ID: 1169687098

View in Genome Browser
Species Human (GRCh38)
Location 20:8287649-8287671
Sequence GGATGTACAAAGAATCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169687095_1169687098 3 Left 1169687095 20:8287623-8287645 CCAGCAGAATCATAGCATTGCCT 0: 1
1: 0
2: 0
3: 16
4: 120
Right 1169687098 20:8287649-8287671 GGATGTACAAAGAATCAGCATGG 0: 1
1: 0
2: 0
3: 12
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169687098 Original CRISPR GGATGTACAAAGAATCAGCA TGG Intronic
904867557 1:33592786-33592808 GAATGTACAAAAAATTAGCTGGG + Intronic
905368998 1:37472796-37472818 GGATGTTCAGAGATTCAGAAAGG - Intergenic
906040687 1:42785774-42785796 GGATGAACAAAGAATTAGGAGGG - Intronic
906337397 1:44945391-44945413 AAAAGTACAAAAAATCAGCAGGG + Intronic
907841803 1:58165399-58165421 GGATGTACAGAGAATCGGGGAGG - Intronic
909602389 1:77474030-77474052 GGCTGGACAAACAATAAGCAGGG + Intronic
910348626 1:86270184-86270206 GGCTGCACAAAGAATCACCTGGG - Intergenic
913441657 1:118904874-118904896 GGTTGTACTAATAGTCAGCAGGG - Intronic
916850154 1:168695403-168695425 GAATGGATAAATAATCAGCAAGG + Intergenic
923888641 1:238186246-238186268 AGATGTAGAAAGAATCAGACTGG - Intergenic
924052506 1:240092619-240092641 GGATGGACAAAGGACCAGCTCGG + Exonic
1064860672 10:19821689-19821711 GGATGGACAAAGTCTTAGCATGG - Intronic
1074538121 10:114343530-114343552 AGATTTACAAATAACCAGCAAGG + Intronic
1074763566 10:116684912-116684934 GGATGCTCAGAGAAACAGCATGG + Intronic
1085956350 11:81400859-81400881 GTGTGTACAAAGAATTAGAAAGG - Intergenic
1086685730 11:89731227-89731249 GGATATATTAAGAATCATCAGGG + Intergenic
1088141760 11:106625368-106625390 GTATGTAAAAAGAATCAATACGG - Intergenic
1089236315 11:117029294-117029316 GGATCTACAAAAAATTAGCTGGG + Intronic
1090014596 11:123074823-123074845 AGATGTACAAAGCATCGGCATGG - Exonic
1103355701 12:120318287-120318309 GTCTCTACAAAAAATCAGCAAGG - Intergenic
1105058100 12:133122210-133122232 GCCAGTACAAAGAATCAGGATGG - Intronic
1108927241 13:55768529-55768551 GGATGCAGGGAGAATCAGCAAGG + Intergenic
1109797422 13:67334736-67334758 TGATTGACAAATAATCAGCATGG + Intergenic
1112167827 13:96938359-96938381 GGATGTACTAAGAAGCTGCCTGG + Intergenic
1114725477 14:24931855-24931877 AGCTATACAAAGAATCAGGAAGG + Intronic
1116291181 14:43043267-43043289 GGTAGTATAGAGAATCAGCAGGG - Intergenic
1120484676 14:85097918-85097940 TGATGTCTAAAGAATCAGTAAGG + Intergenic
1121155261 14:91677324-91677346 GAATCTACAAAGAATCTACAAGG + Intronic
1124793996 15:32758810-32758832 GGATATACAAAGATTCAGAAAGG - Intergenic
1129817537 15:78567993-78568015 AGAGAAACAAAGAATCAGCAAGG - Intronic
1130512691 15:84602304-84602326 GGATAAACACAAAATCAGCAGGG - Intronic
1131324550 15:91429833-91429855 GGGTGAACAAAGAAGCAGCTTGG + Intergenic
1131402304 15:92134957-92134979 AGATGTAAAAAAAATTAGCAGGG + Intronic
1133557967 16:6923612-6923634 GGATGGAGAGTGAATCAGCAGGG + Intronic
1133641809 16:7724402-7724424 TGATGTACTAAGAATCTGCTGGG - Intergenic
1134403036 16:13929080-13929102 GGATTTAAAAAAAATCACCATGG - Intronic
1135431964 16:22392273-22392295 GGATTAACAAAGAAGCAGAAAGG - Intronic
1135910393 16:26555487-26555509 GGATTTACAAAGGGTCACCATGG + Intergenic
1136990768 16:35150127-35150149 GGCAGTACCAAGAAACAGCAAGG + Intergenic
1137859076 16:51828158-51828180 GGTTGTATAAAGTATCATCAAGG + Intergenic
1137862995 16:51865622-51865644 GTGTGTACTAAGAATCACCAGGG + Intergenic
1138020543 16:53475990-53476012 GTATCTACAAAAAATTAGCAGGG - Intronic
1139542362 16:67627776-67627798 GTCTGTACAAAAAATCAGCTGGG + Intronic
1140266615 16:73426792-73426814 GGATGCAAAAAGAATCTTCAAGG - Intergenic
1140279591 16:73542631-73542653 GGATTTAAAAGGAATCTGCATGG + Intergenic
1140350141 16:74254526-74254548 GGATGTAGAAAGACTTAGTAAGG - Intergenic
1141844917 16:86601773-86601795 GGCTGAACAAAGAGGCAGCATGG - Intergenic
1142105743 16:88301742-88301764 GGATGTACACAGAGACAGAAGGG - Intergenic
1143765094 17:9132553-9132575 GGATGTTTAATAAATCAGCAAGG + Intronic
1144285079 17:13766307-13766329 GGATGTACAAAGAAAAAAAAAGG - Intergenic
1144556217 17:16285262-16285284 GGATATAAAAAGGATTAGCAAGG - Intronic
1149225915 17:54470620-54470642 GTATGTAAAATGAATCAGAAAGG + Intergenic
1151568663 17:74915164-74915186 GGATGGCCAAAGAAGCCGCAGGG + Intergenic
1151605880 17:75135457-75135479 GGATGTACAATGAAACTGCCTGG - Exonic
1153569551 18:6455176-6455198 TGGTGTACAAAGAGTTAGCATGG - Intergenic
1153608538 18:6858266-6858288 GAATGAACAAAGAATAAGAAAGG - Intronic
1153794836 18:8611932-8611954 GGATGTTCAGAGAATGATCATGG + Intronic
1157380384 18:47209574-47209596 GGATGGAAACAAAATCAGCATGG + Intergenic
1157530080 18:48412856-48412878 GTATATACAAAGAAACAGCAGGG - Intergenic
1159629091 18:70728325-70728347 GGACACACAGAGAATCAGCAGGG - Intergenic
1159833093 18:73302631-73302653 GGATTTTCAAAGCATCTGCAAGG + Intergenic
1160757159 19:763833-763855 AGAAGCAGAAAGAATCAGCAGGG - Exonic
1162955249 19:14093847-14093869 GGATGGAGAAAGAAGCATCATGG - Intronic
1164819754 19:31239123-31239145 GGAAGTATAAAGTATCAGAAGGG - Intergenic
1164923392 19:32106857-32106879 TGATGTACCATGAATCAGCTGGG + Intergenic
1165972577 19:39644722-39644744 TCATGTACAAAGAGTTAGCATGG - Intergenic
1167971791 19:53192534-53192556 GGATTTACAAAGAGACAGTAAGG - Intronic
1168440549 19:56362406-56362428 GACAGTACAAAGAATCAGCCGGG + Intronic
1168657373 19:58140571-58140593 AAATGTACAAAAAATCAGCTGGG - Intronic
930583530 2:53242518-53242540 GCACGTACAAAGAATCAATATGG - Intergenic
930619964 2:53633380-53633402 GGATCTGCAAGGAATCAGTAGGG + Intronic
931413483 2:62058264-62058286 AGATGAAAAAAGAATCAGTATGG - Intronic
932072949 2:68638873-68638895 AGATATAGAAAGAATCACCAAGG + Intergenic
932808258 2:74801360-74801382 GGATACACAAAGAGACAGCAGGG + Intergenic
934635935 2:95990943-95990965 TGATTTATAAAGAAGCAGCATGG + Intronic
934797718 2:97114491-97114513 TGATTTATAAAGAAGCAGCATGG - Intronic
934835698 2:97588948-97588970 TGATTTATAAAGAAGCAGCATGG + Intronic
935417004 2:102829537-102829559 GGATGTGCCAAGAGTCACCATGG + Intronic
936956050 2:118023348-118023370 AGAAGTACAAAAAATCAGCCAGG + Intergenic
937792351 2:125975581-125975603 GGATATGCAAAGAATCACCCTGG + Intergenic
938787320 2:134642958-134642980 AGATGAACAAAGAATAAGCATGG + Intronic
939920014 2:148098700-148098722 GGCTATACATAGAATCACCACGG - Intronic
940657610 2:156507801-156507823 GCAGGTACAAAGAATGGGCAAGG - Intronic
940784220 2:157964907-157964929 GGATCTACAACAAATTAGCAAGG - Intronic
942963665 2:181863380-181863402 GGAAGTGCAAACAATAAGCATGG - Intergenic
943190325 2:184669543-184669565 GGATGTATAAAGAACCAGGGTGG - Intronic
943906647 2:193507561-193507583 AGATGGACTAAGAAACAGCAGGG - Intergenic
944270044 2:197772482-197772504 GGATATCCAAAGAATTAGTAGGG - Intronic
948307505 2:236960178-236960200 GGATGTCCAAAGAACCATCAGGG + Intergenic
1169186554 20:3622190-3622212 GGATGTAAAAAGCAACAGCCAGG + Intronic
1169687098 20:8287649-8287671 GGATGTACAAAGAATCAGCATGG + Intronic
1179220128 21:39399308-39399330 GGAAGTACAGAAAAGCAGCAAGG + Intronic
1181566490 22:23741945-23741967 GGATGCACAAAAACCCAGCATGG + Exonic
1182105596 22:27686777-27686799 GGAGGGACAAAGAATCAGGCCGG + Intergenic
1182941764 22:34283736-34283758 GGGTGAACACAGAAACAGCATGG - Intergenic
1185093451 22:48790751-48790773 GGCTGGACAATGAAACAGCAAGG - Intronic
949238376 3:1839100-1839122 GGAAGAAGAAAGAATGAGCAAGG + Intergenic
951980411 3:28560053-28560075 GGATGAAGAAAGAAACTGCAGGG - Intergenic
956322570 3:68014088-68014110 GAATGTACACAGATTCAGCTTGG - Intronic
958427340 3:93994221-93994243 GGAAGGTCCAAGAATCAGCAAGG - Intronic
958767733 3:98390513-98390535 GGATGTATTTAGAAACAGCAGGG + Intergenic
960272463 3:115689831-115689853 GGAGGCAGAAAGAATAAGCAAGG + Intronic
960665744 3:120107221-120107243 AGATGTACAAAATATCAGCATGG - Intergenic
964818023 3:160738265-160738287 TGAATTCCAAAGAATCAGCACGG + Intergenic
968174388 3:196536750-196536772 TTATGTACAAAGAATGATCATGG - Intergenic
968280138 3:197470990-197471012 GGACACACAAAGAAACAGCAGGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
969082872 4:4633337-4633359 GGATGGAGTAGGAATCAGCAAGG - Intergenic
970862859 4:20723462-20723484 GGATGTAGAAATAAGCAGCAAGG + Intronic
971013364 4:22463173-22463195 GGCTGTATAAAGAATGGGCAAGG - Intronic
971073325 4:23119876-23119898 GCCGATACAAAGAATCAGCATGG - Intergenic
972260350 4:37401751-37401773 GGATGTTCAAAGAACCAGAAAGG - Intronic
972920812 4:43939018-43939040 GAAGGTACAAAAAATCAGCCAGG + Intergenic
973878051 4:55241355-55241377 GGAGGCACCAAGAATGAGCAAGG - Intergenic
977464397 4:97365117-97365139 TGATGGACAAAGAATTAGAAAGG + Intronic
978405778 4:108377338-108377360 GGATGGACAAACAAGCAGCTGGG - Intergenic
978981839 4:114956893-114956915 AGATATACAAAGAAACAGGATGG + Intronic
979547187 4:121951642-121951664 GGAAGTGCAAAGAACAAGCAAGG - Exonic
990099920 5:52169594-52169616 GGATGAACAATGGATCAGGAAGG - Intergenic
993750831 5:91665394-91665416 GGCTGGAGAAAGAATCACCATGG + Intergenic
995637738 5:114214258-114214280 CGATGTATAGAGAATGAGCATGG + Intergenic
995799910 5:115982703-115982725 AGATGGAGGAAGAATCAGCAGGG + Intronic
996008951 5:118459051-118459073 GACTGTACAAGGAATCAGAATGG + Intergenic
996505227 5:124261095-124261117 GGAGTTACAAAGAATCACAAAGG + Intergenic
996760418 5:126981014-126981036 TGCTGCACAAAGAATCAGCCTGG + Intronic
1001007056 5:168061720-168061742 GGATGTAAAACTTATCAGCAGGG - Intronic
1003841986 6:10130063-10130085 AGATATACAAAGAAACAGGAAGG + Intronic
1007097543 6:39223083-39223105 GGTATTACAAAGAATCAGGAAGG - Intronic
1008412407 6:51195327-51195349 GGAAGTGCAAACAATCAGAATGG - Intergenic
1009773927 6:68180448-68180470 GCATGTACAGGTAATCAGCATGG + Intergenic
1010739800 6:79487345-79487367 GGATTTCCAAAGAAACAGTATGG - Exonic
1010987405 6:82440555-82440577 CCATGTACAAAGACACAGCATGG - Intergenic
1011570029 6:88725321-88725343 GTCTGTACACAGAATCATCATGG - Intronic
1011866336 6:91833223-91833245 GCATGTACAAAGCACCAGGAGGG - Intergenic
1012797267 6:103778234-103778256 GGATGTACAAACAATCATAGAGG + Intergenic
1014589972 6:123252779-123252801 AGATATTCAAAGAATCAGCCAGG - Intronic
1015454745 6:133413926-133413948 GCATGAAAAAAGAATCAGGATGG - Intronic
1015687474 6:135881193-135881215 TGATGTATAAAGAAACAGTAAGG + Intronic
1017098181 6:150823896-150823918 GGATGAATAAATAATCACCATGG - Intronic
1019938912 7:4273867-4273889 GGATGTAAAAATAATGAACAAGG - Intergenic
1020383217 7:7568047-7568069 GAATGAACACAGAATCAGCATGG + Exonic
1020777490 7:12473160-12473182 GGATATGCAAAGTAACAGCATGG - Intergenic
1020965870 7:14867799-14867821 GCATGTAAAAACAATTAGCATGG + Intronic
1026322726 7:69281723-69281745 TGATGCACAAAGCATCAGCTAGG - Intergenic
1028097640 7:86782031-86782053 GAAAGTACTAGGAATCAGCATGG - Intronic
1028545660 7:91996705-91996727 GAATCTACAAAGAATGAGGATGG + Intronic
1029158342 7:98533259-98533281 GTATATACAAAAAATTAGCATGG + Intergenic
1029984677 7:104912127-104912149 GGTGGTGCAAAGGATCAGCACGG - Intergenic
1031188854 7:118519968-118519990 AGATGTGCATAGAATCAGAAAGG + Intergenic
1032285725 7:130537224-130537246 GGATGAGAAAAGAATCAGGAAGG + Intronic
1032286488 7:130541650-130541672 GGATGAGAAAAGAATCAGGAAGG + Intronic
1032739794 7:134727579-134727601 GGAGGAACAAGGAAACAGCATGG + Intergenic
1032906985 7:136379786-136379808 GGATGGACAAAAACTCAGAAGGG - Intergenic
1033525863 7:142212524-142212546 GGAAGTAAAAAGAAAAAGCAGGG + Intronic
1033770269 7:144543181-144543203 GAATGCACAAAGAATAAACAAGG + Intronic
1036440380 8:8776667-8776689 GAAAGTACAAAAAATTAGCAAGG + Intergenic
1038015070 8:23507981-23508003 GGAAGTACTTAGAGTCAGCAGGG + Intergenic
1039300403 8:36202906-36202928 TCAGGTAGAAAGAATCAGCAAGG + Intergenic
1040342809 8:46449897-46449919 GAAACTAGAAAGAATCAGCAAGG - Intergenic
1040557269 8:48491766-48491788 AGATGTACAAAGAAACAATAAGG - Intergenic
1041749405 8:61243416-61243438 GGATGATCAAAGAATGAGGAGGG - Intronic
1041992754 8:64013771-64013793 TGAAGTATAAAGAATGAGCACGG - Intergenic
1042416836 8:68529505-68529527 GGATAAATAAAGAATCTGCAGGG - Intronic
1043651566 8:82600574-82600596 GCATGTACACAGACTCAGCTGGG - Intergenic
1044763982 8:95551922-95551944 GGCTGTACCAAGAATGAACACGG + Intergenic
1044862520 8:96536677-96536699 GGATGTAGCAACAGTCAGCAAGG + Intronic
1045256351 8:100526909-100526931 GGTTGTAAATAGAATAAGCAAGG - Intronic
1045907022 8:107358454-107358476 GGATGTAACAAGCATCACCAGGG - Intronic
1046155930 8:110290109-110290131 GAAAGTACAAAAAATTAGCAGGG - Intergenic
1049835311 8:144731745-144731767 GAAAATACAAAAAATCAGCAGGG - Intronic
1049978472 9:882415-882437 GGATGTATAAAGGATAAGAAAGG - Intronic
1050466657 9:5933009-5933031 GGATGTAATAAAAATCAGAAAGG + Intronic
1056724854 9:89105986-89106008 GGATGTTCAATAAATCTGCATGG - Intronic
1058833072 9:108836678-108836700 GGATATAAAAAGATTCAGCAAGG - Intergenic
1059195974 9:112371325-112371347 GGATGTAGAATGAGGCAGCAAGG - Intergenic
1059260014 9:112966850-112966872 GTATGAACTAAGAATCAGAAAGG + Intergenic
1059974722 9:119703194-119703216 AAATGTATAAAGAAGCAGCAAGG - Intergenic
1062226804 9:135457014-135457036 GGCTGAACAAAGAAGCAGGAAGG - Intergenic
1202804426 9_KI270720v1_random:38029-38051 GGATGAATAAAAAATCAGTAAGG + Intergenic
1186611631 X:11143680-11143702 GGAGGGAAAAAGAATCAGCTGGG + Intronic
1187827368 X:23345463-23345485 GGATATACAAAGGTTCAGCAAGG - Intronic
1189227235 X:39423044-39423066 GGATGGACTATGTATCAGCAAGG - Intergenic
1190042433 X:47082033-47082055 GGATGTATAAAGCATCAACCAGG + Intronic
1190942831 X:55059294-55059316 GTATGCACAGAGAAACAGCAGGG - Intergenic
1193951347 X:87803806-87803828 GAATATACAGAAAATCAGCAAGG + Intergenic
1195771621 X:108357607-108357629 AGAAGTTCAGAGAATCAGCATGG - Intronic
1196297191 X:114011723-114011745 GGATTCACAAAGAGACAGCAGGG + Intergenic
1196830617 X:119772818-119772840 GGCTGTTCGAAGGATCAGCAAGG - Intergenic
1196895344 X:120330428-120330450 GGATGTACCAACAATAACCAAGG + Intergenic
1197687536 X:129457615-129457637 GGCTGTACAACTAATTAGCAAGG - Intronic
1198366284 X:135943182-135943204 AGATGAAGAAACAATCAGCATGG + Intergenic
1199508563 X:148593866-148593888 GGTTGTATGAACAATCAGCATGG + Intronic
1199653253 X:149969217-149969239 GCCTGGACAAAGAAGCAGCATGG - Intergenic
1200325915 X:155238794-155238816 GGATGTAAAAAGAAGAAACAAGG + Exonic
1200329051 X:155275149-155275171 GGAAGTACAAATAATCAAGAAGG - Intergenic