ID: 1169698231

View in Genome Browser
Species Human (GRCh38)
Location 20:8415841-8415863
Sequence CCAGATTCATGGTGTTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 371}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169698231_1169698235 9 Left 1169698231 20:8415841-8415863 CCAGGGCAACACCATGAATCTGG 0: 1
1: 0
2: 1
3: 21
4: 371
Right 1169698235 20:8415873-8415895 GCTAGTGGTCAGTTTGCCTTAGG 0: 1
1: 0
2: 0
3: 11
4: 72
1169698231_1169698238 26 Left 1169698231 20:8415841-8415863 CCAGGGCAACACCATGAATCTGG 0: 1
1: 0
2: 1
3: 21
4: 371
Right 1169698238 20:8415890-8415912 CTTAGGTAGGTTGTTGCTCTTGG 0: 1
1: 0
2: 0
3: 9
4: 92
1169698231_1169698236 13 Left 1169698231 20:8415841-8415863 CCAGGGCAACACCATGAATCTGG 0: 1
1: 0
2: 1
3: 21
4: 371
Right 1169698236 20:8415877-8415899 GTGGTCAGTTTGCCTTAGGTAGG 0: 1
1: 0
2: 1
3: 31
4: 263
1169698231_1169698234 -6 Left 1169698231 20:8415841-8415863 CCAGGGCAACACCATGAATCTGG 0: 1
1: 0
2: 1
3: 21
4: 371
Right 1169698234 20:8415858-8415880 ATCTGGTAAAAGTCTGCTAGTGG 0: 1
1: 1
2: 0
3: 10
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169698231 Original CRISPR CCAGATTCATGGTGTTGCCC TGG (reversed) Intronic
900396928 1:2456905-2456927 CCAGAGTCATGGTGTGAACCTGG - Intronic
901551767 1:10000506-10000528 CAAGTCTCATGCTGTTGCCCAGG - Intronic
901577604 1:10212817-10212839 CCAGGGTCTTGCTGTTGCCCAGG - Intronic
902327451 1:15710981-15711003 CCAGTTTCACCGTGTTGGCCAGG - Intronic
902600381 1:17536893-17536915 ACAGAGTCATGCTGTTGCCTAGG + Intergenic
903167315 1:21529964-21529986 GGAGTTTCATTGTGTTGCCCAGG + Intronic
904824320 1:33264754-33264776 CCAGATGCATGGTCTTGGGCAGG + Intronic
905434215 1:37945939-37945961 CCAGATTCACTGTGTGGCCTTGG + Intronic
908205461 1:61843544-61843566 ACAGTTTCACTGTGTTGCCCAGG - Intronic
909273195 1:73650997-73651019 ACAGACTCTTGCTGTTGCCCAGG + Intergenic
909339427 1:74515107-74515129 CCAGAGTCAAGGTGTTGGCAAGG - Intronic
909415295 1:75399508-75399530 CCAGATGCAAGGTCTGGCCCTGG + Intronic
911739320 1:101369810-101369832 CCAGATAGATGCTGTGGCCCGGG + Intergenic
912048461 1:105491027-105491049 AGAGTTTCATCGTGTTGCCCAGG - Intergenic
912249409 1:107995291-107995313 CCAGTCTCATTCTGTTGCCCAGG - Intergenic
916120697 1:161525651-161525673 CCAGATTCATGACGTCGTCCTGG + Exonic
916159716 1:161897240-161897262 GGAGTTTCATCGTGTTGCCCAGG - Intronic
917802768 1:178585307-178585329 CAAGATTCATGGAGTTGACCAGG - Intergenic
918882530 1:190143779-190143801 CCAAATTCAAGGTGGTGGCCAGG + Intronic
919814671 1:201429902-201429924 CCTGAGCCAGGGTGTTGCCCAGG - Intergenic
921007068 1:211104507-211104529 CCAGATTCAGTGTGGGGCCCAGG - Intronic
921137191 1:212272311-212272333 GCAGATACAAGGGGTTGCCCTGG + Intergenic
923284804 1:232483353-232483375 CCAGATTCATGATGTTAACCAGG - Intronic
924120268 1:240790342-240790364 CCAGATCTATTTTGTTGCCCAGG + Intronic
1064119993 10:12610233-12610255 CCGGAGTCATGGTGATGGCCAGG + Intronic
1064340701 10:14482950-14482972 ACAGAGTCTTGCTGTTGCCCAGG + Intergenic
1065620771 10:27578622-27578644 CTACATTCAAGGTGTTGGCCAGG - Intergenic
1065732990 10:28726174-28726196 TCATATTCATGGGGCTGCCCTGG - Intergenic
1065776972 10:29130063-29130085 TTAGTTTCATCGTGTTGCCCAGG + Intergenic
1066402071 10:35086303-35086325 AGAGTTTCATTGTGTTGCCCAGG - Intronic
1067665709 10:48276490-48276512 GCAGATTCAGGGTGGTGCCTGGG - Intergenic
1070592200 10:77809213-77809235 CCAGTTTCACCATGTTGCCCAGG - Intronic
1071770842 10:88727660-88727682 CCAGACCCATGCTGGTGCCCAGG - Intronic
1073138927 10:101235183-101235205 GGAGTTTCATGATGTTGCCCAGG + Intergenic
1074337428 10:112592194-112592216 CCAAGATCAAGGTGTTGCCCAGG - Intronic
1074406271 10:113182778-113182800 ACAGTTTCATTCTGTTGCCCAGG + Intergenic
1074914844 10:117945743-117945765 GGAGGTTCATGATGTTGCCCAGG + Intergenic
1075632835 10:124011510-124011532 CCTGACTAATGGTCTTGCCCGGG - Intronic
1076137940 10:128057709-128057731 CCATCTTCCTGGTGTTGCCTTGG - Intronic
1076469041 10:130705847-130705869 CCAGATTTCAGGTGTTGCCTTGG + Intergenic
1077029410 11:457461-457483 CGATGTTCATGATGTTGCCCCGG + Intronic
1077084295 11:740715-740737 ACAGTTTCATTCTGTTGCCCAGG - Intergenic
1077816579 11:5691468-5691490 CCAGGTCCAGGGTGTGGCCCCGG + Intronic
1078282804 11:9919673-9919695 CCAGGTCCAGGGTGTGGCCCCGG + Intronic
1078540923 11:12212276-12212298 ACAGTTTCATCATGTTGCCCAGG - Intronic
1078769864 11:14339248-14339270 ACAGTCTCATTGTGTTGCCCAGG - Intronic
1079949746 11:26786031-26786053 ACAGTCTCATGCTGTTGCCCAGG + Intergenic
1080764895 11:35286782-35286804 CCAAATGAATGGTGTTGTCCTGG - Exonic
1081692708 11:45089003-45089025 CCAGTTTCACCATGTTGCCCAGG + Intergenic
1082694787 11:56348707-56348729 CAAGTTTCACCGTGTTGCCCAGG + Intergenic
1083913809 11:65727088-65727110 CCAGACTCATGCTGGTGCCTAGG - Intergenic
1084110941 11:67013865-67013887 CCAGAATCAAGGTGTTGGCAGGG + Intronic
1085171593 11:74454236-74454258 CGAGATCCCTGGAGTTGCCCTGG + Intergenic
1085379633 11:76102893-76102915 CCAGAATCAACGTGTTGGCCAGG + Intronic
1085520218 11:77133338-77133360 CCAGCTTCATGGTGGTGCCAGGG + Intronic
1088245447 11:107813854-107813876 GGAGTTTCATCGTGTTGCCCAGG + Intronic
1089054577 11:115575216-115575238 CAAGATCCAGGGTGTTGCCATGG + Intergenic
1089517660 11:119044047-119044069 ACAGAGTCTTGCTGTTGCCCAGG + Intergenic
1089546393 11:119229751-119229773 CCAGAATCTTGCTGTGGCCCAGG + Intronic
1089890345 11:121874525-121874547 ACAGATTCATGCTGTGGCCTAGG + Intergenic
1089951532 11:122532302-122532324 ACAGAATCTTGCTGTTGCCCAGG - Intergenic
1090012691 11:123059584-123059606 ACAGATTCATGATATTGTCCTGG - Exonic
1090299647 11:125624717-125624739 ACGGAATCATGCTGTTGCCCAGG + Intronic
1090953276 11:131493024-131493046 CGAGGTTCACCGTGTTGCCCAGG - Intronic
1091895358 12:4098567-4098589 ACAGATTCATGATATTGTCCTGG + Intergenic
1092005137 12:5063018-5063040 ACAGTTTCATTATGTTGCCCAGG + Intergenic
1092151565 12:6252465-6252487 ACAGTTTCACCGTGTTGCCCAGG + Intergenic
1092726704 12:11493593-11493615 TCTGCTTCATGGTGTAGCCCAGG - Intronic
1092883251 12:12904177-12904199 CCACATTCACGGTGTAGCCTGGG + Intronic
1094369898 12:29726776-29726798 CTAGATTGATGGTATTGCCTTGG - Intronic
1094588810 12:31801782-31801804 GGAGTTTCATGCTGTTGCCCAGG - Intergenic
1096303428 12:50452237-50452259 CCAGAGTCTTGCTCTTGCCCAGG + Intronic
1097012678 12:55964649-55964671 ACAGAGTCTTGCTGTTGCCCAGG + Intronic
1097120468 12:56727461-56727483 CCTGTTTCACCGTGTTGCCCAGG + Intronic
1103104278 12:118209426-118209448 ACAGAGTCTTGCTGTTGCCCAGG + Intronic
1106388832 13:29315936-29315958 CAAGGTCCATGGTGATGCCCAGG + Intronic
1106703966 13:32260795-32260817 ACAGAGTCTTGCTGTTGCCCAGG - Intronic
1107738030 13:43418500-43418522 ACAGAGTCTTGCTGTTGCCCAGG - Intronic
1108709232 13:53016664-53016686 CCAAAATCAAGGTGTTGCCACGG - Intergenic
1108809138 13:54199612-54199634 CCACATTAATTGTCTTGCCCAGG - Intergenic
1110572812 13:77025529-77025551 CAGGTTTCATCGTGTTGCCCAGG - Intronic
1110998407 13:82143169-82143191 CCAAAATCAAGGTGTTGGCCAGG - Intergenic
1112620778 13:101051920-101051942 CCAGAATCAAGGTGTTGACAGGG + Intergenic
1112892934 13:104260700-104260722 ACAGAGTCTTGCTGTTGCCCAGG - Intergenic
1113829233 13:113281847-113281869 CAAGATCCACTGTGTTGCCCAGG - Intergenic
1114518632 14:23319170-23319192 ACAGAGTCTTGCTGTTGCCCAGG + Intronic
1115589748 14:34852425-34852447 ACAGTTTCATTATGTTGCCCAGG - Intronic
1116055400 14:39857907-39857929 CCAGATTCTAGGTGTTTGCCAGG + Intergenic
1116643572 14:47497280-47497302 ACAGATTCACTGTCTTGCCCAGG + Intronic
1116813687 14:49564133-49564155 CGAGGTTCACGGTGTTGGCCAGG - Intergenic
1116814623 14:49572139-49572161 CGAGGTTCACGGTGTTGGCCAGG + Exonic
1117586244 14:57209332-57209354 AGAGTTTCATGATGTTGCCCAGG - Intronic
1119301669 14:73576141-73576163 GCAGAGTCTTGCTGTTGCCCAGG - Intergenic
1119322892 14:73742072-73742094 GCAGCTTCATGGGGGTGCCCAGG - Intronic
1119913481 14:78373018-78373040 CCAGAGCCATGGTGATGCCATGG - Intronic
1121727596 14:96164641-96164663 CCAAAATCAAGGTGTTGACCAGG - Intergenic
1122803459 14:104244770-104244792 CCAGAAGCATGCTGTGGCCCTGG + Intergenic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1123007507 14:105330979-105331001 ACAGAGTCATCCTGTTGCCCAGG + Intronic
1123664652 15:22598814-22598836 CAAGTTTCATCATGTTGCCCAGG - Intergenic
1123683597 15:22781849-22781871 ACAGTTTCATTCTGTTGCCCAGG - Intronic
1123830300 15:24129097-24129119 ACAGAGTCTCGGTGTTGCCCAGG - Intergenic
1123844975 15:24291023-24291045 ACAGAGTCACTGTGTTGCCCAGG + Intergenic
1124318488 15:28693262-28693284 CAAGTTTCATCATGTTGCCCAGG - Intergenic
1124564954 15:30804180-30804202 CAAGTTTCATCATGTTGCCCAGG + Intergenic
1125670557 15:41469411-41469433 GCAGATTCACCATGTTGCCCAGG + Intronic
1125920004 15:43519743-43519765 AGAGATTCAGGGTGTTCCCCAGG - Intronic
1126307412 15:47276048-47276070 AGAGATTCATGGTCTTGCTCTGG - Intronic
1126816711 15:52460975-52460997 ACAGAGTCTTGCTGTTGCCCAGG + Intronic
1127496665 15:59519378-59519400 GGAGTTTCATGGTGTTGGCCAGG + Intronic
1127624878 15:60770635-60770657 CCAGTCTCATTTTGTTGCCCAGG + Intronic
1129497427 15:75998463-75998485 CCAGACTTAAGGTGTTGGCCTGG - Intronic
1129694045 15:77730621-77730643 CCAGGTTGATGCTGTGGCCCAGG - Intronic
1131173517 15:90195281-90195303 CCAGTTTCACCCTGTTGCCCAGG + Intronic
1131727648 15:95244346-95244368 ACAGTTTCACTGTGTTGCCCAGG + Intergenic
1133822457 16:9248765-9248787 GCAGTTTCATGGTGTTGGCCAGG + Intergenic
1134100542 16:11448699-11448721 ACAGTTTCATTCTGTTGCCCAGG - Intronic
1134160626 16:11885700-11885722 ACAGATTCACCATGTTGCCCAGG - Intronic
1134561530 16:15214335-15214357 ACAGTTTCATGATGTTGCTCAGG - Intergenic
1134922067 16:18125961-18125983 ACAGTTTCATGATGTTGCTCAGG - Intergenic
1136275498 16:29177204-29177226 CCATCTTCATGGTGTTGAACAGG - Intergenic
1137443250 16:48513601-48513623 ACAGATTCACTCTGTTGCCCAGG - Intergenic
1138452143 16:57099621-57099643 ACAGTTTCATTCTGTTGCCCTGG + Intronic
1138695324 16:58807679-58807701 CAAGATTGATGGTCTAGCCCAGG + Intergenic
1140560684 16:75977243-75977265 GCAGATCCATGTTGTTGACCTGG + Intergenic
1141344503 16:83232498-83232520 ACAGAGTCCTGCTGTTGCCCAGG - Intronic
1141361389 16:83398252-83398274 CCAAAATCAAGGTGTTGCCAAGG + Intronic
1141904717 16:87016798-87016820 CCTGATTTATGGTGGTGCTCAGG - Intergenic
1141942282 16:87285084-87285106 CGAGTTTCACCGTGTTGCCCAGG - Intronic
1142079857 16:88143269-88143291 CCATCTTCATGGTGTTGAACAGG - Intergenic
1142797711 17:2321801-2321823 ACAGATTCTCGCTGTTGCCCAGG + Intronic
1143698057 17:8635104-8635126 CCAGAATCTTGCTGTTACCCAGG - Intergenic
1144075385 17:11714927-11714949 CCAGAGTCAAGGTGTTGGCTGGG - Intronic
1144799796 17:17917927-17917949 GCAGCCTCATTGTGTTGCCCAGG - Intronic
1145221781 17:21095528-21095550 CGAGTCTCATGGTGTTGCCCAGG + Intergenic
1146001951 17:29136034-29136056 AAGGATTCATCGTGTTGCCCAGG - Intronic
1146394246 17:32450278-32450300 CGAGTTTCATTCTGTTGCCCAGG + Intronic
1147005599 17:37401216-37401238 ACAGAGTCTTGCTGTTGCCCAGG + Intronic
1147736284 17:42640657-42640679 GCGGTTTCATTGTGTTGCCCAGG + Intergenic
1147789601 17:43005456-43005478 CAAGATTCACTGTGTTGCCCAGG + Intergenic
1148167679 17:45494669-45494691 CCATACTCATTGGGTTGCCCTGG - Intergenic
1148272876 17:46277670-46277692 ACAGAGTCTTGCTGTTGCCCAGG + Intronic
1148901465 17:50881528-50881550 ACGGCTTCATTGTGTTGCCCAGG - Intergenic
1150398859 17:64841084-64841106 CCATACTCATTGGGTTGCCCTGG - Intergenic
1150613625 17:66752570-66752592 ACAGAGTCTTGCTGTTGCCCAGG - Intronic
1150677189 17:67254680-67254702 ACAGTTTCACTGTGTTGCCCAGG + Intergenic
1150918461 17:69459684-69459706 ACAGAGTCTTGCTGTTGCCCGGG - Intronic
1151905551 17:77046209-77046231 CCACATTCATTATCTTGCCCAGG + Intergenic
1152049812 17:77964424-77964446 CCAGATGCAAGTTGGTGCCCAGG + Intergenic
1152066817 17:78116687-78116709 GCAGTTTCACTGTGTTGCCCAGG - Intronic
1152859360 17:82686671-82686693 CCAGAATGAAGGTGTTGCCTGGG - Intronic
1153933325 18:9898109-9898131 CAAGTCTCATTGTGTTGCCCAGG - Intergenic
1154491357 18:14924780-14924802 GAAGATTCCTGGTGTTCCCCAGG + Intergenic
1155043175 18:22082178-22082200 CGAGTTTCACCGTGTTGCCCAGG + Intergenic
1155409147 18:25523065-25523087 CCAGAATCAAGGTGTTGACCAGG - Intergenic
1157143724 18:45138906-45138928 CCTTAGTCATTGTGTTGCCCAGG + Intergenic
1157152630 18:45233502-45233524 CCTATTTCATGGTCTTGCCCGGG + Intronic
1158679501 18:59554301-59554323 CCAGATTCAAGCTTTTGACCTGG - Intronic
1161735420 19:5989427-5989449 ACAGAGTCTTGCTGTTGCCCAGG - Intergenic
1161762788 19:6186886-6186908 CCAATTTCACTGTGTTGCCCAGG + Intronic
1162743360 19:12785947-12785969 CCAGGGTCTTGGTGATGCCCAGG + Intronic
1163738513 19:18996368-18996390 ACAGTCTCATTGTGTTGCCCAGG - Intronic
1164045080 19:21530912-21530934 GCAGTTTCATGATGTTGGCCAGG - Intronic
1165063560 19:33216503-33216525 CCAGACTCATGGAGTGGCTCAGG + Intronic
1165135666 19:33666891-33666913 CCAGTTTCATTATGTTGCCCAGG + Intronic
1165944500 19:39433653-39433675 CCAGATTTATGGTGAGTCCCAGG - Exonic
1166058192 19:40306812-40306834 ACAGAGTCTTGCTGTTGCCCAGG + Intergenic
1166134481 19:40767306-40767328 ACAGATTCTTGCTGTTGCCCAGG - Intergenic
1166553099 19:43679866-43679888 GGGGTTTCATGGTGTTGCCCAGG - Intergenic
1167070653 19:47220503-47220525 GGAGTTTCATCGTGTTGCCCAGG + Intergenic
925462047 2:4072112-4072134 ACAGAATCTTGCTGTTGCCCAGG + Intergenic
926252077 2:11160462-11160484 CCAGATTCCTGGTGTTTCTGCGG + Exonic
926859403 2:17292301-17292323 CCTGCTTCATGGAGTGGCCCAGG + Intergenic
929008462 2:37418060-37418082 CCTGAGTCAAGGTGTTGCCAAGG + Intergenic
929122981 2:38498770-38498792 CGAGTTTCATTCTGTTGCCCGGG + Intergenic
929150047 2:38739265-38739287 ACAGTTTCACTGTGTTGCCCAGG - Intronic
930064328 2:47316180-47316202 CCAGAATCAAGGTGTTGGCTGGG + Intergenic
930181865 2:48368140-48368162 CCAAATTCATGGTGTTGACACGG + Intronic
930966844 2:57339181-57339203 ACAGTCTCATTGTGTTGCCCGGG + Intergenic
931725994 2:65111168-65111190 GCAGTTTCACCGTGTTGCCCAGG - Intronic
932102865 2:68916500-68916522 CCAAATTCATGATTTTGTCCAGG - Intergenic
933492219 2:83000439-83000461 CCATATTCGAGGTGTTGGCCAGG + Intergenic
934067658 2:88354402-88354424 CCAGAATCAAGGTGTTGGCAGGG - Intergenic
934782861 2:96983614-96983636 ACAGTTTCATTGTGTTGCCCAGG + Intronic
935074159 2:99724296-99724318 ACAGTCTCATGCTGTTGCCCAGG + Intronic
935294172 2:101634250-101634272 CCTGATTCACCATGTTGCCCAGG - Intergenic
937036853 2:118789216-118789238 ACAGTCTCATGCTGTTGCCCAGG - Intergenic
937345583 2:121123449-121123471 CCAGATGCAGGCTGTGGCCCTGG - Intergenic
938923337 2:136015380-136015402 ACAGAGTCATTGTGTTGGCCAGG - Intergenic
940237041 2:151522905-151522927 ACAGCTTCATGGTGTGGCCCTGG - Intronic
940464147 2:154007334-154007356 CCAAAATCAAGGTGTTGGCCAGG - Intronic
940789086 2:158013027-158013049 ATAGATTCTTGCTGTTGCCCAGG + Intronic
940933307 2:159462475-159462497 CCACATTCAAGGTCTTGCGCCGG - Intronic
945627619 2:212230257-212230279 ACAGAGTCTTGCTGTTGCCCAGG - Intronic
945805261 2:214482735-214482757 GCAGTTTCACTGTGTTGCCCAGG - Intronic
947032931 2:225818726-225818748 TCAGATTGAAGGTGTTGCTCAGG - Intergenic
947571296 2:231236908-231236930 ACAGTTTCACGCTGTTGCCCAGG - Intronic
948064640 2:235067966-235067988 CTGTAGTCATGGTGTTGCCCAGG - Intergenic
1169533558 20:6512132-6512154 ACAGTCTCATGCTGTTGCCCAGG + Intergenic
1169565626 20:6850750-6850772 GGGGTTTCATGGTGTTGCCCAGG + Intergenic
1169698231 20:8415841-8415863 CCAGATTCATGGTGTTGCCCTGG - Intronic
1170205820 20:13796951-13796973 ACAGAGTCTTGCTGTTGCCCAGG - Intronic
1170616496 20:17956647-17956669 ACAGTCTCATTGTGTTGCCCAGG - Intronic
1170993663 20:21330089-21330111 GCAGTTTCATTGTGTTGGCCAGG - Intronic
1171444688 20:25195430-25195452 CCAGATTCAAGGGGTTCCCTTGG - Intergenic
1171452079 20:25243002-25243024 AGGGTTTCATGGTGTTGCCCAGG - Intergenic
1172547118 20:35770857-35770879 GCAGTTTCACGATGTTGCCCAGG - Intergenic
1172580201 20:36041415-36041437 CCTGTTTCATGGAGATGCCCAGG - Intergenic
1172876995 20:38170428-38170450 CCAGGTTCTTGGGGTTGGCCCGG + Intergenic
1172935429 20:38616740-38616762 CCAGAATGATGGTGTTCCCCAGG + Intronic
1173351479 20:42249512-42249534 CCAGATCCATGAAGTTACCCAGG - Intronic
1173731592 20:45332783-45332805 CAGGTTTCATCGTGTTGCCCAGG + Intronic
1174009398 20:47437419-47437441 ACAGGTTCTTGCTGTTGCCCAGG - Intergenic
1174010615 20:47446705-47446727 CCAGTTTCACTCTGTTGCCCAGG - Intergenic
1174398429 20:50262156-50262178 CCAGTCTCATTCTGTTGCCCAGG + Intergenic
1174523822 20:51155553-51155575 CCAGACCCACGGGGTTGCCCTGG + Intergenic
1174527415 20:51184762-51184784 ACAGAGTCTTGTTGTTGCCCAGG + Intergenic
1174748181 20:53085337-53085359 GGAGTTTCATTGTGTTGCCCAGG - Intronic
1175003004 20:55650283-55650305 CCAGATTCATGCTAATTCCCAGG - Intergenic
1175186114 20:57180501-57180523 CCAGAGTCAGGGTGGTGCCTAGG - Intronic
1176224368 20:63987447-63987469 ACAGTCTCATTGTGTTGCCCAGG - Intronic
1178019136 21:28389378-28389400 ACAGTTTCATTCTGTTGCCCAGG + Intergenic
1178161668 21:29924309-29924331 CCAGTCTCACTGTGTTGCCCAGG - Intronic
1178336719 21:31749945-31749967 ACAGTTTCATTCTGTTGCCCAGG - Intergenic
1178426476 21:32482880-32482902 ACAGAGTCTTGTTGTTGCCCAGG + Intronic
1178615034 21:34125073-34125095 CCAGATCCCTGGAGCTGCCCTGG + Intronic
1179019588 21:37626323-37626345 GGAGTTTCATCGTGTTGCCCAGG + Intronic
1179274884 21:39883200-39883222 ACAGATCCATGGGGTTGCCAAGG + Intronic
1179391897 21:41001574-41001596 CCAGAGTCACTCTGTTGCCCAGG + Intergenic
1179467491 21:41586458-41586480 CCAGTAGCATGGTGCTGCCCAGG - Intergenic
1181678344 22:24472638-24472660 CGAGTCTCATTGTGTTGCCCAGG - Intergenic
1181694495 22:24586077-24586099 CCACATCCACGTTGTTGCCCAGG + Exonic
1183022220 22:35036555-35036577 CCAAAATCAAGGTGTTGCCAGGG - Intergenic
1183264940 22:36819232-36819254 CCAGACTCCTGGTGTGGCCTGGG - Intronic
1183419413 22:37702075-37702097 ACAGTTTCATTCTGTTGCCCAGG - Intronic
1184023385 22:41835814-41835836 CCAGTCTCACTGTGTTGCCCAGG + Intronic
1184196845 22:42935436-42935458 CCAGACTCATGGTCTTGTCTAGG + Intronic
949794546 3:7833730-7833752 CAAGTTTCATTCTGTTGCCCAGG - Intergenic
950236237 3:11323071-11323093 ACAGTTTCATTCTGTTGCCCAGG - Intronic
950258266 3:11523601-11523623 CCTGATTTACGGTGTTGCTCTGG + Intronic
950374992 3:12563969-12563991 ACAGATTCACTCTGTTGCCCAGG + Intronic
950885478 3:16358838-16358860 AGAGTTTCATTGTGTTGCCCAGG - Intronic
952022314 3:29039013-29039035 CAAGTTTCACTGTGTTGCCCAGG - Intergenic
953500877 3:43432980-43433002 CGAGTTTCATTCTGTTGCCCAGG + Intronic
954856181 3:53645903-53645925 ACTGATTCATGCTGTGGCCCTGG - Intronic
955223000 3:57038466-57038488 GCAGAGTCTTGCTGTTGCCCAGG + Intronic
956021839 3:64941467-64941489 CCTGTTTCAGGGTCTTGCCCAGG + Intergenic
957192718 3:77030589-77030611 CCAGAGTCAAGGTGTTGGCAAGG + Intronic
957817936 3:85327279-85327301 ACAGATTCTCAGTGTTGCCCAGG + Intronic
958112845 3:89172229-89172251 CCCCATTCAGAGTGTTGCCCTGG + Intronic
959590644 3:108076081-108076103 CTAAAATCAAGGTGTTGCCCAGG - Intronic
960226547 3:115175837-115175859 ACAGAGTCTTGTTGTTGCCCAGG - Intergenic
961971340 3:130971778-130971800 CCAGATTTCTGGTGTTCCACAGG - Intronic
962014370 3:131424970-131424992 ACAGAGTCACTGTGTTGCCCAGG - Intergenic
962452191 3:135529434-135529456 CCAAAATCAAGGTGTTGGCCAGG + Intergenic
963664368 3:148163854-148163876 TCAGACTCATTCTGTTGCCCAGG - Intergenic
964266637 3:154904483-154904505 CAATATTCATGGTGCTGACCTGG - Intergenic
966069159 3:175854043-175854065 TCAGAGTCTTGCTGTTGCCCAGG + Intergenic
967431058 3:189385685-189385707 CCAGTTTCATGATGTTCCCCAGG + Intergenic
967438270 3:189476928-189476950 CCAGATTCAAGATGTTGGCTGGG - Intergenic
969821365 4:9722931-9722953 CCAGATTAGTGGTTCTGCCCCGG - Intergenic
971362500 4:25950890-25950912 CCACTTTCATGGTGTTGCCCTGG - Intergenic
971470337 4:27018207-27018229 CTAAAATCATGGTGTTGGCCAGG + Intronic
971798844 4:31261999-31262021 TGAGATTAATGGTGTGGCCCTGG - Intergenic
974243630 4:59284577-59284599 CAGGGTTCATCGTGTTGCCCAGG + Intergenic
975101119 4:70514057-70514079 CGGGTTTCATGTTGTTGCCCAGG - Intergenic
975146317 4:70971312-70971334 CGAGATTCACTATGTTGCCCAGG - Intronic
975704858 4:77101593-77101615 CCAGTTTCGTCATGTTGCCCGGG + Intergenic
976020845 4:80623648-80623670 CTAGATGCATTGTGTTGCCCGGG - Intronic
976171020 4:82304513-82304535 ACAGAGTCTTGCTGTTGCCCAGG + Intergenic
977034280 4:91929686-91929708 AGAGATTCATCATGTTGCCCAGG + Intergenic
979344208 4:119567126-119567148 CCAGGTTGTTGGTGTAGCCCAGG - Exonic
982775000 4:159432174-159432196 CCAGTTGCACTGTGTTGCCCAGG - Intergenic
984156144 4:176198175-176198197 ACAGAGTCATGCTGTTGCGCAGG + Intergenic
985963432 5:3321136-3321158 GGAGTTTCACGGTGTTGCCCAGG + Intergenic
986920309 5:12672283-12672305 GCGGTTTCATCGTGTTGCCCAGG - Intergenic
987588915 5:19896581-19896603 CCAAATTCAAGGTGTTTGCCAGG - Intronic
988476885 5:31594270-31594292 ACAGAGTCTTGCTGTTGCCCAGG - Intergenic
992775913 5:80089281-80089303 CCAGCTGCTTGGTGATGCCCTGG - Intergenic
995815596 5:116164293-116164315 CGAGTTTCACTGTGTTGCCCAGG - Intronic
995910019 5:117175817-117175839 GGAGTTTCATGATGTTGCCCAGG + Intergenic
996119997 5:119660642-119660664 CCAGGTTCACGGTGGTGCCAGGG - Intergenic
997537604 5:134634640-134634662 AGGGTTTCATGGTGTTGCCCAGG + Intronic
997567656 5:134902044-134902066 CCAGCTACATGGGGTTCCCCTGG + Intergenic
998550800 5:143076187-143076209 CCAGTCTCATTATGTTGCCCAGG + Intronic
999498589 5:152124671-152124693 CCATCTCCATGGTGTTGTCCTGG + Intergenic
999600308 5:153255344-153255366 CCATATTCAAGGCATTGCCCTGG + Intergenic
999972088 5:156874937-156874959 ACAGTCTCATGGTGTTGCCCAGG + Intergenic
1000624920 5:163527937-163527959 CCAAATCCAAGGTGTTGCCGGGG - Intergenic
1001772689 5:174308006-174308028 CCACATGCATGGGGCTGCCCTGG + Intergenic
1001912296 5:175531112-175531134 CCACATTCCTGGTGTTCCCAGGG + Intergenic
1002614156 5:180440027-180440049 ACAGAGTCTTGCTGTTGCCCAGG - Intergenic
1002819752 6:713710-713732 CCAGATTAATGTGGATGCCCTGG - Intergenic
1004078297 6:12365612-12365634 CCAGAAGCATGGTGTTTTCCTGG - Intergenic
1004261796 6:14114883-14114905 CCAGGTTCACCATGTTGCCCAGG + Intergenic
1004263066 6:14125125-14125147 CCAAAATCAAGGTGTTGCCAGGG - Intronic
1005113113 6:22307636-22307658 ACAGAGTCTTGCTGTTGCCCAGG + Intergenic
1005296801 6:24435035-24435057 ACAGAGTCTTGCTGTTGCCCAGG + Intronic
1005515659 6:26551773-26551795 CCTGATCCATGGGGTTGCCCAGG - Intergenic
1005584771 6:27265825-27265847 CAGGTTTCATTGTGTTGCCCAGG + Intergenic
1005685314 6:28248123-28248145 CCAGGTTCCTGGGCTTGCCCAGG - Exonic
1006352292 6:33530194-33530216 GGGGTTTCATGGTGTTGCCCAGG - Intergenic
1006508942 6:34511371-34511393 CCAGCTTCCAGGTGGTGCCCAGG + Intronic
1007318247 6:41007484-41007506 CCTGATTCATGATGATGTCCAGG + Intergenic
1007535134 6:42580563-42580585 ACAGTCTCATGCTGTTGCCCAGG + Intronic
1007771946 6:44199387-44199409 ACAGTTTCATCATGTTGCCCAGG + Intergenic
1008187986 6:48418589-48418611 TTAGAATCAAGGTGTTGCCCAGG + Intergenic
1008915050 6:56778213-56778235 CCTAATTCATGGTGTTGCTTAGG - Intronic
1010037192 6:71339820-71339842 ACAGTTTCACCGTGTTGCCCAGG - Intergenic
1010066691 6:71690619-71690641 CCACATTCTTGCTATTGCCCTGG - Intergenic
1011676012 6:89734914-89734936 ACAGTCTCATGCTGTTGCCCAGG + Intronic
1013335356 6:109153083-109153105 ACAGAGTCTTGCTGTTGCCCAGG - Intronic
1015795319 6:137005462-137005484 CCTGATTAATGGTGTGGGCCAGG - Intronic
1016089329 6:139956680-139956702 GGAGTTTCACGGTGTTGCCCAGG - Intergenic
1016197473 6:141362987-141363009 ACAGATTCTTGCTGTTGCCCAGG - Intergenic
1016990852 6:149926515-149926537 CCAGATTCTTGATATTGCCGGGG + Intergenic
1017343085 6:153348685-153348707 CTAGATTCTTGATGTTTCCCTGG - Intergenic
1018415193 6:163594810-163594832 ACAGAGTCTTGCTGTTGCCCAGG - Intergenic
1019493501 7:1325723-1325745 CAAGGTCCATGGTGTGGCCCAGG + Intergenic
1019529960 7:1498504-1498526 CCAACTTGATGGTGGTGCCCAGG + Exonic
1019683062 7:2363445-2363467 ACAGAGTCACGCTGTTGCCCAGG - Intronic
1019720183 7:2564886-2564908 CCAGAATCAAGGTGTTGGCAGGG - Intronic
1020201397 7:6082800-6082822 GCAGTTTCACTGTGTTGCCCAGG + Intergenic
1020592612 7:10160456-10160478 CCAGAATCAAGGTGTTGGCAGGG + Intergenic
1021553196 7:21893912-21893934 ACAGTTTCATTCTGTTGCCCAGG + Intronic
1021818757 7:24476098-24476120 GTAGATTAAGGGTGTTGCCCAGG + Intergenic
1022181734 7:27927028-27927050 CCATCTTCATGGTGTTGCCAGGG + Intronic
1022714288 7:32884350-32884372 GCAGAATCTTGCTGTTGCCCAGG - Intronic
1023062290 7:36339923-36339945 CCACCTTCCAGGTGTTGCCCAGG + Intronic
1023796239 7:43794707-43794729 AGAGTTTCATGGTGTTACCCAGG - Intronic
1024026114 7:45411189-45411211 CCAAAATCATGGTGTTGGCAGGG + Intergenic
1026051366 7:66949440-66949462 ACAGAGTCTTGCTGTTGCCCAGG - Intronic
1026066340 7:67076798-67076820 GCAGAGTCTTGCTGTTGCCCAGG + Intronic
1026100320 7:67378818-67378840 CCAGAGTCAAGGAGGTGCCCTGG + Intergenic
1026537417 7:71251433-71251455 CAAGGTCCATGCTGTTGCCCAGG + Intronic
1026710585 7:72735544-72735566 GCAGAGTCTTGCTGTTGCCCAGG - Intronic
1026960478 7:74404450-74404472 CCAGGTTCAAGGTGTTGGCGGGG + Exonic
1027229640 7:76264726-76264748 CCACAGTGATGGTGTGGCCCGGG - Intronic
1027261375 7:76467088-76467110 GCAGCTTCACTGTGTTGCCCAGG + Intronic
1027312758 7:76965197-76965219 GCAGCTTCACTGTGTTGCCCAGG + Intergenic
1027679094 7:81196508-81196530 ACAGATTCATGGAGATGCCTTGG - Intronic
1029393633 7:100291833-100291855 ACAGAGTCTTGCTGTTGCCCAGG + Intergenic
1029433578 7:100548336-100548358 ACAGAGTCTTGCTGTTGCCCAGG + Intronic
1030571702 7:111234312-111234334 CCAGATTCATAGGGTTGTTCAGG + Intronic
1032865971 7:135924709-135924731 ACAGTTTCATTCTGTTGCCCAGG + Intergenic
1034633928 7:152552400-152552422 ACAGAGTCTTGCTGTTGCCCAGG - Intergenic
1035046178 7:155968412-155968434 ACAGTCTTATGGTGTTGCCCTGG + Intergenic
1035240829 7:157528069-157528091 CCAGATTCAGGGTTAGGCCCCGG + Intergenic
1035986179 8:4434338-4434360 ACAGTCTCATGCTGTTGCCCAGG - Intronic
1036403040 8:8427303-8427325 GGAGATTCATTCTGTTGCCCAGG - Intergenic
1036517200 8:9455275-9455297 ACAGAGTCTTGCTGTTGCCCAGG - Intergenic
1038167278 8:25098048-25098070 GCAGTTTCATGCTGTTGCCCAGG - Intergenic
1038190327 8:25314308-25314330 CAAGTTTCATTATGTTGCCCAGG + Intronic
1038552057 8:28478794-28478816 CAGAATTCATTGTGTTGCCCAGG - Intronic
1039788760 8:40857075-40857097 CCAGGCTCCTGGTATTGCCCAGG - Intronic
1041516179 8:58701011-58701033 CCAAAATCATGGTGTTGGCAGGG - Intergenic
1042092735 8:65176619-65176641 ACAAAGTCATGCTGTTGCCCAGG - Intergenic
1042121448 8:65493044-65493066 ACAGTTTCATTCTGTTGCCCAGG + Intergenic
1042859563 8:73298717-73298739 GGGGTTTCATGGTGTTGCCCAGG + Intronic
1042915271 8:73869232-73869254 ACAGATTCACTGTGTTGCCGAGG - Intronic
1043505816 8:80900894-80900916 TTAGCTTCATGATGTTGCCCAGG - Intergenic
1044078950 8:87860205-87860227 CCAGTTTCACTGTGTCGCCCAGG + Intergenic
1044706355 8:95012616-95012638 ACAGAGTCTTGCTGTTGCCCAGG - Intronic
1045019842 8:98032555-98032577 ACAGTTTCATTCTGTTGCCCAGG + Intronic
1049859470 8:144888840-144888862 CCAGATTCATGGCGTGAACCCGG - Intronic
1051339936 9:16101886-16101908 CCAAAGTCAAGGTGTTGGCCAGG - Intergenic
1053190489 9:36062501-36062523 ACAGAGTCTTGCTGTTGCCCAGG + Intronic
1053398596 9:37798589-37798611 AGAGTTTCATGATGTTGCCCAGG + Intronic
1053724238 9:40981282-40981304 GCAGTCTCATTGTGTTGCCCAGG - Intergenic
1054341731 9:63870719-63870741 GCAGTCTCATTGTGTTGCCCAGG + Intergenic
1055290235 9:74775207-74775229 CCTGACTCACAGTGTTGCCCAGG + Intronic
1056320159 9:85428225-85428247 CAAGAATCGTAGTGTTGCCCAGG - Intergenic
1057798227 9:98173111-98173133 ACAGAATCACTGTGTTGCCCAGG - Intronic
1060964357 9:127704311-127704333 GGAGTTTCATCGTGTTGCCCAGG - Intronic
1185995751 X:4946932-4946954 CCCGATTCATGGAGTTTCACTGG + Intergenic
1186349940 X:8731175-8731197 AAAGATTCAAGGTCTTGCCCTGG - Intronic
1187019523 X:15366030-15366052 CCAGTCTCATTCTGTTGCCCAGG + Intronic
1187357888 X:18595154-18595176 AGAGTTTCATGCTGTTGCCCAGG - Intronic
1187437267 X:19284082-19284104 CCAGAATCCTGGTGTAACCCTGG + Intergenic
1188495616 X:30780100-30780122 CCATATTCATGTTGTTGACATGG - Intergenic
1189232030 X:39460121-39460143 ACAGATGCCTGGTGTTGGCCGGG + Intergenic
1190082204 X:47365460-47365482 CGAGTTTCATCATGTTGCCCAGG + Intergenic
1194454991 X:94092566-94092588 CCAAAATCATGGTGTTGGCAGGG - Intergenic
1196671929 X:118377332-118377354 ACAGAGTCTTGCTGTTGCCCAGG - Intronic
1196693158 X:118582102-118582124 ACAGAGTCTTGCTGTTGCCCAGG - Intronic
1196738288 X:119000259-119000281 CCAGTTTCATGGTGCTGCATTGG + Intronic
1196980153 X:121204009-121204031 ACAGATTCATGATATTGCCCTGG - Intergenic
1197056095 X:122121277-122121299 CCAAAATCATGGTGTGGACCAGG + Intergenic
1197949860 X:131882721-131882743 ACAGATTCACTATGTTGCCCAGG + Intergenic
1198106815 X:133469905-133469927 CAAGTTTCACTGTGTTGCCCAGG + Intergenic
1200953098 Y:8919301-8919323 GGGGATTCATGGTGTTGGCCAGG - Intergenic
1201317240 Y:12659739-12659761 ACAGAGTCTTGCTGTTGCCCAGG + Intergenic
1201317390 Y:12661449-12661471 CCAGATAGATGGTCTGGCCCAGG + Intergenic
1201578976 Y:15491219-15491241 ACAGAGTCTTGCTGTTGCCCAGG - Intergenic