ID: 1169702112

View in Genome Browser
Species Human (GRCh38)
Location 20:8458304-8458326
Sequence TGAAATATACAAACGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 271}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169702112 Original CRISPR TGAAATATACAAACGGACAA TGG (reversed) Intronic
900987183 1:6080073-6080095 TGAAATATAAAAACAGAAAACGG + Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903205152 1:21776434-21776456 AGAAATAAACAAAAGGAGAAAGG + Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
906921057 1:50064845-50064867 AGAAATATACAAAAGGCTAAAGG - Intronic
907621356 1:55983820-55983842 TGGGATATACAAGAGGACAAGGG + Intergenic
908137501 1:61148337-61148359 TGAAATGTACAAAAGTCCAAAGG - Intronic
909789973 1:79664025-79664047 TGAAATAAACCCAAGGACAAAGG + Intergenic
911175940 1:94818893-94818915 AGAAATATAAAAACAGAGAAGGG - Intergenic
911318626 1:96385034-96385056 TGAATTAAACAAAAGGAAAAAGG + Intergenic
912184525 1:107258953-107258975 TGAAAAATCCAAAGGGAAAATGG + Intronic
913390482 1:118305492-118305514 TAAAATTTACAAATGTACAAAGG - Intergenic
915305079 1:154972661-154972683 TGAAATTTACATAGGGAGAAAGG + Intronic
916495115 1:165339717-165339739 GGAAATGTACAAAAGAACAAAGG + Intronic
917629835 1:176880631-176880653 TAAAATATAAAAAGTGACAAAGG + Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917761914 1:178170440-178170462 TAAAATATATAATCAGACAAGGG + Intronic
918748588 1:188240675-188240697 TCAAATATGAAAATGGACAAAGG + Intergenic
918965461 1:191342087-191342109 TGAAATAAAAAGACTGACAATGG + Intergenic
919182261 1:194102190-194102212 TGAAATTTAAAAATGAACAAAGG - Intergenic
919389046 1:196958029-196958051 TAACATGTAGAAACGGACAATGG + Exonic
921428788 1:215038679-215038701 TAAAATATACCAAGGAACAAAGG - Intronic
922319477 1:224473159-224473181 TCAAATTTAAAAACGTACAATGG + Intronic
922324181 1:224513126-224513148 TAAATTATACAAAGGGACACAGG - Intronic
1063320659 10:5049806-5049828 TGAAATTAACACAGGGACAAAGG - Intronic
1065979842 10:30882476-30882498 TGGAATATATAAACATACAATGG + Intronic
1066019462 10:31283541-31283563 TGTAATACACAACAGGACAAAGG - Intergenic
1071320039 10:84445502-84445524 TGTAATATACATACAGAAAAGGG + Intronic
1071879672 10:89882814-89882836 TCAAATCTAAAAACAGACAATGG - Intergenic
1073365693 10:102938959-102938981 TAAAATAAACAAGCAGACAAAGG + Intronic
1074861630 10:117514442-117514464 TGAAACACACAAAAGAACAAAGG + Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1077345373 11:2046578-2046600 TGAAGTATAAAAACGGGGAATGG - Intergenic
1078792803 11:14561539-14561561 AGAATTATACAAACACACAAAGG - Intronic
1079501195 11:21103158-21103180 TGAATTACACAAACAAACAAGGG - Intronic
1080003616 11:27380143-27380165 TGATATATACAAAGGGAAACCGG + Intronic
1080237363 11:30086618-30086640 AAAAATATACAAACAGACAATGG - Intergenic
1080570244 11:33549353-33549375 TTAAATAAACAAACAAACAAAGG - Intronic
1080955412 11:37088374-37088396 TTTAATATACAAAGGAACAATGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081199942 11:40203631-40203653 TGAATTCTACAAACAGAAAAGGG + Intronic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1086056796 11:82655925-82655947 TGAAATGTACAAATGGAAGATGG + Intergenic
1087892932 11:103555820-103555842 TGAAATGTCCTAACAGACAAAGG - Intergenic
1090496764 11:127220704-127220726 TGCACTATACAAACAGACAATGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094628167 12:32146071-32146093 TGACATATACATATGAACAAAGG + Intronic
1094711448 12:32967207-32967229 TGAAATATAGAAACCTACAAAGG - Intergenic
1094794592 12:33956490-33956512 CTAAATATACAAACCAACAATGG + Intergenic
1095106448 12:38239104-38239126 CTAAATATACAAACCAACAATGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096350521 12:50895640-50895662 TGAAATACACAAAGCGAAAATGG + Intergenic
1099325703 12:81212140-81212162 TGATAAATACTAACGGAAAAAGG - Intronic
1099529457 12:83759364-83759386 TGAAATAAACAATCTGACACAGG - Intergenic
1099572075 12:84335135-84335157 TAAACTATACATACAGACAATGG + Intergenic
1099992496 12:89739295-89739317 TGAAATCTAAAAACATACAATGG + Intergenic
1100107844 12:91198857-91198879 GAAAATATACAAATGGCCAATGG - Intergenic
1100273875 12:93052978-93053000 TAAAATATAAAAAGGGAGAATGG - Intergenic
1100704394 12:97184535-97184557 AGAAATTTACAAATGAACAAAGG - Intergenic
1101590409 12:106120663-106120685 TGAAATAAACAGACAGTCAAAGG + Intronic
1102075253 12:110054759-110054781 AGAAATATAAAAACAAACAAGGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1106893807 13:34275970-34275992 TGAAAAGTACAAACTGGCAAGGG + Intergenic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1108878918 13:55084933-55084955 TCAAATCTAAAAACGTACAATGG - Intergenic
1109242668 13:59909454-59909476 TGAAAAATAGAAATGGAAAAAGG + Intronic
1109933830 13:69253230-69253252 TGAAAAATAAAAAGGGACACTGG - Intergenic
1110796323 13:79642888-79642910 TGACATATACAAACTGAGAATGG + Intergenic
1111171493 13:84532388-84532410 TGAAACATGCAAATGGACACAGG - Intergenic
1111199711 13:84918226-84918248 TGAAAAGTACAAATAGACAAAGG + Intergenic
1111450020 13:88402791-88402813 TGATATATGCAAACAGAAAAAGG - Intergenic
1112472701 13:99703251-99703273 TTAAATTTAAAAAGGGACAATGG - Intronic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114854112 14:26416798-26416820 TGAAATATGAAAACACACAAAGG - Intergenic
1115142204 14:30184869-30184891 TGAATTAAATAAAGGGACAACGG + Intronic
1115166087 14:30450115-30450137 TGAACTTTACAAAAGGACGAAGG + Intergenic
1116233162 14:42243744-42243766 TCAAATAAACAAACAAACAATGG + Intergenic
1116497910 14:45585286-45585308 TGAAATATTCAAACTGGTAAAGG - Intergenic
1118017087 14:61671673-61671695 TGAAATATACAAATGGAGGCCGG + Intergenic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1119882225 14:78109718-78109740 TTAAATATACAAACAGAAATAGG - Intergenic
1122951617 14:105048028-105048050 TGAAATTTAAAAATGGACACCGG - Intergenic
1123942341 15:25222652-25222674 TGAAAGACACAAAGGGAGAATGG - Intergenic
1124474967 15:30025386-30025408 GGAAATATACAAATATACAAGGG - Intergenic
1125363563 15:38889746-38889768 TCAAATATTCAAACTGACATAGG - Intergenic
1126136598 15:45398037-45398059 TGAAAGAAATAAACGGAAAAGGG - Intronic
1126412916 15:48390485-48390507 TGAAACAAACAAACAAACAAAGG - Intergenic
1126961804 15:54004783-54004805 GAATATATACAAACGGAAAATGG - Intergenic
1129243854 15:74268139-74268161 TGAAATATTCAAATGGAAAAGGG + Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131004252 15:88963730-88963752 TCAAATAGACAAAAGAACAAAGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133528370 16:6628689-6628711 TGAAATATACAAACCTTGAAGGG + Intronic
1135221533 16:20618628-20618650 TTAAAAATACAAACTCACAATGG + Intronic
1137505358 16:49049577-49049599 TTAAACATACAAACTGACAAAGG - Intergenic
1137851263 16:51747152-51747174 AAAAATAAACAAACAGACAAAGG + Intergenic
1140812833 16:78594704-78594726 TGAGTTATAAAAAGGGACAAAGG - Intronic
1143929475 17:10406854-10406876 TGAAATAATCAAACGGGCACAGG - Intronic
1144218691 17:13080445-13080467 TGAAATATCCAAACTGCCCATGG - Intergenic
1147032544 17:37651510-37651532 TGGAAGAGACAAAGGGACAAGGG + Intergenic
1149354160 17:55822490-55822512 TGAAATATTCCAACTGACAAAGG - Intronic
1150232373 17:63563175-63563197 TGCAATAGAAAAATGGACAAAGG + Intronic
1153986612 18:10356664-10356686 TGGCATATACAAACCGACTATGG + Intergenic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1157015255 18:43704406-43704428 TTGAATATACGAACAGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157656387 18:49393434-49393456 TGAAATGTACATACACACAATGG + Intronic
1158096456 18:53777712-53777734 TGAAATATACATAATGACACTGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1167704817 19:51074993-51075015 TGAAAAATAAAAAAGGGCAAAGG + Intergenic
925358327 2:3259211-3259233 TGAAATACACAAGATGACAAAGG + Intronic
925479060 2:4250362-4250384 GGAAATATAAAGACAGACAATGG - Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929873215 2:45775148-45775170 TGAGATATAAACATGGACAATGG - Intronic
930258635 2:49119743-49119765 AGAAATACAAAAACGAACAAAGG + Intronic
930617941 2:53613575-53613597 TAAAACATACAAATGGCCAATGG - Intronic
930961094 2:57262642-57262664 TGAAATATACCAACAGACAAAGG + Intergenic
931586805 2:63838747-63838769 TGAAATATATAAAGGGAAATAGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932907358 2:75768325-75768347 TGAAATATACAACCAGACAATGG + Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933418681 2:82021663-82021685 TGAAATTTAGGAAGGGACAAAGG - Intergenic
933909422 2:86926362-86926384 TGAAATATACAAATGGTAAAAGG + Intronic
934023304 2:87977017-87977039 TGAAATATACAAATGGTAAAAGG - Intergenic
934948681 2:98561058-98561080 TAAAATATACACACTTACAAAGG + Intronic
935053941 2:99549152-99549174 TGAAATATTCAAACACATAAAGG - Intronic
935540932 2:104348026-104348048 TCCAATTTAAAAACGGACAAAGG + Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
936413253 2:112279388-112279410 TGAAATATACTAATGGTAAAAGG + Intronic
937673928 2:124568307-124568329 TGAAGTAGACAAAAGGAAAAGGG + Intronic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938816788 2:134912900-134912922 TCAAACAAACAAACAGACAAAGG - Intergenic
941172281 2:162154000-162154022 TCAAATAGACAAATAGACAATGG - Intergenic
943231476 2:185258345-185258367 TTAAATATAAGAAGGGACAATGG - Intergenic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
943818398 2:192285542-192285564 AGAAAAATACAAAAGCACAATGG + Intergenic
944108354 2:196103686-196103708 AGAAACATACAAACTAACAAAGG - Intergenic
945246357 2:207720759-207720781 AGAAATACACAAAGGGAGAAAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945599160 2:211836887-211836909 TGTAACATACAAAGGCACAATGG + Intronic
945715208 2:213349680-213349702 TGGAATATACATACATACAAGGG + Intronic
946119951 2:217501608-217501630 TGAGATGTACAAATGCACAAAGG - Intronic
947829878 2:233131698-233131720 TCAAATAAACAAACAAACAAAGG + Intronic
1169215146 20:3789232-3789254 TCAAATAAACAAAAGGAGAATGG - Intronic
1169702112 20:8458304-8458326 TGAAATATACAAACGGACAATGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1174676989 20:52367636-52367658 TGAAATATTCAGATGGACCATGG + Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179053947 21:37914737-37914759 TGAAAAAAAGAAACGGAAAAGGG - Intronic
1181428589 22:22861603-22861625 AGAAACATACAAATGGCCAAAGG + Intronic
1183613984 22:38930877-38930899 TGAAATAGACAAATAGATAATGG - Intergenic
949735471 3:7166932-7166954 TGAAATATACTAAAATACAAAGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
951863738 3:27283783-27283805 TGAAATATACAAATGGCTAGAGG + Intronic
952930946 3:38360735-38360757 TGAAATATACAAACATAGACTGG + Intronic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953443900 3:42945965-42945987 TGAAATTTACAAAGGGCAAAGGG - Intronic
954831589 3:53425681-53425703 TGAATTACACAAGCGGACAGTGG - Intergenic
954895475 3:53971581-53971603 TGAAATATACTTACGGCCAGTGG - Intergenic
957390630 3:79562466-79562488 TGATATATACAAAGAGATAATGG - Intronic
957660453 3:83144956-83144978 TGAAAAATACAACCAGGCAATGG - Intergenic
959058131 3:101588663-101588685 TGAAATATACACAAAGACTAAGG - Intronic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959299623 3:104580538-104580560 AGAAAGATACAAAGGAACAATGG + Intergenic
960126880 3:114008751-114008773 TCAAATAGAAAAATGGACAAAGG + Intronic
960187884 3:114666150-114666172 GGAAATAGACAAAGGGAAAAGGG - Intronic
961543171 3:127614174-127614196 TGAAATATACCAAGGGTGAATGG - Intronic
962131444 3:132682038-132682060 TGAATTATACAAAAGGGCAATGG - Exonic
962668087 3:137676246-137676268 TGAAATCTAAAAACATACAATGG + Intergenic
963053921 3:141168028-141168050 TGAAATCTGCAAAAAGACAATGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
965618868 3:170622491-170622513 TGAAATAGAAAAAAAGACAATGG - Intronic
965672370 3:171159754-171159776 TGAAAAATAGAAAAGGACAATGG - Intronic
966290268 3:178347866-178347888 TGTAATATACAAATGGACACTGG + Intergenic
974072967 4:57141739-57141761 TGAAATAAACATACGGGCACAGG + Intergenic
974670462 4:65023581-65023603 TGAAACATTCAAAAGGAAAATGG - Intergenic
975531963 4:75408818-75408840 TGGAATATATATACGCACAATGG - Intergenic
976213755 4:82696114-82696136 TGAAATATTCAAATGGAAGAAGG + Intronic
977113339 4:92988785-92988807 TGGAATAAACAAACTGACAAAGG + Intronic
977152006 4:93524145-93524167 AGAAATAAACAAACTGAAAATGG + Intronic
978038100 4:104021791-104021813 TTGAATATATAAACAGACAATGG + Intergenic
979563388 4:122125614-122125636 ACAAATATACAAATGGACATAGG - Intergenic
981447695 4:144859288-144859310 TGAAATATAATCACAGACAATGG - Intergenic
984476157 4:180237608-180237630 TAAAATTTACAAGCTGACAAAGG - Intergenic
984742934 4:183184902-183184924 TGAAATATTTAAACAGATAATGG - Intronic
985800278 5:2001331-2001353 TGACAAATACAGACGGGCAAAGG + Intergenic
986199042 5:5564672-5564694 TGAAAAATACATACGGGAAAAGG + Intergenic
986646397 5:9920751-9920773 ATAAACATACAAACGGGCAATGG - Intergenic
987503126 5:18738546-18738568 TGAAATATTCAAAAATACAAAGG - Intergenic
988057922 5:26124515-26124537 AGAAATGGACAAACGAACAAAGG + Intergenic
988388307 5:30595086-30595108 AGACAAATACAAACAGACAAAGG - Intergenic
988981813 5:36577547-36577569 TGAAATTTACATAGGGACTATGG + Intergenic
989227314 5:39044430-39044452 TAAAATATAAGAATGGACAAGGG + Intronic
989415606 5:41171869-41171891 TTAAAAATACAGACTGACAAGGG - Intronic
991015982 5:61933125-61933147 TGAAATATATCAAGGGAGAATGG - Intergenic
991393385 5:66174869-66174891 TCAAATATACAAAAGCAAAAGGG - Intronic
991615480 5:68492961-68492983 TGAAATATACACACACACACAGG - Intergenic
993080606 5:83293658-83293680 TGAAATTTACAAACTGATAATGG - Intronic
993594788 5:89840086-89840108 TGAAATATCCAAATGGAACACGG - Intergenic
993710909 5:91223807-91223829 TGAAATATACAAGCGACCATAGG - Intergenic
993789477 5:92190168-92190190 TGAAAAATAAAAACTGAAAATGG - Intergenic
994101729 5:95900972-95900994 TGAAATAGACAGACGGTCATTGG - Exonic
996031396 5:118708605-118708627 TAAAATATACAAAGAGAGAATGG + Intergenic
997043027 5:130279828-130279850 TAAAATATTCAAAAGGTCAAAGG - Intergenic
998544824 5:143018166-143018188 TGAAATAGAAAAATGGGCAAAGG - Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999531169 5:152464976-152464998 AGAAATGTAAAAACAGACAAAGG - Intergenic
999598361 5:153232096-153232118 TTAAATAAACAAACTGACACTGG - Intergenic
1000479795 5:161758020-161758042 TTAAATACACCAAAGGACAATGG - Intergenic
1001340330 5:170837551-170837573 TGAAAAATACAAACTAATAAAGG - Intergenic
1001870699 5:175152330-175152352 AGAAATATAGAAAAGGACACAGG + Intergenic
1003488597 6:6601037-6601059 TGAAATAAACAAAGGGCCACTGG - Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004368834 6:15034804-15034826 TAAAATATAGAAACAGACATAGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1006765598 6:36502408-36502430 TAAAAAATACTAATGGACAAAGG - Intronic
1007864397 6:44952491-44952513 TGAAATATATAACCTGAAAATGG - Intronic
1008368991 6:50712515-50712537 TGCTTTATACAAATGGACAAAGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1010929733 6:81786697-81786719 TGCAATACACAACAGGACAATGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012106250 6:95163027-95163049 TGAAATATACATAGGAAGAAAGG + Intergenic
1012575032 6:100784819-100784841 TAAAATAAACAAAAGGAGAAAGG + Intronic
1016230019 6:141791506-141791528 TGAAATAAAAAAACACACAATGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016651929 6:146471818-146471840 GGAAATATTCAAATAGACAAAGG + Intergenic
1018162342 6:161057855-161057877 TTAAACATACAAACATACAAAGG + Intronic
1018231999 6:161683900-161683922 TGAAATTTAAAAACTGACAAAGG + Intronic
1018524689 6:164695944-164695966 TGAAAAATAAAAACAGAAAATGG + Intergenic
1020463885 7:8454484-8454506 TCAAATTTACAAATGAACAAAGG - Intronic
1020880762 7:13760678-13760700 TGACATTTACAGACGGAAAAAGG + Intergenic
1021368926 7:19817164-19817186 TTAAATGTACAAACGTCCAATGG + Intergenic
1024632099 7:51258252-51258274 TGAAATATACATAGGAAGAATGG - Intronic
1024740293 7:52346524-52346546 TGTGATAAACAAACAGACAAGGG - Intergenic
1025135789 7:56411380-56411402 TGATATATACCAATAGACAAAGG + Intergenic
1025138975 7:56447259-56447281 TGAAACATACAGACGTACATAGG + Intergenic
1025962897 7:66239352-66239374 GGAAATACGCAAAGGGACAATGG - Intronic
1026149208 7:67773755-67773777 AGAAAGAGACAAAGGGACAAAGG - Intergenic
1027178962 7:75924183-75924205 TGAAATATACATAGGAAGAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029384597 7:100235109-100235131 TCAAATATGCAAATGGAAAAGGG + Intronic
1036052733 8:5218000-5218022 TGAGATCTACAAGCGGACATGGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1042095186 8:65207638-65207660 TAAGATATACAAATGGCCAACGG - Intergenic
1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG + Intronic
1043996700 8:86826375-86826397 TGAAATATACAACAGACCAAAGG - Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044475627 8:92621927-92621949 AGAAGTATACCAACGGACATAGG + Intergenic
1046147835 8:110185117-110185139 TCAAATAAACAACCTGACAACGG - Intergenic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1050035129 9:1427288-1427310 TGAAATAATCAAACAGTCAAAGG + Intergenic
1050656709 9:7836618-7836640 TGCAATCTACCATCGGACAAAGG - Intronic
1052162964 9:25289156-25289178 TAAAATAGACAAACGGTCTAAGG + Intergenic
1053493613 9:38531830-38531852 TAAAATAAACAAACAGAAAATGG + Intergenic
1055220379 9:73922345-73922367 TGAAATATACAAACCAGAAAAGG - Intergenic
1055242789 9:74204254-74204276 TGAAATATACATCTGGGCAATGG + Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056187745 9:84152436-84152458 AGATATATACAAAGGGCCAAAGG - Intergenic
1057823243 9:98350992-98351014 AGAAACATAAAAAGGGACAAAGG - Intronic
1058704726 9:107628804-107628826 TGGGAAATACCAACGGACAATGG - Intergenic
1058712915 9:107696707-107696729 TTAAATTTACAAACGGGTAAAGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059209219 9:112496549-112496571 TGAAACATACACTCGGAAAAAGG - Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1061841182 9:133359402-133359424 TCCAATATACAAGGGGACAACGG + Intronic
1186155773 X:6724959-6724981 TTAAATAAACAAACTGGCAATGG + Intergenic
1186685182 X:11918302-11918324 TGAGATATAGAAAGGGACACAGG + Intergenic
1186812005 X:13199594-13199616 TCTCATATACAAATGGACAATGG + Intergenic
1186867136 X:13731992-13732014 TCAACTGTACAAAAGGACAAGGG + Intronic
1187756204 X:22529717-22529739 TGAAACAGACACACAGACAAAGG + Intergenic
1187803352 X:23090105-23090127 TGAAATTTACAAGGGGAAAAGGG - Intergenic
1187841031 X:23488258-23488280 GCAGATATACAAATGGACAATGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1189448612 X:41105509-41105531 TAAAATATACATACAAACAATGG - Intronic
1192276249 X:69634176-69634198 TGCAATTTAGAAATGGACAAAGG - Intronic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193057068 X:77164153-77164175 TTAAATAAAGAAATGGACAAAGG + Intergenic
1193293560 X:79806975-79806997 TAAAATATAAAAACATACAATGG - Intergenic
1193714296 X:84919760-84919782 TGAAATATACAAACTACCAAAGG + Intergenic
1196407405 X:115379038-115379060 TGAAAAATATAAAAGGAGAATGG + Intergenic
1196902434 X:120398871-120398893 TGTTATATACAAAGGCACAAGGG - Intergenic
1197267818 X:124394616-124394638 AGAAATATAGAAATGTACAAAGG + Intronic
1197543864 X:127799810-127799832 TGAAAAATACAAAGGCATAAAGG - Intergenic
1198719700 X:139603093-139603115 TGAAATATACAAATGGTCCTGGG - Intronic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1199346287 X:146745255-146745277 TGAAATAACCAAAAAGACAAGGG - Intergenic
1199795646 X:151193139-151193161 TGTAATATTCAAACTGCCAAAGG + Intergenic
1199828193 X:151521155-151521177 TGAAATGAACAAAAGGGCAAGGG - Intergenic
1199828246 X:151522188-151522210 TGAAATGAACAAAGGGGCAAGGG + Intergenic
1199903497 X:152201025-152201047 TGAAATTGTCAAAGGGACAATGG + Intronic
1201549152 Y:15201072-15201094 TTAAATAAACAAACTGGCAATGG + Intergenic