ID: 1169697764

View in Genome Browser
Species Human (GRCh38)
Location 20:8410094-8410116
Sequence CATTATATGCATATATTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 409}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169697764 Original CRISPR CATTATATGCATATATTGTT GGG Intronic
900005569 1:46803-46825 CATCATCTTCATATATAGTTGGG - Intergenic
900040116 1:453797-453819 CATTTTATGTATTTATTGTCAGG - Intergenic
900061546 1:688773-688795 CATTTTATGTATTTATTGTCAGG - Intergenic
902088849 1:13886055-13886077 CATTTTGTGCATCTATTGGTTGG + Intergenic
903547239 1:24133235-24133257 CATAATATGCATATATTACCTGG - Intronic
907080992 1:51621676-51621698 TTTTATATGCAGATCTTGTTTGG - Intronic
907627271 1:56042518-56042540 CATTGCATCAATATATTGTTTGG - Intergenic
907754358 1:57296138-57296160 GAGTAAATGCAGATATTGTTGGG + Intronic
908305133 1:62806512-62806534 AATTATATATATATATTTTTTGG + Intronic
908634759 1:66150707-66150729 CATTATATCCCTACTTTGTTAGG + Intronic
910134082 1:83945916-83945938 CATTATTTGCAAATGTGGTTTGG - Intronic
910469110 1:87531959-87531981 TATTATATGTATATATTTTTAGG + Intergenic
910545106 1:88407035-88407057 TATTATATCCAGATATTGTCAGG - Intergenic
910572922 1:88725910-88725932 AATTCTATACATATTTTGTTAGG + Intronic
910777359 1:90890585-90890607 GCTTATATCCATTTATTGTTTGG + Intergenic
910820594 1:91340899-91340921 TATTAGATGCATATATATTTAGG - Intronic
911046800 1:93635545-93635567 CATTCTCTGCAAATATTCTTGGG - Intronic
911327980 1:96491607-96491629 CATTATATACATATAATGTTGGG - Intergenic
911429388 1:97764862-97764884 CATTGAATGTATAAATTGTTGGG - Intronic
911722335 1:101205048-101205070 CACTTTATGCATCTATTATTGGG - Intergenic
912097404 1:106162056-106162078 TTTTATATGTATATATTATTGGG - Intergenic
913210565 1:116579093-116579115 CATTATACTAGTATATTGTTAGG - Intronic
913428958 1:118767682-118767704 TCTTAAATGCAAATATTGTTGGG + Intergenic
915303140 1:154962801-154962823 TTTTATATGCATATATTTTAGGG - Exonic
915614741 1:157028733-157028755 GATTATTTGCATATTTTCTTTGG - Intronic
915867743 1:159522677-159522699 CCTTCTATGCATAGTTTGTTGGG + Intergenic
915968878 1:160337856-160337878 CTTTATATGAATAAATTGTATGG - Intronic
916898619 1:169195079-169195101 CATTATATGCAATTATAATTTGG + Intronic
917406853 1:174716236-174716258 AATTATCTGCATCCATTGTTTGG + Intronic
918787502 1:188781855-188781877 AATTATATTTATGTATTGTTTGG + Intergenic
919389927 1:196970691-196970713 CATTATCTGCATAAATCATTCGG + Intergenic
921194757 1:212744835-212744857 CTTGTTATGCATATATTGATGGG - Intronic
921688649 1:218121408-218121430 CATTTTATGTATAAATTGTGAGG + Intergenic
922099961 1:222471903-222471925 CATTATATAAATATTTTGGTCGG - Intergenic
922735081 1:227974345-227974367 CATTATATAAATATTTTTTTCGG + Intergenic
923893529 1:238242176-238242198 CATTATAATAAAATATTGTTTGG + Intergenic
924256211 1:242185382-242185404 TATTAGATGCATGTATTATTTGG + Intronic
1063640929 10:7829837-7829859 GAATATCTGCATATGTTGTTAGG + Intronic
1066354556 10:34669536-34669558 CGTTACATGGATATATTGTGTGG - Intronic
1066733326 10:38452002-38452024 CATTATATGAATATTTTGGTAGG + Intergenic
1067052805 10:43032864-43032886 CCTATTATGCATATATTGGTTGG - Intergenic
1067368233 10:45656640-45656662 CATTATCTGTATATCTTTTTTGG - Intronic
1067964766 10:50898558-50898580 TAGTATCTGCATATATTATTTGG + Intergenic
1068122646 10:52799343-52799365 CATTAGGTGCATATATATTTAGG + Intergenic
1069122505 10:64584660-64584682 CATTGGATGCATATATATTTAGG - Intergenic
1069476755 10:68740769-68740791 CATTATATTCCTAAATTATTAGG - Intronic
1069526502 10:69176651-69176673 CATCAAATTCATATATTGATTGG + Intergenic
1071931591 10:90477829-90477851 CGTTTTATGCATTTATTATTGGG - Intergenic
1073556542 10:104457921-104457943 AATTATATGGACATCTTGTTGGG + Intergenic
1074240449 10:111633639-111633661 CAATATATGCATAGATTCCTGGG - Intergenic
1075827916 10:125375951-125375973 TATTATGTGTATATATTTTTTGG - Intergenic
1076047498 10:127306315-127306337 CATTTTATGCATATTTGATTTGG + Intronic
1076966338 11:89704-89726 CATTTTATGTATTTATTGTCAGG - Intergenic
1077693152 11:4367719-4367741 CATTACATGCATATTTGGCTAGG + Exonic
1078288852 11:9985738-9985760 TATTAGATGCATATATGTTTAGG - Intronic
1078919239 11:15812633-15812655 CAAGATATGGATATATTGTTTGG + Intergenic
1080031681 11:27667722-27667744 TATTAGGTGCATATATTTTTAGG - Intronic
1080207336 11:29745349-29745371 TATTATATGCATATATTGATAGG + Intergenic
1080594143 11:33754119-33754141 CATTATATTCATGTATAATTGGG - Intronic
1080670810 11:34375435-34375457 CAATATGTGCATATATATTTAGG + Intergenic
1081284431 11:41249862-41249884 CATTATGTTCATATTTAGTTGGG - Intronic
1081420151 11:42866396-42866418 TAATATATGAATATATTCTTTGG + Intergenic
1085148699 11:74229327-74229349 TATTATATATATATATTTTTAGG - Intronic
1086046061 11:82533524-82533546 TATTTTATGCATAATTTGTTGGG + Intergenic
1087866511 11:103234330-103234352 CTTTATATGAATAGATTTTTAGG + Intronic
1088165091 11:106925822-106925844 CATTGTTTGCATTTAATGTTTGG - Intronic
1088993420 11:114974282-114974304 TATAATATGCATAAAATGTTGGG + Intergenic
1089336856 11:117731121-117731143 CATTAAATGGGTATATTGTATGG + Intronic
1089725876 11:120479511-120479533 AATAATATGCATATAGTGTCTGG + Intronic
1090756916 11:129800228-129800250 TGTTAGATGCATATATAGTTAGG - Intergenic
1091496213 12:975152-975174 CATAATATGTATATAGGGTTTGG + Intronic
1091679252 12:2514842-2514864 CATTAAATGAATAAATTGTTAGG + Intronic
1092601247 12:10067862-10067884 CATTATATGAATAGATTTTTAGG - Intergenic
1093077933 12:14776137-14776159 CAATATATACATATATTTTTGGG - Intronic
1093298578 12:17423733-17423755 GTGTATTTGCATATATTGTTGGG + Intergenic
1094214471 12:27925757-27925779 CATTATTTACATATATAGTTTGG - Intergenic
1094394187 12:29987673-29987695 TATTATAAGTATGTATTGTTAGG - Intergenic
1094862077 12:34478747-34478769 TATTGTATGCATATATATTTAGG - Intergenic
1095269884 12:40205412-40205434 CAATTTTTGCAAATATTGTTAGG - Intronic
1096032312 12:48430531-48430553 CATTATTTTCATATGTTTTTTGG - Intergenic
1097305138 12:58060310-58060332 TATTAGATGCATATATATTTAGG - Intergenic
1097810344 12:64012391-64012413 CATTATTTGAATATATTATTGGG + Intronic
1098026256 12:66205612-66205634 CATTTTATGCATCTTTAGTTAGG - Intronic
1099504211 12:83452262-83452284 GATTATATTCATATATTACTTGG + Intergenic
1099564427 12:84223841-84223863 CAATATATGCATGAATTGGTGGG + Intergenic
1099752723 12:86798654-86798676 CATTTTTCACATATATTGTTTGG - Intronic
1100025811 12:90126558-90126580 CATTGAATGTATATATTGCTTGG - Intergenic
1100576916 12:95900430-95900452 CATTATGTCAACATATTGTTTGG - Intronic
1100872847 12:98930145-98930167 GGTTATTTGCATATATTTTTTGG - Intronic
1101360096 12:104018320-104018342 CTTCATATGCATCTATTTTTTGG + Intronic
1103005264 12:117415828-117415850 CATTAGATGCATCTATTTTGAGG + Intronic
1103064458 12:117885529-117885551 TATAATATGCATATATTTATAGG + Intronic
1104315390 12:127695118-127695140 CATTATATGCATATTTTATATGG - Intergenic
1106757173 13:32834280-32834302 CTTTATAGCAATATATTGTTGGG - Intergenic
1107189757 13:37566783-37566805 CATTAAATGCATAAAATTTTTGG - Intronic
1108483429 13:50899901-50899923 CATTATATAAAAATATTGTGTGG - Intergenic
1108774957 13:53754475-53754497 CATAATAAGCAGATATTCTTTGG + Intergenic
1108974081 13:56415042-56415064 GATTATAAGCATACATTGCTTGG + Intergenic
1109201146 13:59432862-59432884 CATTAGGTGCATATATATTTGGG + Intergenic
1109348973 13:61152375-61152397 CATGATATGCATCTATTATTTGG - Intergenic
1109474944 13:62867996-62868018 GAGTATCTTCATATATTGTTTGG - Intergenic
1109596888 13:64568210-64568232 TATTAGATGCATATATATTTAGG + Intergenic
1109888844 13:68580592-68580614 AGATATATGCATATATTGTTTGG - Intergenic
1109969620 13:69750562-69750584 TATTATATGCTTATATATTTTGG - Intronic
1111158284 13:84357597-84357619 CATTAATTGTGTATATTGTTTGG + Intergenic
1111213922 13:85118705-85118727 GAGTATATGAATATATTATTTGG - Intergenic
1111520380 13:89394456-89394478 TATTTTATGTATATATTCTTTGG + Intergenic
1111535633 13:89599130-89599152 CATAATATGTATATCTTTTTGGG - Intergenic
1111563263 13:89980776-89980798 CATTATATTAATGTATTTTTTGG + Intergenic
1111603592 13:90506364-90506386 TACTATATGCATATCTTCTTTGG - Intergenic
1111975689 13:94964949-94964971 GATTATATTCATTTATTGTGTGG + Intergenic
1112310656 13:98314862-98314884 TATTGTATGTATGTATTGTTGGG + Intronic
1112474609 13:99719502-99719524 CAATATATATATATATTTTTTGG + Intronic
1114900258 14:27048948-27048970 TATTATATGTATATATATTTAGG + Intergenic
1115135725 14:30105941-30105963 GATTATTTGCTTATAGTGTTGGG - Intronic
1115230354 14:31153727-31153749 CATTATATATATACATGGTTAGG - Intronic
1116708155 14:48330188-48330210 CAGTATGTGAATATATTCTTAGG - Intergenic
1117068723 14:52036375-52036397 CAGTATATGAATATATTTTTTGG + Intronic
1118750111 14:68800264-68800286 AATCATATGCTTATATTGCTAGG - Intergenic
1121945043 14:98111981-98112003 CATGATCTGCATTTATTTTTAGG - Intergenic
1123797117 15:23783214-23783236 GAGTATCTGCATATATTATTTGG + Intergenic
1124224033 15:27873864-27873886 CATTATATACCTACAGTGTTAGG - Intronic
1124380940 15:29164634-29164656 TGTTAGATGCATATATTTTTAGG - Intronic
1125450785 15:39804736-39804758 AATTAAATGAATATATTATTTGG + Intronic
1127450187 15:59109044-59109066 CAGTATATGTATATATTTTTGGG + Intronic
1127543933 15:59971951-59971973 CAGTATGTGCATATATGTTTGGG + Intergenic
1129504311 15:76068479-76068501 CAACATATACATATATTTTTTGG - Intronic
1129632980 15:77282039-77282061 AATTATATGGAAATATTGATTGG - Intronic
1130949972 15:88578503-88578525 GATTATATTCATATAAAGTTTGG + Intergenic
1131717299 15:95127060-95127082 TATTATATGTATTTATTGGTAGG + Intergenic
1132047759 15:98579116-98579138 CATCATTTGCATAGATTTTTTGG + Intergenic
1132441790 15:101873821-101873843 CATTTTATGTATTTATTGTCAGG + Intergenic
1132447947 15:101944119-101944141 CATCATCTTCATATATAGTTGGG + Intergenic
1137746625 16:50825413-50825435 CATTATATCCATCTATTAATGGG + Intergenic
1138324582 16:56153655-56153677 CCTTGCATGCATATATTGTATGG + Intergenic
1138871784 16:60897590-60897612 CATTATGCACATATTTTGTTAGG + Intergenic
1142431427 16:90030263-90030285 CATCATTTGCATATTTTTTTTGG + Intronic
1145092864 17:20000367-20000389 CACTAAATATATATATTGTTGGG + Intergenic
1147972571 17:44227476-44227498 TTTTATATGCATATATTTTAGGG - Intergenic
1148400745 17:47358088-47358110 CTTTATACACATATATTGCTTGG - Intronic
1148889400 17:50797032-50797054 TATTATATATATATAGTGTTTGG - Intergenic
1151003845 17:70411023-70411045 TAGTATATCTATATATTGTTAGG + Intergenic
1151166349 17:72206918-72206940 CATTTTAGGCATATACTTTTGGG - Intergenic
1153313174 18:3697871-3697893 TATTAGATGCATATATATTTAGG + Intronic
1153812181 18:8761904-8761926 CCTTATATGAAGATATGGTTTGG - Intronic
1154090743 18:11359861-11359883 GATTCTATACATATTTTGTTAGG - Intergenic
1155124868 18:22863414-22863436 CATCATATGCATATTTGGTGAGG + Intronic
1158020185 18:52832467-52832489 AATTATATGCATAAATTTTGGGG - Intronic
1158302945 18:56073141-56073163 AATTATATTCATGAATTGTTTGG + Intergenic
1159378972 18:67631761-67631783 CTTTATAGGCAGATAATGTTGGG + Intergenic
1159686462 18:71427454-71427476 CATTATAAACATAGAATGTTTGG - Intergenic
1160297683 18:77653269-77653291 CAATATGTGTATATCTTGTTGGG - Intergenic
1160637324 19:88414-88436 CATCATCTTCATATATAGTTGGG - Intergenic
1160643142 19:159326-159348 CATTTTATGTATTTATTGTCAGG - Intergenic
1161730558 19:5958003-5958025 TACTGTATGCATATAGTGTTGGG - Intronic
1162591692 19:11596510-11596532 CATTAAATGCAAATATTGGCCGG + Intronic
1164489881 19:28699265-28699287 CATTTTTTTCAAATATTGTTTGG - Intergenic
925255885 2:2487527-2487549 CATCATATGTACAGATTGTTGGG + Intergenic
927339898 2:21971513-21971535 AATAAGATGCATATTTTGTTCGG - Intergenic
927419442 2:22914915-22914937 TAGTATATGCATATATTTATGGG - Intergenic
927903028 2:26836038-26836060 CATCATCTGTATATCTTGTTTGG - Intergenic
932480306 2:72035213-72035235 CATTATATGCATGTATTCTATGG - Intergenic
932542715 2:72673039-72673061 TATTATATGCACATATTTTCAGG - Intronic
932967724 2:76497177-76497199 CATTATATGCAGATATTTCAGGG - Intergenic
934088172 2:88527491-88527513 CCTTATATGTATATATTCTTTGG + Intronic
934965854 2:98721570-98721592 AATTATAACAATATATTGTTTGG + Intronic
935795634 2:106638668-106638690 CATTATAATCATATACTTTTGGG + Intergenic
936407188 2:112215591-112215613 CATTATATTGTTTTATTGTTGGG - Exonic
936436506 2:112511483-112511505 TATTAGATGCATATATATTTAGG + Intronic
936815910 2:116460581-116460603 CATTATATCAGTAGATTGTTTGG - Intergenic
937713954 2:125010689-125010711 CATTATCTGCATTTATTCTAGGG - Intergenic
939472346 2:142639568-142639590 TCTTACATGCATATATTGTGTGG + Intergenic
939644388 2:144678783-144678805 CTCTATATGCAAATAGTGTTGGG - Intergenic
940807214 2:158201360-158201382 CATTATTTGGATATATTCTTAGG - Intronic
943165520 2:184319358-184319380 CATTATATGCTTATGTTGTAAGG - Intergenic
943446984 2:187998517-187998539 AATTAGATGCATATATATTTAGG - Intergenic
943804462 2:192105718-192105740 CATTTTCTGCATATATGTTTTGG - Intronic
943974545 2:194456512-194456534 CTTAATATGCATATTTTGTTAGG - Intergenic
944959618 2:204856307-204856329 CATTATTTTCATATATATTTTGG + Intronic
945142950 2:206706457-206706479 GAATGTATGTATATATTGTTTGG + Intronic
946600494 2:221355179-221355201 CATAATATCCACATGTTGTTGGG - Intergenic
948012334 2:234659418-234659440 TATTAGGTGCATATATTTTTAGG - Intergenic
1169152650 20:3302269-3302291 CATAATATGCACATATTTATGGG + Intronic
1169668011 20:8060695-8060717 CATTAAATGTATATATTATTTGG - Intergenic
1169670579 20:8095990-8096012 TAATATATTGATATATTGTTTGG - Intergenic
1169697764 20:8410094-8410116 CATTATATGCATATATTGTTGGG + Intronic
1170167153 20:13372979-13373001 CATTATAATGATGTATTGTTAGG - Intergenic
1170207736 20:13817452-13817474 CATTATTTGCAAATATTTTAGGG - Exonic
1170916367 20:20630269-20630291 AATTATATGTATATTTTGTTTGG - Intronic
1171315489 20:24188683-24188705 GAATATCTGCATATATTATTTGG + Intergenic
1172502258 20:35435833-35435855 CATTATATGTATAAATGATTGGG + Intronic
1172574695 20:35998998-35999020 TATTATATGCATAGATGTTTGGG + Intronic
1173242112 20:41306269-41306291 CTATATATGCAAATATAGTTGGG - Intronic
1173514238 20:43653649-43653671 AATTATATATATATATTTTTGGG + Intergenic
1173557525 20:43977098-43977120 AAATATATACATATATTGATTGG - Intronic
1175057862 20:56214430-56214452 AATTATATGTATATATTTTTTGG - Intergenic
1175629186 20:60518801-60518823 AATTATAGCCATGTATTGTTAGG - Intergenic
1176892027 21:14329624-14329646 TATTAGATGCATATATATTTAGG - Intergenic
1177244705 21:18508247-18508269 CATTAAATGAATAAATTTTTTGG + Intergenic
1177371629 21:20211422-20211444 CTTTATAAGCAGATATTGTAAGG - Intergenic
1177452258 21:21285521-21285543 CATTTTATAGATATAATGTTTGG + Intronic
1177719644 21:24888943-24888965 CATTAAATGTATAAATTCTTGGG - Intergenic
1179063090 21:37997843-37997865 CATCATATGCACATATTCTGGGG + Intronic
1182248741 22:28982720-28982742 CATTATGTGAAAATATTCTTAGG - Intronic
1184619408 22:45663668-45663690 AATAATATCCAAATATTGTTTGG + Intergenic
949637848 3:6003517-6003539 AAGTATATGCATAAATTATTTGG - Intergenic
949705568 3:6812993-6813015 TATTATATGCATATATTAAGAGG + Intronic
949722232 3:7003351-7003373 CATTAATTGCATATATTTATGGG - Intronic
950236907 3:11330281-11330303 CAGTATTTGCTTATATAGTTTGG + Intronic
951066082 3:18267186-18267208 CATGAAATGCAAATATTGTAGGG - Intronic
951070594 3:18324199-18324221 CATTAAATCTATATATTATTTGG + Intronic
951653487 3:24979424-24979446 TATTACATGCATATATATTTAGG + Intergenic
951654687 3:24992153-24992175 CATCATATATTTATATTGTTTGG + Intergenic
951828007 3:26889853-26889875 CATGATTTGCATACATTATTTGG + Intergenic
951869309 3:27342719-27342741 CACTAGATGCAGAAATTGTTAGG - Intronic
952063982 3:29544876-29544898 CTTTATTAGCATATATAGTTAGG - Intronic
952398705 3:32943831-32943853 TATTATATATATATATTCTTTGG + Intergenic
952855176 3:37764418-37764440 CATTATACGGATAAATTATTAGG - Intronic
953036763 3:39218677-39218699 CAAAATATGAATATATTCTTTGG - Intergenic
953897466 3:46813098-46813120 TTTTATATGCATATATTTTAGGG + Intergenic
954031105 3:47820469-47820491 TAATATATGTATATATGGTTGGG + Intronic
954765667 3:52913714-52913736 CATTATATTAATATAAAGTTTGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956907914 3:73786106-73786128 AATTAGATGCATATATTTGTTGG + Intergenic
957173060 3:76764951-76764973 TATTATGTGCATATATTGTGTGG + Intronic
957676303 3:83370696-83370718 AATTATATGTATATATTTTGGGG - Intergenic
958609675 3:96409278-96409300 TATTATCTGCATATCTTTTTTGG - Intergenic
959059956 3:101607278-101607300 AATTATAATAATATATTGTTGGG - Intergenic
959123444 3:102261412-102261434 TATTAGATGTATATATTTTTTGG + Intronic
959601003 3:108185715-108185737 TATTTTATGCAAATATAGTTGGG + Intronic
960732954 3:120746068-120746090 CAATCTATGCATATATTTTGGGG - Intronic
960749792 3:120935835-120935857 TATCCTATGCATATATTTTTTGG + Intronic
962112524 3:132468716-132468738 CACTATATACATATATGGTCAGG + Intronic
962718074 3:138145238-138145260 CACTATCTGCATATTTTCTTTGG - Intergenic
964194871 3:154051524-154051546 CATTATCTGCATATATGCTTTGG + Intergenic
964257161 3:154788738-154788760 CATGATAAGCAAATGTTGTTTGG - Intergenic
964301803 3:155296018-155296040 CTATATATGCATATATTATAAGG - Intergenic
964498436 3:157321016-157321038 CATTATATATATATATTTTTTGG + Intronic
965069379 3:163898630-163898652 AATTTTGTGCATATATGGTTGGG + Intergenic
965222370 3:165943003-165943025 AATTAAATGCATATATTTTATGG + Intergenic
965238835 3:166165713-166165735 AATTATAAAAATATATTGTTAGG - Intergenic
965288566 3:166847646-166847668 CATTAGGTGCATATATATTTAGG + Intergenic
965873315 3:173286431-173286453 ATTTATATGCATAAGTTGTTTGG - Intergenic
966522975 3:180893483-180893505 GGTTATCTGCATATATTATTTGG + Intronic
966537101 3:181047010-181047032 AACTATCTACATATATTGTTTGG + Intergenic
967445868 3:189565825-189565847 CTTGACATGCATATATTATTAGG - Intergenic
967524800 3:190479002-190479024 CATTTTTTTCATATATTGGTTGG - Intergenic
967549094 3:190768318-190768340 CATCATATGCATTTATTATACGG + Intergenic
970655157 4:18222996-18223018 TATTGGATGCATATATAGTTAGG + Intergenic
971744635 4:30563987-30564009 CATTAAATCCATAGATAGTTTGG - Intergenic
971783220 4:31066223-31066245 TAATATATGCATATATTATGAGG + Intronic
971839324 4:31813167-31813189 AAATATATGTATATATTGCTGGG + Intergenic
972008103 4:34137760-34137782 ATTTATATGCATATATATTTAGG + Intergenic
972748284 4:41962899-41962921 AATTATATGGATATATTGCTGGG + Intergenic
973063282 4:45756937-45756959 GAGTATATTCAAATATTGTTAGG - Intergenic
973344322 4:49037939-49037961 CACTATATGCAGATAGTCTTTGG + Intronic
974475916 4:62379741-62379763 CATTATATTTATACATTGATAGG - Intergenic
974876110 4:67704796-67704818 CATAATAAGCATATATTTATGGG + Intergenic
975183876 4:71378555-71378577 CATTAAATCCAGACATTGTTTGG - Intronic
976200436 4:82572501-82572523 CATTAAATGGATATGTTGTATGG - Intergenic
977510712 4:97958678-97958700 TATTAGATGCATATATATTTAGG - Intronic
977981299 4:103325808-103325830 CATTGAATGCATTCATTGTTTGG + Intergenic
978990618 4:115077641-115077663 CATTATATACATATAAAATTAGG + Intronic
979272624 4:118780770-118780792 CATTGGATGCATATATATTTAGG + Intronic
979328705 4:119405648-119405670 CATTATATAAATATTTTGGTAGG - Intergenic
979639507 4:122997178-122997200 CTTTAAATGAATAAATTGTTTGG - Intronic
979737884 4:124110864-124110886 CATTATTTGTATATATAGATTGG + Intergenic
980173288 4:129314778-129314800 TTTTAAATGTATATATTGTTGGG + Intergenic
981830218 4:148991019-148991041 AATTATATTCATAAAATGTTTGG + Intergenic
982419650 4:155179682-155179704 CACTTTCTGCATATATAGTTTGG + Intergenic
982476362 4:155856302-155856324 AATTATATGTATACATTGTGGGG - Intronic
982554826 4:156847103-156847125 GGGTATATGCATATATTATTTGG - Intronic
982794288 4:159627414-159627436 TATTATGTGCATATATATTTAGG + Intergenic
982871672 4:160587070-160587092 AAATATATACATATATTTTTTGG + Intergenic
983204004 4:164893923-164893945 CATTAAATGAATATTTTCTTGGG + Intronic
983342521 4:166482620-166482642 AATTATATACATATATTCTCAGG + Intergenic
983347342 4:166543900-166543922 CATTAAATCTATAAATTGTTTGG - Intergenic
983536836 4:168866793-168866815 CATTCCATGCATATAATGTTAGG - Intronic
983669394 4:170217843-170217865 CATTATTTGCATATGTTCTTTGG - Intergenic
983724163 4:170898740-170898762 CATTATATATATATATAGGTAGG + Intergenic
983770498 4:171542976-171542998 CATTATTTTCATACATTTTTAGG + Intergenic
984250113 4:177321652-177321674 CATTCTAACAATATATTGTTTGG + Intronic
984318874 4:178165233-178165255 ATTTATATGAATATAGTGTTTGG - Intergenic
984722561 4:182989357-182989379 CATTATGTGTATAGATTTTTTGG - Intergenic
985586146 5:736276-736298 CGTTAGGTGCATATATAGTTAGG - Intronic
985600565 5:827688-827710 CATTACGTGCATATATAGTTAGG - Intronic
986119018 5:4813094-4813116 TATTATTTGCATATCTTCTTTGG + Intergenic
986537314 5:8804237-8804259 CATTAAGTGCATATATGTTTAGG + Intergenic
987257050 5:16165910-16165932 GATTATATACATAAATTATTTGG + Intronic
987510752 5:18834910-18834932 CATTTTTTTCATATATTTTTTGG + Intergenic
987721962 5:21647551-21647573 CATTATTTGCAAATATTCATGGG + Intergenic
987860583 5:23482509-23482531 CATTACCTGCATATGTAGTTTGG + Intergenic
988151848 5:27393468-27393490 CATTACATGGATATCTTGATAGG - Intergenic
989307847 5:39977965-39977987 CATCATTACCATATATTGTTTGG + Intergenic
990764818 5:59170448-59170470 CATAATATTGAAATATTGTTAGG + Intronic
991261533 5:64673814-64673836 CATTAAATGGATAAATTGTATGG - Intergenic
991430993 5:66546255-66546277 TATTATATGCATATACCTTTAGG + Intergenic
993250128 5:85511294-85511316 CATTAGGTGCATATATGTTTAGG + Intergenic
993796197 5:92270417-92270439 TATTAGATGCATATATTTTTAGG - Intergenic
994238253 5:97390983-97391005 ATTTATATGCATATTTTCTTGGG + Intergenic
994872165 5:105365746-105365768 CATTGAATCTATATATTGTTTGG - Intergenic
995153922 5:108886850-108886872 CATTAAATGCAGACATTGGTAGG + Intronic
995266556 5:110168420-110168442 CAATGTGTGCATATATTTTTTGG + Intergenic
995353218 5:111206373-111206395 CATCATAGACAGATATTGTTAGG + Intergenic
995372351 5:111433168-111433190 TCTTATATTCATATATTCTTTGG + Intronic
995802677 5:116016118-116016140 CATCTTATGCATTTATTTTTAGG + Intronic
995944460 5:117626571-117626593 CATTATAAGCCTGTATTGTAAGG + Intergenic
996126305 5:119728794-119728816 TATTATATGCTGATATAGTTTGG + Intergenic
996459768 5:123727962-123727984 CAGTATATGTATATCTTGATAGG - Intergenic
997499381 5:134360134-134360156 CGTTATATGTACAAATTGTTAGG - Intronic
1002733731 5:181365146-181365168 CATTTTATGTATTTATTGTCAGG + Intergenic
1002750811 6:108974-108996 CATTTTATGTATTTATTGTCAGG - Intergenic
1002955147 6:1855140-1855162 CACCATATGCAGAGATTGTTTGG - Intronic
1003219313 6:4143651-4143673 TATTATATACATATATTCTTTGG - Intergenic
1004435931 6:15594091-15594113 TATTATAAGTAGATATTGTTAGG - Intronic
1005088351 6:22030161-22030183 TTTTATTTGCAAATATTGTTTGG - Intergenic
1005178956 6:23081514-23081536 TATAATATGCATATATTATAGGG - Intergenic
1006343996 6:33465251-33465273 TATTATATGCTTATATGGTTTGG + Intergenic
1006526959 6:34614586-34614608 GAGTATCTACATATATTGTTTGG - Intronic
1007256403 6:40532288-40532310 CATTATATTCCTATACTGTGTGG - Intronic
1007886315 6:45234180-45234202 CATTATATTCAATTATTGTCTGG + Intronic
1008242756 6:49131762-49131784 CATGAAATGCATATTTTGATGGG + Intergenic
1008968960 6:57344736-57344758 AACTATATGCATAAATGGTTAGG - Intronic
1009532497 6:64837951-64837973 TGTTATATGCATATATTGCAAGG - Intronic
1009536921 6:64898911-64898933 TATTGTATGCATATATATTTGGG - Intronic
1009557384 6:65190739-65190761 CATTATATTCAAATATGTTTTGG - Intronic
1009598629 6:65768908-65768930 TATTCTATGCATTTATTGTGTGG + Intergenic
1010308488 6:74353327-74353349 GATTTTATACATGTATTGTTAGG - Intergenic
1010416570 6:75618199-75618221 GAGTATATGCTTATATTATTTGG + Intronic
1010479462 6:76333118-76333140 CATTATTTTCATATATTTTTTGG + Intergenic
1010966780 6:82219324-82219346 CATTATAGGCATATATTGTAGGG - Intronic
1010997133 6:82546690-82546712 CATTGGATGCATATATATTTTGG + Intergenic
1011350562 6:86418715-86418737 CATAATCTGCATATCTTCTTTGG + Intergenic
1011707450 6:90015945-90015967 TATTAGATGCATATATATTTAGG + Intronic
1011764383 6:90604443-90604465 ATTTATATGCATATATATTTTGG + Intergenic
1011982263 6:93395061-93395083 CATATTATGCATTTCTTGTTTGG - Intronic
1012060574 6:94474200-94474222 CATTATATATATATATTTATTGG + Intergenic
1013670293 6:112394588-112394610 CATTGTATGGATATTTTGTTTGG + Intergenic
1013822308 6:114169265-114169287 TATTATATGCAAATATATTTAGG + Intronic
1013882320 6:114919554-114919576 AAGTATATGCATAAATTATTTGG + Intergenic
1014063016 6:117094914-117094936 CATTATATATTTCTATTGTTTGG + Intergenic
1014490714 6:122058429-122058451 CTTTGTATGCATATGGTGTTAGG + Intergenic
1018123916 6:160663601-160663623 CATTATATGCGTATATCATCTGG + Intronic
1018144464 6:160870647-160870669 CATTAAGTGCATATATATTTAGG + Intergenic
1018153004 6:160957523-160957545 CATGTTATGCATATATATTTTGG + Intergenic
1018781574 6:167072189-167072211 TATTATGTGCATATATATTTAGG + Intergenic
1019237980 6:170637466-170637488 CATTTTATGTATTTATTGTCAGG + Intergenic
1020986375 7:15139898-15139920 CATTGTATTTATATATAGTTGGG - Intergenic
1021201585 7:17733683-17733705 ACTTACATGCATATATTCTTCGG + Intergenic
1021263259 7:18485317-18485339 CATTATTTCCATATCTTATTTGG + Intronic
1023070450 7:36426665-36426687 CTTTTTATGCATACATTTTTAGG + Intronic
1023401396 7:39794594-39794616 CATTATATAAATATTTTGGTAGG + Intergenic
1024191265 7:47013284-47013306 CATTATATACATATCTTATAAGG + Intergenic
1024206957 7:47171626-47171648 TTTTATATGCATATTTTCTTTGG - Intergenic
1024648218 7:51386085-51386107 CATTATATAAATATTTTGGTAGG - Intergenic
1024836887 7:53531456-53531478 CATGAAATGGATATATTGCTTGG - Intergenic
1025177416 7:56809125-56809147 CATTATATAAATATTTTGGTAGG - Intergenic
1025694376 7:63767263-63767285 CATTATATAAATATTTTGGTAGG + Intergenic
1027055642 7:75047644-75047666 AATTATATATATATATTTTTTGG + Intronic
1027699207 7:81448890-81448912 CCTTATGTACATATATTATTGGG - Intergenic
1027949084 7:84789877-84789899 CATTTTATGCCTCTATTCTTTGG + Intergenic
1029055559 7:97737537-97737559 AATTATATGAATATATTCTCTGG - Intronic
1029067863 7:97870519-97870541 CATTCTAACCATATATTATTTGG - Intronic
1029303808 7:99604188-99604210 CATTTTATGCATTTTTTTTTTGG + Intronic
1029935960 7:104424533-104424555 CAGTATATGGATTTATTGTTTGG - Intronic
1030484160 7:110145095-110145117 CATTATATAAATGTATTCTTAGG + Intergenic
1031296299 7:120009163-120009185 TTTTATATACATATATTGTCAGG + Intergenic
1031473614 7:122196483-122196505 AAATATATGCACATATTGTTGGG - Intergenic
1031844572 7:126789684-126789706 GATAATATCCATATATTTTTTGG - Intronic
1035148539 7:156845169-156845191 TATTAGATGTATATATTCTTGGG - Intronic
1035217118 7:157376260-157376282 CATTGTATATATATATTTTTTGG + Intronic
1035509790 8:169143-169165 CATTTTATGTATTTATTGTCAGG - Intergenic
1035562884 8:619677-619699 AATTATAACAATATATTGTTGGG + Intronic
1035894862 8:3388138-3388160 CATTATATGTGTATATGTTTGGG - Intronic
1037088852 8:14887440-14887462 AACTAGATGCATATATTTTTAGG + Intronic
1039157085 8:34572797-34572819 TATTATGGCCATATATTGTTTGG + Intergenic
1039170604 8:34740492-34740514 TATTAGGTGCATATATTTTTAGG - Intergenic
1039502557 8:38029655-38029677 CATTATGGGCACATATTGTGGGG - Intergenic
1040355634 8:46615732-46615754 CATTATAATCATATATTATTTGG - Intergenic
1040411680 8:47160557-47160579 CATTAGGTGCATATATATTTAGG - Intergenic
1040741919 8:50586271-50586293 CATTAACTGCATATATTTGTTGG - Intronic
1041326106 8:56666339-56666361 AATTATATGTATATACTGATTGG + Intergenic
1041371146 8:57162318-57162340 TATTAGATGCATATATATTTAGG + Intergenic
1041997356 8:64079514-64079536 TTTTAAGTGCATATATTGTTTGG - Intergenic
1042555197 8:70028429-70028451 AATGATATGAATATATTGTGAGG - Intergenic
1042759373 8:72254169-72254191 AAATATATGCATATATTGTTTGG + Intergenic
1043299774 8:78713391-78713413 CATTATGTGTATATATTCATGGG + Intronic
1043521663 8:81053142-81053164 TATTATCTGAATATATTATTTGG + Intronic
1043888179 8:85626590-85626612 CTTTGTATGAGTATATTGTTGGG + Intergenic
1044424504 8:92035441-92035463 TCTTACATGCATATATTGTGTGG - Intronic
1045170171 8:99657001-99657023 CGTTATATTAATATTTTGTTGGG + Intronic
1046020830 8:108662735-108662757 CTTTTTATGCATAAATTGTGGGG - Intronic
1046274131 8:111934767-111934789 CATTATATGCAGATCATGGTTGG - Intergenic
1046811010 8:118533627-118533649 TATTAGATGCATATATAATTAGG + Intronic
1048720356 8:137317069-137317091 CATTAAATGTGTATATTCTTTGG + Intergenic
1048913806 8:139163100-139163122 TATTAGATGCATATATATTTAGG + Intergenic
1048940198 8:139393857-139393879 TGTTATATGGATATATTGTGTGG - Intergenic
1049918911 9:345365-345387 CAGTGTAAGCATTTATTGTTTGG - Intronic
1049933955 9:482743-482765 CATCAAATGCGTGTATTGTTTGG - Intronic
1050229834 9:3510775-3510797 CGTTTTATTCACATATTGTTTGG + Intronic
1050829714 9:9995799-9995821 GATTATATTCTTATATTTTTAGG + Intronic
1051064890 9:13091555-13091577 CAGTATATGCCAATCTTGTTTGG + Intergenic
1051117597 9:13714774-13714796 AATTATATACATAAATTATTTGG - Intergenic
1051744172 9:20279213-20279235 CAATATATGCTTATATGATTTGG - Intergenic
1051757282 9:20416576-20416598 AATTACATGCATATAATGCTAGG + Intronic
1051909202 9:22133613-22133635 AATTATCTGCATAAATTCTTTGG + Intergenic
1052140520 9:24976457-24976479 CATTATTTCCATATATCCTTGGG + Intergenic
1052226448 9:26094508-26094530 CATTATATTCATATTTAATTTGG + Intergenic
1052318523 9:27142373-27142395 CATAACATGCATTTATTATTGGG + Intronic
1052578721 9:30325415-30325437 CTTTAAATGCAAATATTATTTGG - Intergenic
1053340038 9:37318167-37318189 CATTATATGACTATATTGTAAGG - Intronic
1055340526 9:75277099-75277121 TATCATATGCATATCTTCTTTGG + Intergenic
1055715188 9:79109776-79109798 CAGTATATGCATATAATGAAAGG + Intergenic
1056468102 9:86878603-86878625 CATGATATTCAGATTTTGTTGGG + Intergenic
1058433666 9:104941983-104942005 AATTATATGCATATGGTGATTGG - Intergenic
1062758186 9:138317762-138317784 CATTTTATGTATTTATTGTCAGG + Intergenic
1186638532 X:11430787-11430809 CATTACATGGATAGATTGTGTGG + Intronic
1186947849 X:14589356-14589378 CAAAATATGCATATATTTTGAGG - Intronic
1188877710 X:35451578-35451600 CATTTTTTTCATATATTTTTTGG + Intergenic
1188935055 X:36165565-36165587 AATTATAGCAATATATTGTTGGG - Intergenic
1189412832 X:40789296-40789318 CATTAAATGAATATATTATTTGG + Intergenic
1190414776 X:50170165-50170187 GATTATCTACATATATTATTTGG - Intergenic
1191640442 X:63425920-63425942 CATTATTTTCATAGATTTTTAGG + Intergenic
1191741046 X:64435142-64435164 TTTTATATGCATATATTTTAGGG + Intergenic
1191954369 X:66627587-66627609 TATTATTTGCATATATGTTTAGG - Intronic
1192045319 X:67665833-67665855 CATTTTATGCATATATTCCATGG - Intronic
1192591619 X:72364769-72364791 TCTTATATGCATATATTGCATGG - Intronic
1192907270 X:75564961-75564983 TATTATGTTCATATATTTTTAGG + Intergenic
1193185737 X:78509946-78509968 TATTAAATGCATATATAGTTAGG - Intergenic
1193278076 X:79614630-79614652 CATTAGATGGATATATTATGGGG - Intergenic
1193854236 X:86579032-86579054 TTTTATCTGCATATATTATTTGG + Intronic
1194164607 X:90499543-90499565 CTTTATATGTATATTTTGTGTGG - Intergenic
1194872928 X:99155156-99155178 CATTAGGTGCATATATGTTTAGG - Intergenic
1194967551 X:100305872-100305894 CATTAAGTGCATATATATTTAGG - Intronic
1195248533 X:103019936-103019958 TATTAGATGCATATATATTTAGG + Intergenic
1195455071 X:105058995-105059017 CAGTAGATGTATATATTTTTGGG + Intronic
1195768758 X:108325688-108325710 CATCATTTCTATATATTGTTAGG - Intronic
1195770760 X:108348684-108348706 CAATATATTCATATATCCTTTGG + Intronic
1196285681 X:113876938-113876960 AAGTATCTGCATATATTATTTGG + Intergenic
1196551148 X:117027242-117027264 TATTAGATGCATATATATTTAGG + Intergenic
1197193877 X:123678900-123678922 CAATATATGTAGATATAGTTGGG - Intronic
1197212537 X:123840076-123840098 AATTTTATACATATTTTGTTAGG + Intergenic
1199279381 X:145982008-145982030 CATTATAGCAATACATTGTTGGG + Intergenic
1199627697 X:149756293-149756315 GAGTATCTGCATAAATTGTTTGG - Intergenic
1199998480 X:153043077-153043099 AAATATATGCATATATAATTTGG + Intergenic
1200510866 Y:4077338-4077360 CTTTATATGTATATTTTGTGTGG - Intergenic
1200823822 Y:7618727-7618749 CATTTTATTCATCTGTTGTTTGG - Intergenic
1200955569 Y:8940650-8940672 AATCATATGTATATATTGTTTGG + Intergenic
1201538665 Y:15081986-15082008 GAATATATGGATATATTGGTAGG - Intergenic
1202236234 Y:22712361-22712383 CATTTTATTCATCTGTTGTTTGG + Intergenic
1202306931 Y:23483807-23483829 CATTTTATTCATCTGTTGTTTGG - Intergenic
1202381178 Y:24277338-24277360 CATTATATAAATATTTTGGTAGG + Intergenic
1202489607 Y:25392788-25392810 CATTATATAAATATTTTGGTAGG - Intergenic
1202563876 Y:26186779-26186801 CATTTTATTCATCTGTTGTTTGG + Intergenic