:177480943-177480965 ATATATATATATATGTGGCCAGG - Intergenic
1002766758 6:247204-247226 ATATATATATATATGGAACAGGG + Intergenic
1002848938 6:974167-974189 GTGTATATATATATATACCATGG + Intergenic
1002968058 6:1987295-1987317 ATGTATGTATATAAATAGAAAGG - Intronic
1003090155 6:3094587-3094609 ATATATATATATATGAAGAAAGG + Intronic
1003131341 6:3397737-3397759 ATGTGTGCATGTATATAGCATGG - Intronic
1003751628 6:9065280-9065302 ATGTATGTGTGTATATAACAGGG - Intergenic
1003751630 6:9065345-9065367 ATGTATGTGTGTATATAACAGGG - Intergenic
1004262409 6:14119432-14119454 ATGTATGTAAATATTTACCTTGG - Intronic
1004922239 6:20386550-20386572 ATGTATGTATGTATGTATTTAGG + Intergenic
1004984196 6:21061972-21061994 ATGCATGGATATATTTGGCAAGG - Intronic
1005097224 6:22130619-22130641 ATGTTTTTATATTTGTAGGAGGG + Intergenic
1005100131 6:22162913-22162935 ATATATATATATATGTATGATGG - Intergenic
1005166659 6:22930535-22930557 ACGTGTGTATATATGTATCCTGG + Intergenic
1005534368 6:26740423-26740445 ATGTATATATACATGTATTATGG - Intergenic
1005729413 6:28682572-28682594 ATGTATATATATATATATTAGGG + Intergenic
1005744567 6:28824279-28824301 ATATATATATATATATAGCGTGG - Intergenic
1006938678 6:37736847-37736869 ATGTATGTGAAAATGCAGCATGG + Intergenic
1007528293 6:42516350-42516372 ATGTATGTATACACGCACCATGG + Intergenic
1007968166 6:46023000-46023022 CTGTTTGTAAGTATGTAGCAAGG - Intronic
1008052330 6:46913006-46913028 AAGTATGAAAATATGTTGCAAGG - Intronic
1008181574 6:48337103-48337125 GTGTATGTATGTATGTAATAAGG - Intergenic
1008190734 6:48453827-48453849 ATATATATATATATGCACCATGG + Intergenic
1008633826 6:53389632-53389654 ATGTATATATGTATGTACAAGGG + Intergenic
1008740770 6:54605288-54605310 ATGTAGGTATATGTGTACCATGG + Intergenic
1008814867 6:55553275-55553297 ATGTATGTATGTAACTAGCAGGG + Intronic
1008973093 6:57392995-57393017 ATGTATATATATATATAATAAGG - Intronic
1009022944 6:57963947-57963969 ATATATATATATATATAGAAGGG - Intergenic
1009210716 6:60860000-60860022 ATGCATGTATATATGTAGGGGGG + Intergenic
1009274941 6:61663513-61663535 ATATATATATATATGCAGCTGGG + Intergenic
1009739697 6:67728647-67728669 ATGTAGGTATACATGTGCCATGG + Intergenic
1010329666 6:74608434-74608456 ATATAGGTAAATATGTATCATGG + Intergenic
1010449519 6:75987366-75987388 ACATATGTATATATGTGCCATGG + Intronic
1010576723 6:77540867-77540889 ACGTATGTATATATGTGCCATGG - Intergenic
1010656810 6:78521142-78521164 AAATATATATATATGTAGCTTGG - Intergenic
1010684766 6:78840198-78840220 ATGTAGGTATACATGTGCCATGG - Intergenic
1010794956 6:80107571-80107593 ATATATGTATATATGTCCCTTGG + Intronic
1011093030 6:83628214-83628236 ATATATATATATATGTAAAATGG - Intronic
1011190916 6:84727236-84727258 ACATATGTATATATGTGCCATGG - Intronic
1011227937 6:85128229-85128251 ATGTATGTACATATGTATGAAGG + Intergenic
1011227986 6:85128693-85128715 ATGTATGTGTATATATATGAAGG - Intergenic
1011355095 6:86465724-86465746 ATGTAGGTATACATGTGCCATGG - Intergenic
1011893730 6:92198437-92198459 ATATATATATATATTTAGCCAGG - Intergenic
1012194004 6:96316856-96316878 ATGTGTATGTGTATGTAGCAAGG - Intergenic
1012272156 6:97226707-97226729 ATATATGTATGTAGGTAGGAAGG + Intronic
1012302546 6:97607120-97607142 ATATATATATATATATATCATGG - Intergenic
1012306169 6:97660774-97660796 ATATATATATATATGTAGAAGGG + Intergenic
1012348203 6:98218473-98218495 ATTTATATATATATATAGTATGG + Intergenic
1012362340 6:98398285-98398307 ATATATATATATATGTTTCAAGG + Intergenic
1012635418 6:101532703-101532725 ATATATGTATATATATATAATGG + Intronic
1012726144 6:102813276-102813298 ATATATATATATATGTAGTTTGG + Intergenic
1013390070 6:109677574-109677596 AGGCATGTATATATTTAGCAGGG - Intronic
1013713172 6:112925515-112925537 ATTTATGTATTTTAGTAGCAAGG - Intergenic
1013721159 6:113029785-113029807 ATATATGTATATATATATGACGG - Intergenic
1013721162 6:113029863-113029885 ATATATGTATATATATATGACGG - Intergenic
1013995147 6:116299606-116299628 ATGTATGTATGTAGGTAGGTAGG + Intronic
1014392983 6:120887516-120887538 ATAGATGTATATTTTTAGCAAGG - Intergenic
1014453278 6:121606521-121606543 ATATATATATATATATACCATGG - Intergenic
1014630345 6:123781877-123781899 ATATATGTGTATAGATAGCAGGG - Intergenic
1014638172 6:123874884-123874906 ATGTATGTATGTATGTATGTAGG - Intronic
1014638481 6:123879280-123879302 ATGTGTCTATTTATGTAGTATGG + Intronic
1014867881 6:126554286-126554308 ATACATATATATATGTAACAGGG - Intergenic
1015042714 6:128741366-128741388 AAGTATGGAAATATGTTGCAAGG - Intergenic
1015184573 6:130400043-130400065 GTGTATGTATATATATATGATGG - Intronic
1015202299 6:130596440-130596462 ATGTATGTATGTATGGGGCCTGG + Intergenic
1015216546 6:130756517-130756539 TTTTATGTATGTATGTAGCTGGG - Intergenic
1015409951 6:132882922-132882944 ATATATATATATATGTACCCTGG + Intergenic
1015564947 6:134559845-134559867 ATATATATATATATATATCACGG + Intergenic
1015592792 6:134838594-134838616 GTGTGTGTATATATATATCATGG - Intergenic
1015802975 6:137079137-137079159 ATGTATATATATATACACCATGG - Intergenic
1015901099 6:138068416-138068438 ATGTATATATATATCTATCTTGG + Intergenic
1015902969 6:138086315-138086337 ATATATATATATATGGAACATGG + Intergenic
1016218748 6:141638181-141638203 ATGTATGTATATATCTTCCCTGG - Intergenic
1016822902 6:148362839-148362861 ATGTATGTATTTTTGAGGCAAGG - Intronic
1016862873 6:148738975-148738997 ATATATATATATATATAGCCGGG + Intergenic
1017128019 6:151084082-151084104 ATGTAGCTATAGATGTAGCCAGG - Intronic
1017404733 6:154107053-154107075 TTGTATGTTTATATGTAAAAGGG - Intronic
1017518517 6:155180458-155180480 ATGTATCGATATATTTAACAAGG - Intronic
1017621533 6:156304262-156304284 ATGTATATAGATATGTATTATGG - Intergenic
1017966233 6:159269407-159269429 ATGTATGTATGTATGTATGTAGG + Intronic
1019024682 6:168949137-168949159 AAGTATGAAAATATGTTGCAAGG + Intergenic
1019116460 6:169767522-169767544 CTGTGTGTGTATATGCAGCATGG - Intronic
1019116468 6:169767707-169767729 CTGTGTGTGTATATGTGGCATGG - Intronic
1020214742 7:6181158-6181180 ATGTCAGTATTTAAGTAGCAAGG - Intronic
1020357836 7:7296975-7296997 ATATATGTATATATATAAAAGGG - Intergenic
1020526016 7:9259987-9260009 ACGTAGGTATACATGTACCATGG + Intergenic
1020531027 7:9335780-9335802 ATATATATATATATATAGCCAGG - Intergenic
1020588910 7:10108993-10109015 ATGTGTGTATGTGTGTATCAGGG + Intergenic
1020731311 7:11884501-11884523 ATATATATATATATATACCATGG + Intergenic
1021175290 7:17442907-17442929 AGGTATGTATATATATAGATAGG - Intergenic
1021695820 7:23275383-23275405 ATATATATATATATGTAGTTAGG - Intergenic
1021711452 7:23419977-23419999 ATGTATATATGTATGTATAAGGG + Intronic
1021741457 7:23690162-23690184 ATATATATATATATGAACCAAGG - Intronic
1021827296 7:24568115-24568137 ATATATATATATATGTACTATGG + Intergenic
1022380610 7:29856035-29856057 ATGTATGTATATATGTAGATAGG + Intronic
1022737232 7:33087710-33087732 AAGTATGAAAATATGTTGCAAGG + Intergenic
1022783912 7:33616501-33616523 ATATATATATATATATAGAAAGG + Intergenic
1022863350 7:34390981-34391003 ATATATATATATATATAGCTTGG - Intergenic
1023132215 7:37014485-37014507 ACATAGGTATATATGTAACATGG + Intronic
1024113988 7:46174739-46174761 ATGTTTTTATATATGTAACTTGG - Intergenic
1024173871 7:46818507-46818529 ATATATATATATATTTAGGAAGG - Intergenic
1024401615 7:48929967-48929989 ATGTATGTATGTATGTATGTAGG + Intergenic
1024401616 7:48929971-48929993 ATGTATGTATGTATGTAGGTAGG + Intergenic
1024411803 7:49051661-49051683 TGGTATGTATATATATATCATGG + Intergenic
1024602529 7:50996421-50996443 ATGTATATATATATACACCATGG - Intergenic
1024636559 7:51295335-51295357 ATGTAGGTATACATGTGCCATGG - Intronic
1024908330 7:54414820-54414842 ATATATATATATCTGGAGCAAGG + Intergenic
1024920799 7:54552533-54552555 ATGAATGAATAAATGAAGCATGG - Intronic
1024925511 7:54609573-54609595 ATGAATTTATAAATGTAGCTTGG + Intergenic
1025195705 7:56930966-56930988 ATGTATGTATTTATGGAGTGGGG + Intergenic
1025676244 7:63645969-63645991 ATGTATGTATTTATGGAGTGGGG - Intergenic
1026559685 7:71438141-71438163 ATGTATGTATGTATGTATATGGG + Intronic
1026599204 7:71761032-71761054 ATATATATATATATATAGAAAGG - Intergenic
1026982957 7:74537492-74537514 ATGTATGTATGCATGTAGGTAGG - Intronic
1027360828 7:77407779-77407801 ATATATACATATATTTAGCAAGG + Intronic
1027507696 7:79038865-79038887 ATGTTTTTCTATGTGTAGCATGG - Intronic
1027543607 7:79499495-79499517 ATGTATGTATATTTAAAGTATGG - Intergenic
1027564916 7:79779638-79779660 ATGTATGTATTTATGGAGATGGG + Intergenic
1027630480 7:80598350-80598372 ATGTATGGATATATGTATATGGG - Intronic
1027742586 7:82029731-82029753 ATGTATGTATGTATGTATGCAGG + Intronic
1027827278 7:83131953-83131975 ATATATGTATATGTGTACAAAGG + Intronic
1027918756 7:84362208-84362230 ATTTATTTATTTATTTAGCATGG - Intronic
1027986870 7:85304116-85304138 ATATATATATATATATAGCCTGG + Intergenic
1028529200 7:91819350-91819372 ATATATCTATATATATACCATGG - Intronic
1028678570 7:93497395-93497417 ATGTATGTAAGAATCTAGCATGG - Intronic
1028818792 7:95181807-95181829 ATATATGTATATATATATGATGG - Intronic
1028967788 7:96821774-96821796 ATATATATATATATATAGAATGG + Intergenic
1029291788 7:99507601-99507623 ATATATGTATATATATAGGCTGG + Intronic
1029583482 7:101453991-101454013 ATGTATAGACATATGTAGAAAGG - Intronic
1030228696 7:107181693-107181715 ATGTATGTGTGTATGTAGTAGGG - Intronic
1030519525 7:110580713-110580735 ATGTATATATATATATAGGAAGG + Intergenic
1030852397 7:114506562-114506584 ATGTATATATATATATCTCAAGG - Intronic
1030911503 7:115256270-115256292 ATATATATATATATTTAGCCGGG - Intergenic
1031255446 7:119441665-119441687 ATGGATAAATATATGTAGGAAGG - Intergenic
1031391375 7:121218785-121218807 ATGTAGGTATACATGTGCCATGG - Intronic
1031443005 7:121816144-121816166 ATATATATATATATATACCATGG + Intergenic
1031492977 7:122411730-122411752 ATGTGTGTATGTGTGTGGCAGGG - Intronic
1031757085 7:125658523-125658545 ATTTATGTATATAGGTGGAATGG + Intergenic
1033076601 7:138255763-138255785 ATGTGTGTATATATATATGAAGG - Intergenic
1033182003 7:139189061-139189083 CAGTATGTATATAGGTAGTATGG + Intronic
1033208906 7:139445791-139445813 ATGTGTGTATATATATATGACGG + Intergenic
1033737875 7:144242200-144242222 ATGTAAGTATTTCTGTAGAATGG + Intergenic
1033745180 7:144308757-144308779 ATGTAAGTATTTCTGTAGAATGG - Intergenic
1033793554 7:144820676-144820698 TTGTATGTGTATATGTGGTATGG - Intronic
1033820078 7:145124565-145124587 ATATATGTACATTTGGAGCATGG - Intergenic
1034315059 7:150123163-150123185 ATGTAGGTATACATGTGCCATGG - Intergenic
1034570015 7:151948094-151948116 ATGTGTGTATATGTGTATGAGGG + Intergenic
1034711901 7:153200224-153200246 ATATATATATATATATACCATGG + Intergenic
1034791834 7:153977619-153977641 ATGTAGGTATACATGTGCCATGG + Intronic
1035205644 7:157292447-157292469 GTGTATGTATATGTGTGGGAGGG + Intergenic
1035288669 7:157822991-157823013 ATGTATGTCTGTATGGATCATGG - Intronic
1035369367 7:158369246-158369268 ATGTGTGTATATATATATAAAGG - Intronic
1035854175 8:2956035-2956057 ATGTATAAATATATATAGGATGG - Intronic
1036271398 8:7306903-7306925 ATATATATATATATGTACAATGG + Intergenic
1036927497 8:12921292-12921314 ATGTAAGTATATATATAGTGTGG - Intergenic
1036987495 8:13552250-13552272 ATATAGGTATATATGTAGACAGG - Intergenic
1037072515 8:14669195-14669217 ATATATATATATATATAGCTGGG + Intronic
1037075901 8:14717997-14718019 ATATATATATATATGTAATATGG + Intronic
1037417690 8:18668706-18668728 AAGTATGTATATATGTACACAGG - Intronic
1037461941 8:19119751-19119773 ATATATATATATATATAGCCAGG - Intergenic
1037773701 8:21818733-21818755 ATGCATGGATAACTGTAGCAGGG + Intergenic
1038144827 8:24885730-24885752 ATATATATATATATATAGCCAGG + Intergenic
1038154367 8:24973951-24973973 ATGTATGTAGATATATTTCAGGG + Intergenic
1039150697 8:34502142-34502164 AGGTATGTATATATCTAATATGG - Intergenic
1039164420 8:34661186-34661208 CTGTATATATATATATGGCAAGG - Intergenic
1039286554 8:36048124-36048146 ATGTAAATTTTTATGTAGCAAGG - Intergenic
1039664872 8:39514220-39514242 ATGAATGAATATATGTTTCAAGG - Intergenic
1040747332 8:50661595-50661617 ACGTAGGTATACATGTACCATGG + Intronic
1041415236 8:57600608-57600630 ATGAGTGTATATATATAACAGGG + Intergenic
1042050036 8:64693740-64693762 GTGTATGTGTATATATTGCATGG - Intronic
1042284501 8:67093164-67093186 ATCTATGGATTTATGTGGCATGG + Intronic
1042735468 8:71983087-71983109 GTGTATATATATATATAGCTAGG + Intronic
1042783520 8:72520347-72520369 ATGTAGGTATACATGTGCCATGG - Intergenic
1042991670 8:74647139-74647161 ATATATGCATATATGCAGAAAGG - Intronic
1043048263 8:75354373-75354395 ATATATGTATACATGTGCCATGG + Intergenic
1043206115 8:77443396-77443418 ATGTATGTAGGTATGTAGATGGG - Intergenic
1043208953 8:77486280-77486302 ATATATGTATATATATATGATGG + Intergenic
1043558693 8:81465486-81465508 ACATATGTATACATGTACCATGG + Intergenic
1043580944 8:81713489-81713511 ATGTATGTATATATATATATTGG + Intronic
1043666709 8:82823778-82823800 ATATATGTATATATGTATATGGG - Intergenic
1043728338 8:83641820-83641842 ATTTATTTATATACGTAGAATGG - Intergenic
1044034294 8:87279831-87279853 ATATATTTATATATGTATGAGGG + Intronic
1044148029 8:88742002-88742024 ATGTATGCGTGTATGTAGGAAGG - Intergenic
1044188756 8:89288147-89288169 ATGTATGTACATATGTAATCAGG - Intergenic
1044667926 8:94649885-94649907 GTGTATGTATGTGTGTAACAAGG - Intronic
1044894829 8:96880561-96880583 ATATATATATATATATACCATGG + Intronic
1045079690 8:98612006-98612028 ATGTATTTATTTATTTAGCAAGG - Intronic
1045431797 8:102122022-102122044 ATCTATGTATCTATGTATCAAGG - Intronic
1045464836 8:102460348-102460370 ATATATATATATATGTAGCCAGG + Intergenic
1045686427 8:104717309-104717331 ATATATGTATATATTTTACATGG - Intronic
1045794746 8:106029356-106029378 ATATATGTATACATGTGCCATGG - Intergenic
1046238437 8:111458054-111458076 ATGTGTATATATATGTACTAAGG - Intergenic
1046300642 8:112282295-112282317 TTTTATGTATATATGTAAAATGG - Intronic
1046929804 8:119830678-119830700 ATGTATGTATATATTTACTTAGG - Intronic
1046976091 8:120279348-120279370 ATATATATATATATGGACCAGGG + Intronic
1047029212 8:120858436-120858458 ATATATATATATATATAGCTGGG + Intergenic
1047042933 8:121018569-121018591 ATGTATGTATGTATGTGGGGGGG + Intergenic
1047243023 8:123110672-123110694 ACATATGTATATATTTAGCAAGG - Intronic
1047453884 8:124991377-124991399 ATGTATGTATCTATGCATGAAGG - Intergenic
1048119735 8:131566027-131566049 ATATATTTTTATATGTAGCAGGG - Intergenic
1048146032 8:131844476-131844498 ATCTATGTATAAATGTTACATGG - Intergenic
1048257862 8:132918942-132918964 ATGTATTAATGTATGTAACAGGG + Intronic
1048582051 8:135737373-135737395 ATATATGTATATGTGTGCCATGG + Intergenic
1048646836 8:136430014-136430036 ATATATATATATATATATCATGG + Intergenic
1048690118 8:136953394-136953416 ATATATATATATATGTATGAAGG - Intergenic
1048750588 8:137669427-137669449 ATTTATTTATTTATTTAGCAGGG - Intergenic
1048754540 8:137722561-137722583 ATGTGTATATATATATATCAGGG + Intergenic
1048787520 8:138066088-138066110 GTGTATATATATATATATCAAGG - Intergenic
1048787535 8:138066400-138066422 ATATATATATATATATATCAAGG - Intergenic
1048787538 8:138066470-138066492 ATATATATATATATATATCAAGG - Intergenic
1048858380 8:138703491-138703513 ATGTATGTATGTATCTATCAAGG - Intronic
1049132507 8:140860257-140860279 ATGTATGCATACATGTACAAGGG - Intronic
1050003683 9:1105126-1105148 ATATATGTATATATATATAAAGG - Intergenic
1050134776 9:2450320-2450342 ATATATGTATATATATATGAAGG - Intergenic
1050305262 9:4299718-4299740 GTGTGTGTATGTGTGTAGCAGGG - Exonic
1050477057 9:6051137-6051159 ATATATGTATATATATACCATGG + Intergenic
1050788256 9:9431982-9432004 ACGTATGTATACATGTGCCATGG - Intronic
1051111433 9:13641915-13641937 ATGTGTGTATATATGTGCAATGG - Intergenic
1051316219 9:15835849-15835871 ATGCATGTATATATGTAAATAGG - Intronic
1051457842 9:17281336-17281358 ATGTAGGTAAATATGTGCCATGG + Intronic
1051561792 9:18450552-18450574 ATATATGTATATATGAATCTGGG - Intergenic
1051570307 9:18549559-18549581 ATGTATGTATGCATGTTACATGG + Intronic
1051946699 9:22577862-22577884 ATGTAGGTAAATATGTGTCATGG - Intergenic
1052197639 9:25736847-25736869 ATATGTGTATATATGTAACCAGG + Intergenic
1052503941 9:29328645-29328667 AGGTATGTATACATGTGCCATGG + Intergenic
1052519153 9:29521902-29521924 ATGTATGAATATATGAGTCATGG + Intergenic
1052631328 9:31044417-31044439 ATGTATGTATATATGTGTGTAGG + Intergenic
1053612005 9:39723374-39723396 ATTTATGCATCTATGTGGCATGG + Intergenic
1053870043 9:42481368-42481390 ATTTATGCATCTATGTGGCATGG + Intergenic
1054086249 9:60747782-60747804 ATTTATGCATCTATGTGGCATGG - Intergenic
1054241514 9:62619019-62619041 ATTTATGCATCTATGTGGCATGG - Intergenic
1054555640 9:66653542-66653564 ATTTATGCATCTATGTGGCATGG - Intergenic
1054889922 9:70240199-70240221 GTGTATATATATACGTATCATGG + Intergenic
1055089546 9:72348737-72348759 ATATATATATATATATAGGAAGG + Intergenic
1055093657 9:72388269-72388291 ATATATATATATATATAGCTGGG + Intergenic
1055178236 9:73348161-73348183 ATATATATATATATGTCTCAAGG - Intergenic
1055208993 9:73766307-73766329 ATGTAAGTGTATATGTGCCATGG - Intergenic
1055253378 9:74335758-74335780 ATATATGTATATATATAATATGG - Intergenic
1055254168 9:74346302-74346324 ATGTGTGTATATATGTATGATGG - Intergenic
1055254169 9:74346336-74346358 ATGTGTGTATATATGTATGATGG - Intergenic
1055317679 9:75050183-75050205 AAGTATGAAAATATGTTGCAAGG - Intergenic
1055687221 9:78789503-78789525 ATATATATATATATGTTCCAAGG + Intergenic
1055922121 9:81472074-81472096 ATATATATATATATATAGCGGGG + Intergenic
1055932049 9:81569140-81569162 ATGTACGTATATATGTATATAGG + Intergenic
1056090711 9:83202872-83202894 ATGTATGTATACCAGTAGAATGG - Intergenic
1056243847 9:84674605-84674627 ATGTATTTAAATTTGGAGCACGG + Intronic
1056616774 9:88174925-88174947 ATGTTTGTTTATATTTATCATGG - Intergenic
1056655384 9:88504444-88504466 TGGTATGTGTATATGTGGCATGG + Intergenic
1056760823 9:89413759-89413781 ATGTATGGATATATGTACACAGG - Intronic
1057066100 9:92053402-92053424 TTTTATGTATATATCTAGCAGGG - Intronic
1057834872 9:98436391-98436413 ATATATATATATATATAGTATGG + Intronic
1058172025 9:101693257-101693279 ATATATATATATATATTGCACGG + Intronic
1058292799 9:103263214-103263236 GTGTGTGTATATATGTATAAAGG - Intergenic
1059200650 9:112412442-112412464 ATGTAGGTATATGTTTTGCAGGG + Intronic
1059208885 9:112492544-112492566 ATGTATGTACATATGTAGGTAGG - Intronic
1059400703 9:114069095-114069117 ATGTATGTATGTATGTACATGGG - Intronic
1059720636 9:116956669-116956691 ATGTATGTATGTATGTTCCTTGG - Intronic
1059784759 9:117569201-117569223 TTGTATGTATGTGTGTGGCAGGG - Intergenic
1059851394 9:118345123-118345145 ATATATGCATATATTAAGCAGGG - Intergenic
1060338098 9:122745917-122745939 ATGTAGGTATACATGTGCCATGG + Intergenic
1060425889 9:123505273-123505295 GTGTATGTAAGTAAGTAGCATGG - Intronic
1061956466 9:133964305-133964327 GTGTATATATATATATATCAGGG - Intronic
1185483690 X:466778-466800 ATATATATATATATATAGCCAGG - Intergenic
1185744350 X:2560044-2560066 ATGGATGTATATATGGATGATGG + Intergenic
1185831428 X:3306549-3306571 CTGCATGTATTTATCTAGCACGG + Intergenic
1185988506 X:4865229-4865251 ATGTATGTATATGTATAGACAGG - Intergenic
1185997615 X:4969579-4969601 AAGTATGAATATATGTAGATAGG - Intergenic
1186018735 X:5229295-5229317 ATATATGTACATATGCAGCAGGG + Intergenic
1186022289 X:5269682-5269704 ATATATATATGTATGTAGGATGG + Intergenic
1186135903 X:6520568-6520590 ATATATGTACATATGCAACATGG + Intergenic
1186370184 X:8938534-8938556 AAGTATGAAAATATGTTGCAAGG + Intergenic
1186604257 X:11073163-11073185 ATAGATGTATATATAGAGCAAGG - Intergenic
1186943148 X:14534625-14534647 ATGTATGTATATATAAAATAAGG - Intronic
1187262335 X:17697448-17697470 ATGAAAGAATATATGAAGCAAGG + Intronic
1187544602 X:20236082-20236104 ATGTATATATTTATTTAGAATGG - Intronic
1187563988 X:20430147-20430169 ATATATGTATATAAATAACAAGG - Intergenic
1187633458 X:21200846-21200868 ATATATGTATATATATATGAAGG - Intergenic
1187813686 X:23208249-23208271 GTGTATGCATAATTGTAGCAAGG + Intergenic
1187937241 X:24347795-24347817 ATGTTTGTATTTATGGGGCATGG - Intergenic
1188267085 X:28090678-28090700 ATGTAGGTATACATGTGCCATGG + Intergenic
1188335519 X:28927472-28927494 ATGTGTGTTTGCATGTAGCAAGG - Intronic
1188417752 X:29956650-29956672 ATATATGTATATATATATAAGGG - Exonic
1188545128 X:31297047-31297069 GTGTATGTATATAGTAAGCATGG + Intronic
1188638951 X:32474186-32474208 ATGTATGTATGTATATATGATGG - Intronic
1188710871 X:33395998-33396020 ACGTAGGTATATATGTGCCATGG + Intergenic
1188758755 X:33999019-33999041 ATATATATATATATATACCATGG + Intergenic
1188924845 X:36026653-36026675 ATTTATGAATTTATGGAGCATGG - Intergenic
1189950812 X:46228849-46228871 ATATATATATATATATAGCTGGG + Intergenic
1190511642 X:51179150-51179172 ATATATGTATATATGTAGCAGGG + Intergenic
1190648060 X:52541449-52541471 ATAGATGTATATGTGAAGCAGGG - Intergenic
1190746512 X:53326289-53326311 GTGTATGTATGTGTGTAGCAAGG + Intergenic
1190853592 X:54270627-54270649 ACGTAGGTATACATGTACCATGG + Intronic
1191013026 X:55780607-55780629 ATATATATATATATATATCACGG - Intergenic
1191692562 X:63955983-63956005 ATATATATATATATGTATGATGG + Intergenic
1191692564 X:63956057-63956079 ATATATATATATATGTATGATGG + Intergenic
1191840201 X:65508247-65508269 ATGTATATGTATGTGTGGCATGG - Intergenic
1191916684 X:66208611-66208633 ATGTATGTATATATTTGAGATGG - Intronic
1191918587 X:66229234-66229256 ATGTAGATATATATGTGCCATGG + Intronic
1192075275 X:67988807-67988829 ATGTATGTGTATATGGAGAGAGG + Intergenic
1192110839 X:68362572-68362594 ATCTATGTATACACGTAGAACGG - Intronic
1192155435 X:68742887-68742909 ATGTATATATATATATATAATGG + Intergenic
1192565806 X:72162526-72162548 ATATATATATATATATAGCTGGG + Intergenic
1193011710 X:76682942-76682964 ATGTGTGTACCTATGTAGCAAGG + Intergenic
1193102293 X:77627866-77627888 ATGTATGTATTTAGGGGGCAGGG - Intronic
1193398868 X:81019021-81019043 ATGTAGGTATACATGTGCCATGG + Intergenic
1193504787 X:82328832-82328854 ATATATGTATATATGTATATAGG - Intergenic
1193583442 X:83292557-83292579 ATGTAGGTATACATGTGCCATGG + Intergenic
1193641403 X:84013583-84013605 ATATAGGTATATATGTGCCATGG - Intergenic
1193814575 X:86089664-86089686 GTGTATATATATATATAGTATGG - Intergenic
1193841217 X:86411034-86411056 ATATATGTATATATGTAAAGGGG + Intronic
1193919851 X:87411293-87411315 ATATATGTATATATATGACATGG - Intergenic
1193931057 X:87552697-87552719 ATATATATATATATATAACATGG + Intronic
1194012358 X:88578305-88578327 ATATATGTATATATATATGATGG + Intergenic
1194058922 X:89172672-89172694 ATATATGTATATATATAAAAGGG - Intergenic
1194220804 X:91188014-91188036 ATATATGTATATTTGAAGCCTGG + Intergenic
1194572641 X:95572755-95572777 ATGTATGGAAAGATGTGGCAGGG + Intergenic
1195237307 X:102913281-102913303 ATGTATGTATATATATATGCAGG + Intergenic
1195405377 X:104507416-104507438 ATGTTTGTTTATTTGGAGCAGGG - Intergenic
1195504779 X:105644669-105644691 ACATAGGTATATATGTACCATGG + Intronic
1195541780 X:106070230-106070252 ATGTATGCGTATGTGTTGCAAGG - Intergenic
1195909812 X:109877640-109877662 ATGTATGTATACAAGAAGCTAGG + Intergenic
1196145359 X:112310361-112310383 ATATATATATATATGTATAAAGG - Intergenic
1196188422 X:112769833-112769855 ATATATATATATATGCAGAATGG + Intergenic
1196205771 X:112937711-112937733 ATGTATATATATATTTAGCCGGG + Intergenic
1196246903 X:113411051-113411073 ATGTATTTATTTATTTACCATGG + Intergenic
1196434367 X:115661533-115661555 ATATATATATATATTTAGCTGGG + Intergenic
1196927980 X:120652715-120652737 ATGTAGGTATACATGTGCCATGG - Intergenic
1197221029 X:123914183-123914205 ATGTATATATATATGAACAATGG + Intergenic
1197281867 X:124546636-124546658 GTGTATGTATATATATAATATGG - Intronic
1197475817 X:126923500-126923522 ATATATGTATATATATATGATGG - Intergenic
1197477040 X:126938838-126938860 ATATATATATATATGTATAAAGG + Intergenic
1197525497 X:127557052-127557074 ATATATGTATATATATATAATGG - Intergenic
1197636960 X:128926125-128926147 AGGTATGTATACATGTGCCATGG + Intergenic
1197665638 X:129220549-129220571 ATGTATGTATATATGTATGTGGG - Intergenic
1197722922 X:129756991-129757013 ATATATATATATATATAGCTGGG - Intronic
1197882207 X:131178561-131178583 ATGAATGTATGAATGGAGCAGGG + Intergenic
1198010263 X:132545345-132545367 ATGTATTTATAAATTTTGCAGGG - Intergenic
1198170901 X:134104213-134104235 ACGTAGGTATACATGTACCATGG - Intergenic
1198185568 X:134251085-134251107 ATGTGTGTATATATTTGGGAAGG + Intergenic
1198237691 X:134750961-134750983 ATTTATATATATATATAGCCTGG + Intronic
1198242357 X:134798295-134798317 ATATATGAAAATATGTTGCAAGG + Intronic
1198838127 X:140826297-140826319 ATATATATATATATATAGCATGG - Intergenic
1198854188 X:140998734-140998756 ATCTATGTATTTATGTGTCATGG + Intergenic
1198877821 X:141246379-141246401 ATCTATGTATTTATGTGTCATGG - Intergenic
1198908279 X:141585806-141585828 ATCTATGTATTTATGTGTCATGG + Intronic
1199377127 X:147126569-147126591 ACGTATGTATACATGTGCCATGG + Intergenic
1199892367 X:152098914-152098936 ATGTATTTATATATGCATGATGG + Intergenic
1200370200 X:155716996-155717018 ATATATATATATATATAGCTGGG + Intergenic
1200557310 Y:4651755-4651777 ATATATGTATATTTGAAGCCTGG + Intergenic
1200781624 Y:7221469-7221491 ATGTATGAATAGATGTAAAATGG + Intergenic
1200811191 Y:7486954-7486976 ATGTATGTATGTATGTATGGAGG - Intergenic
1201234865 Y:11899556-11899578 ACGTATGTATACATGTGCCATGG - Intergenic
1201428102 Y:13876045-13876067 GTTTATACATATATGTAGCATGG - Intergenic
1201603837 Y:15763280-15763302 ATGTATATATATACGAAGCAGGG - Intergenic
1201669059 Y:16495407-16495429 GTGTATGTATATATATATAAAGG + Intergenic
1201862701 Y:18616773-18616795 ATATATATATATATGTTCCAAGG - Intergenic
1201870622 Y:18703607-18703629 ATATATATATATATGTTCCAAGG + Intergenic
1202036176 Y:20638942-20638964 AAGTAGATATATATGTAGGATGG + Intergenic
1202096432 Y:21253383-21253405 ATATATATATATATATAGTAAGG - Intergenic
1202164541 Y:21972513-21972535 ATATATATATATATATATCACGG - Intergenic
1202226815 Y:22613859-22613881 ATATATATATATATATATCACGG + Intergenic
1202316305 Y:23581795-23581817 ATATATATATATATATATCACGG - Intergenic
1202330414 Y:23746168-23746190 ATGTATATATATATGTATATTGG + Intergenic
1202540355 Y:25923893-25923915 ATGTATATATATATGTATATTGG - Intergenic
1202554459 Y:26088271-26088293 ATATATATATATATATATCACGG + Intergenic