ID: 1169702043

View in Genome Browser
Species Human (GRCh38)
Location 20:8457511-8457533
Sequence GTGTTACTCTAGCAGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169702043 Original CRISPR GTGTTACTCTAGCAGTGTGA TGG (reversed) Intronic
912956299 1:114156001-114156023 TTCTCAATCTAGCAGTGTGAAGG + Intergenic
918947959 1:191094471-191094493 TTGTTCCTCCAGCACTGTGAGGG + Intergenic
920862606 1:209722771-209722793 GGGTTGCTCTAAAAGTGTGAAGG + Intronic
921309500 1:213828689-213828711 GTTTTACTATCCCAGTGTGAGGG - Intergenic
922720889 1:227899813-227899835 GTTTTCCTCTGGCTGTGTGAGGG + Intergenic
922903476 1:229156290-229156312 GGGTTGCTCTGGCAGAGTGAGGG - Intergenic
1062881806 10:985066-985088 GTGTCTCTCCAGCTGTGTGACGG + Intergenic
1062935460 10:1382839-1382861 GTGTTACTCTAGAAACGTCAGGG + Intronic
1081155730 11:39687321-39687343 ATGTTAGTCTAGCAGTTTTAGGG + Intergenic
1081663506 11:44902963-44902985 GTGTTAATTCAGCAGTGTGAAGG - Intronic
1086146298 11:83555971-83555993 GTGTTACTCTAGTAATCTCAAGG - Intronic
1089730408 11:120515448-120515470 GTGTGACTCGTCCAGTGTGAAGG + Intronic
1097455271 12:59792442-59792464 GTGTTACATTAGCGGTGGGAGGG + Intergenic
1098745322 12:74230698-74230720 GTGTAAATCTTGCAGTCTGAAGG - Intergenic
1101327238 12:103726629-103726651 CTTTTTCTCTACCAGTGTGATGG - Intronic
1108126987 13:47255430-47255452 GTGATAATCTAGGAGAGTGAGGG + Intergenic
1110622654 13:77615410-77615432 GTGTTGCTCTTGCTGTGGGATGG + Intronic
1112006114 13:95255212-95255234 GTGTTACACGAGAAGTGTGCTGG - Intronic
1116473063 14:45307394-45307416 GTGTTACACTTGGAATGTGAAGG + Intergenic
1118136702 14:63036439-63036461 TTTTTACTCTAGAAGTGTTAGGG - Intronic
1118524739 14:66626059-66626081 GTGTTATTTTAGCCATGTGATGG + Intronic
1121060073 14:90898928-90898950 GTTTTACTCTAGAAGTGAAAGGG + Intronic
1122056192 14:99099768-99099790 CTATTCCTCTAGCAGTGGGAAGG + Intergenic
1125693817 15:41618811-41618833 GTGTTCCTCTAGCACTGTCTAGG + Intergenic
1125734991 15:41918683-41918705 GTCTTACTCTTGGAGTGTGCTGG - Intronic
1126125967 15:45294566-45294588 GTGTTACTCTGGCAGAGAGGAGG + Intergenic
1126904760 15:53352493-53352515 GTGTAAGTCTAGTAGTCTGAAGG + Intergenic
1127559846 15:60125395-60125417 GTGTTTCTCAAACAGTGTGCAGG + Intergenic
1134995610 16:18736204-18736226 GTGTTCCTCGGGCAATGTGAGGG - Intergenic
1135530182 16:23246378-23246400 CTGTTACCCTAGCACTTTGAGGG + Intergenic
1139072503 16:63400194-63400216 GTTTTACTCTAGGAGTTTTATGG - Intergenic
1141406439 16:83798172-83798194 GAGCTACTCTATGAGTGTGATGG - Intronic
1143742936 17:8966900-8966922 GTGCTACTCTTCCATTGTGAGGG - Intergenic
1143862512 17:9901233-9901255 GTTTTCCTCCAGCAGTTTGACGG - Intronic
1146758011 17:35449746-35449768 TTGTAACACGAGCAGTGTGACGG + Intergenic
1152901177 17:82941892-82941914 TTGTTACTTTAGAAGAGTGACGG - Intronic
1155370374 18:25093410-25093432 TTGTTACCCTTGTAGTGTGACGG - Intronic
1155502978 18:26505356-26505378 TTGTTTCTTCAGCAGTGTGACGG - Intronic
1164579820 19:29427957-29427979 GCGTTGCACTAGCTGTGTGATGG - Intergenic
931960840 2:67480827-67480849 GTGTTTGACTAGCAATGTGAGGG + Intergenic
932078284 2:68687187-68687209 GTTTCACTATAGAAGTGTGACGG + Intronic
936397943 2:112143244-112143266 GTGTTTCTCTTCCAGTGGGAAGG - Intronic
936463654 2:112728805-112728827 GTGGTCCACTAGCTGTGTGATGG - Intronic
939216127 2:139240796-139240818 GTGATACTCATGCAATGTGAGGG - Intergenic
939448985 2:142348123-142348145 GTGTTATTGTAGAAATGTGATGG - Intergenic
940912330 2:159219572-159219594 GTGTCAGTCAAGCACTGTGAAGG - Intronic
944373905 2:199017669-199017691 GTGATACTCTAGAAGTAAGATGG + Intergenic
947416533 2:229902123-229902145 CTGTAACTCTAGCACTCTGAGGG + Intronic
1169702043 20:8457511-8457533 GTGTTACTCTAGCAGTGTGATGG - Intronic
1172265614 20:33610499-33610521 GTATTAATCTAGCACTGTTAAGG + Intronic
1172487832 20:35309489-35309511 GCCTTACACTAGCAGTGTGGTGG - Intronic
1181164136 22:20974400-20974422 GTGTCACTGGAGCAGAGTGAGGG + Intronic
1181307517 22:21925415-21925437 GTGATACCCTCGTAGTGTGAAGG - Intronic
1181721527 22:24778697-24778719 GTTATAATCTAGCAGGGTGAGGG - Intergenic
1182287239 22:29255646-29255668 GGGTTTCTCTACCAGTGTCAGGG - Intronic
1184329764 22:43819901-43819923 GTGGTTCTCTGGCAGTGAGATGG + Intergenic
1184700854 22:46171689-46171711 GTGTGACTCGAGCAGTGTCCTGG + Intronic
950399688 3:12760403-12760425 GTGTTACTGGAGCAGAGTGAGGG - Intronic
951442710 3:22741625-22741647 GTGTGTCTCTAGAAGTGAGATGG + Intergenic
952464534 3:33567801-33567823 GGATTACTTAAGCAGTGTGAGGG - Intronic
954853255 3:53620945-53620967 GTGCTCCTCTGGCAGTGTCATGG - Intronic
958845473 3:99260094-99260116 GTGTTTCTCTCTGAGTGTGAGGG + Intergenic
959396614 3:105847624-105847646 GTGGTTGTCTAGCAGTGTGTAGG + Intronic
964930210 3:162010771-162010793 TTGTGACTCTAGCAGTGGGGAGG - Intergenic
965478089 3:169183180-169183202 CTGTTACCCTAGCTATGTGATGG + Intronic
966109362 3:176379987-176380009 TTCTTTCTCCAGCAGTGTGATGG + Intergenic
966168318 3:177047542-177047564 GTTTTTCTCTGGCAGAGTGAAGG - Exonic
969114614 4:4863248-4863270 GTGAAACTGGAGCAGTGTGAGGG - Exonic
974297314 4:60018278-60018300 TTGATACTCAAGAAGTGTGAGGG - Intergenic
976220159 4:82750340-82750362 GTGTTACTCCTGCAGGGTGTAGG - Intronic
978912765 4:114083790-114083812 GTGTCATTTGAGCAGTGTGAGGG - Intergenic
988996308 5:36718071-36718093 GTGCGAATCTGGCAGTGTGAGGG + Intergenic
989530939 5:42507726-42507748 GTGTTACTCTAGTCCTGAGAGGG + Intronic
992400312 5:76404712-76404734 GTGTTACCCTTGCAGTGAGGGGG + Intronic
998518430 5:142777783-142777805 TTGTGACTGTAGCAGAGTGAAGG + Intronic
1002861739 6:1085589-1085611 GTGTTACCATAGCTGTTTGATGG + Intergenic
1006461827 6:34163782-34163804 CTGTTACTCTTGCACTGTGAGGG - Intergenic
1007867923 6:44994158-44994180 TTATTACTCTAGGACTGTGAGGG + Intronic
1014151007 6:118055159-118055181 GTGTTACTTTATCAGTGTTTGGG + Intronic
1019398003 7:833750-833772 GTGTTGCTATGGAAGTGTGATGG - Intronic
1023589655 7:41767900-41767922 GTGTTAATATAGGACTGTGAAGG - Intergenic
1023737843 7:43250461-43250483 GTTTTATTCTAGCTGTGAGAAGG + Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1036405321 8:8449850-8449872 CTGTTCCTCTTGCAGTGTCATGG - Intergenic
1045042657 8:98241411-98241433 CAGTGACTCTAGCAATGTGAGGG - Intronic
1048105364 8:131402722-131402744 GTGTGTCCCTAGCAGTGGGAGGG - Intergenic
1051148208 9:14052558-14052580 GTGTTACACAAGCAGTGCCATGG + Intergenic
1052230757 9:26149060-26149082 GTTTTACTCCTGCAGTCTGAGGG - Intergenic
1052842345 9:33303412-33303434 CTGTGGCTCTAGCTGTGTGATGG - Intronic
1056470960 9:86904126-86904148 GTGCTTCTCCAGCAGGGTGAAGG + Intergenic
1059972973 9:119686339-119686361 GTGTTTCTGCAGCAGAGTGACGG - Intergenic
1189378464 X:40484176-40484198 GGGTTCCTTTAGCAGTGTGGAGG + Intergenic
1189578798 X:42383993-42384015 GTGTTAGTAAAGCAGTGTAAAGG + Intergenic
1197794063 X:130282037-130282059 GTGTTCCTCTCTGAGTGTGAGGG - Intergenic