ID: 1169711468

View in Genome Browser
Species Human (GRCh38)
Location 20:8569184-8569206
Sequence CATTCCTACGATGACTTTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 35}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169711468_1169711471 3 Left 1169711468 20:8569184-8569206 CCTCGAAAGTCATCGTAGGAATG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1169711471 20:8569210-8569232 GGAACTCAGAAAATATTGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 212
1169711468_1169711473 25 Left 1169711468 20:8569184-8569206 CCTCGAAAGTCATCGTAGGAATG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1169711473 20:8569232-8569254 GACACTGACTACATCTGCCACGG 0: 1
1: 0
2: 0
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169711468 Original CRISPR CATTCCTACGATGACTTTCG AGG (reversed) Intronic
907559219 1:55373436-55373458 CGTAACTACGATGACTTTCTCGG - Intergenic
917489709 1:175487710-175487732 GATTCCTACGAAGTCTTTGGTGG - Intronic
921272020 1:213479469-213479491 CATCTCTCCGATTACTTTCGAGG + Intergenic
1096361046 12:50987321-50987343 CATGCCCAAGATGACTTGCGAGG - Exonic
1114054789 14:18958385-18958407 CATTCCTGTGGTGACTTTTGCGG + Intergenic
1114107768 14:19443547-19443569 CATTCCTGTGGTGACTTTTGCGG - Intergenic
1116807013 14:49503779-49503801 CATTCTTACGATTACCTTCAAGG + Intergenic
1121916064 14:97837807-97837829 CATTCCCAGGATGCCTTTCCTGG + Intergenic
1146200691 17:30855426-30855448 CATTCTTATGGTGACTTTAGTGG + Intronic
1157036060 18:43975696-43975718 CATTTTTATGATGACTTTCCAGG + Intergenic
1158727315 18:59985410-59985432 CATGCCCATGATGACTTACGTGG - Intergenic
1160868894 19:1268149-1268171 CATCCCTCCGAAGACTTTCTGGG + Intronic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1163554914 19:17986421-17986443 CCTTCCTTAGCTGACTTTCGGGG + Intronic
930852395 2:55974891-55974913 CATGCCTACCATGCCTTTGGGGG + Intergenic
933314837 2:80703676-80703698 CATTCCTTCCATGCCTTTCCTGG + Intergenic
942216511 2:173725502-173725524 CATTCCCATGATGACTATTGAGG - Intergenic
1169711468 20:8569184-8569206 CATTCCTACGATGACTTTCGAGG - Intronic
1177911136 21:27033753-27033775 CATTTCCACGATCACTTACGTGG - Intergenic
1180473255 22:15680777-15680799 CATTCCTGTGGTGACTTTTGCGG + Intergenic
953084374 3:39652645-39652667 CATTCCAAGGAGGACTTTCAAGG + Intergenic
966267508 3:178063920-178063942 CATTCTTACTAGGACTTTGGTGG - Intergenic
981588171 4:146327173-146327195 CAATGCTACCATGACTTTCTGGG + Intronic
984114607 4:175664112-175664134 GATTCCAACTATGACTTTCTGGG + Intronic
995806048 5:116053419-116053441 TATTGCTAGGATGACTTTCTAGG - Intronic
1002986979 6:2199691-2199713 TATTCCTAAGATGATTTTCATGG + Intronic
1003772351 6:9319447-9319469 CCTTCCTAAGATGACATTTGAGG + Intergenic
1031362104 7:120858915-120858937 CATTTCTAGGATTACTTTTGTGG + Intergenic
1034853787 7:154521624-154521646 CATTTCAAAGATGACTTTAGTGG - Intronic
1038295158 8:26285323-26285345 CATTCATACCATGACATTCAAGG - Intergenic
1041715247 8:60926367-60926389 CATTCCTCTGATGGCTTTGGCGG + Intergenic
1046609356 8:116406814-116406836 CATTCCTATGATTACTTTTTAGG + Intergenic
1046809780 8:118520111-118520133 CATTCCTACTATAACTTGCTTGG + Intronic
1055254105 9:74345600-74345622 CATTCCCATGATGTCTTTCTTGG + Intergenic
1185512587 X:674473-674495 CATTCAGAGAATGACTTTCGTGG - Intergenic
1198527830 X:137519936-137519958 CATTCCTAGGCTGACATTCAAGG + Intergenic