ID: 1169716177

View in Genome Browser
Species Human (GRCh38)
Location 20:8621027-8621049
Sequence CTAGTTGATGAGTTCTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169716177_1169716180 -10 Left 1169716177 20:8621027-8621049 CCAATAAAGAACTCATCAACTAG 0: 1
1: 0
2: 1
3: 12
4: 130
Right 1169716180 20:8621040-8621062 CATCAACTAGGGAGATGCTGCGG 0: 1
1: 1
2: 0
3: 9
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169716177 Original CRISPR CTAGTTGATGAGTTCTTTAT TGG (reversed) Intronic
902561493 1:17280392-17280414 GTAGTTGATGAGGTCTTTATTGG - Exonic
906162477 1:43660670-43660692 GTAGCTGATGAGTTCTTGAAAGG + Intronic
907541791 1:55222199-55222221 CTAGTTGATATGTTATTTAAGGG + Intergenic
909322343 1:74305444-74305466 CTAGTTTCTGAGCTCTTCATGGG - Intronic
909762619 1:79311296-79311318 CTAGTTAATGAGGGCTTAATTGG - Intergenic
911695075 1:100881756-100881778 TTAATTCATTAGTTCTTTATAGG + Intronic
912189870 1:107325241-107325263 CTAGTTTTTCAGTTCGTTATAGG - Intronic
916395375 1:164381130-164381152 CTAGGTGATGATTGTTTTATAGG - Intergenic
917753373 1:178075084-178075106 CTGGTACATGAGTTCTTTTTAGG + Intergenic
921442286 1:215201633-215201655 CTATGTGATGAGTGCTGTATTGG + Intronic
924360221 1:243232566-243232588 CAAGTTGATGAGCTCTTTGAAGG + Intronic
1064967147 10:21026684-21026706 CTATATGATGATTTCCTTATGGG + Intronic
1066328145 10:34387124-34387146 CCAGTTAATGAGTTTTTAATTGG + Intronic
1066515378 10:36153449-36153471 CTAGTTGCTGAGATTTTTCTAGG - Intergenic
1066700718 10:38125100-38125122 TTAGATGATGATTTCTATATAGG + Exonic
1068850385 10:61732144-61732166 CTACTTTTTGAATTCTTTATTGG + Intronic
1069701852 10:70432635-70432657 CAAGTGCATGAGTTCTTTACTGG - Exonic
1074888855 10:117718265-117718287 CGAGTTGATGAATTCCTTATTGG + Intergenic
1078406914 11:11078402-11078424 CTAGATGATAAGTTCTTTGAGGG - Intergenic
1078512168 11:11993473-11993495 CTATTTAATGAATTCTTTCTTGG + Intronic
1080274688 11:30490495-30490517 ATAGTTGATGAATTCTTTAGGGG - Intronic
1080373707 11:31682676-31682698 CTAGACTATGAGCTCTTTATGGG - Intronic
1081458883 11:43252550-43252572 GTACTTGATGATTTCATTATTGG + Intergenic
1087915487 11:103804878-103804900 TTAGATGATGAGTTCCTTAAAGG + Intergenic
1088558237 11:111085150-111085172 TTAATTGATTAGTTTTTTATGGG - Intergenic
1088769528 11:113019764-113019786 AAAGTTAATGAGTTCTATATTGG - Intronic
1092311153 12:7355245-7355267 CTAATTGATCAATTCTTTGTGGG - Intronic
1093438694 12:19167634-19167656 CTAGGTGATGTGTTCTTTACTGG + Intronic
1093915513 12:24798053-24798075 CTAGTTAATGAGTTGTTATTGGG + Intergenic
1096551545 12:52376882-52376904 CCAGTTCATCAGTTCATTATAGG - Intergenic
1097854286 12:64445752-64445774 CTAGATCATGAGCTCCTTATGGG - Intronic
1098999853 12:77166713-77166735 ATAGTTGTTGAGTACTTTCTGGG + Intergenic
1099619498 12:84983310-84983332 TTAGGTGCTGAGTTCTTTGTGGG + Intergenic
1100053610 12:90482124-90482146 CTTGTTTCTGGGTTCTTTATGGG + Intergenic
1101099740 12:101379979-101380001 CCAGCTAATAAGTTCTTTATCGG + Intronic
1105586808 13:21752809-21752831 CTAGTTGTTGATTTCCTTAAAGG + Intergenic
1109129408 13:58562660-58562682 CTAGTTTATTATTTCTTTTTGGG + Intergenic
1112190634 13:97173996-97174018 CTAGTTTATAAGTTCTTTAAAGG + Intergenic
1116907960 14:50423998-50424020 CTTATTAATGTGTTCTTTATTGG + Intronic
1118100437 14:62594486-62594508 ATACTAGATGAGTTATTTATGGG - Intergenic
1126543631 15:49848193-49848215 TTAGTTGATGAGGTATTTTTAGG + Intergenic
1127692718 15:61413758-61413780 CTAGTTGATGTGTTCCTTTGTGG - Intergenic
1128492161 15:68158533-68158555 CTAGATTATGAGTTCTTTGGAGG + Intronic
1130397195 15:83512840-83512862 CTAGTTAATGAGTACTCTAAGGG - Intronic
1131502000 15:92977236-92977258 CCTGTTGATCACTTCTTTATTGG + Intronic
1138034024 16:53584304-53584326 TTATTTGATGAGTTCCTTATTGG + Intergenic
1140183936 16:72749675-72749697 CTAGAATATGAGTTCTTTACTGG + Intergenic
1140791739 16:78398532-78398554 ACAGTTGATGAGTTATTTTTTGG + Intronic
1142536908 17:624312-624334 CTAGTTGAAGAGATGATTATTGG - Intronic
1148166193 17:45485489-45485511 TTAGTTAATGAGGTCTTAATGGG - Intronic
1148383503 17:47218357-47218379 GTAGTTCATGAATTCTTTTTTGG + Intronic
1150288052 17:63965000-63965022 CTATTTGTTGAGTTCTTACTAGG - Intronic
1150397417 17:64832213-64832235 TTAGTTAATGAGGTCTTAATGGG - Intergenic
1151070775 17:71208452-71208474 TTAGTAGATGACTTCTTTTTTGG - Intergenic
1156989884 18:43396502-43396524 CTGGTTGTTGTTTTCTTTATTGG - Intergenic
1158019235 18:52821677-52821699 CTAGCTGAGTACTTCTTTATTGG + Intronic
1158728425 18:59996205-59996227 CTAGTCTATGAGTTCCTTAGTGG + Intergenic
1159289188 18:66394927-66394949 CTAATTCATGAGTTGTTTTTTGG - Intergenic
1160355432 18:78224307-78224329 CTTTTTGATGAGTTTTCTATGGG + Intergenic
927063001 2:19441825-19441847 CTAGATGATGAGCACTGTATTGG + Intergenic
927821689 2:26271628-26271650 CTAGTAGATGAGATTTTTAAAGG - Intronic
928807526 2:35178350-35178372 CTAGTTTATTATTTTTTTATGGG + Intergenic
934876024 2:97921601-97921623 CCATTACATGAGTTCTTTATTGG - Intronic
938215125 2:129504803-129504825 ATAGATGATGATTTCTATATGGG + Intergenic
939366774 2:141243587-141243609 ATAGTTGAATAGTTTTTTATAGG - Intronic
943527899 2:189040448-189040470 CAAGTTGCTGAGTTCTTCCTTGG - Intronic
944334803 2:198520057-198520079 CTAGCTGATGAGTTCTCTGTGGG + Intronic
944642481 2:201742494-201742516 CTGGTTGCTGATTTCTTTGTTGG - Intronic
1169600377 20:7253112-7253134 TTAGATGGTGAGTTATTTATTGG - Intergenic
1169716177 20:8621027-8621049 CTAGTTGATGAGTTCTTTATTGG - Intronic
1170591432 20:17774855-17774877 CAACTTGTTGACTTCTTTATTGG - Intergenic
1171281751 20:23906177-23906199 CTTTTTGATGTGTTATTTATTGG + Intergenic
1172526830 20:35604794-35604816 CTAGTTACTTAGTTCTTAATAGG - Intergenic
1175614474 20:60383325-60383347 CTAGTTTATGAGATTTTTAATGG - Intergenic
1181547551 22:23610753-23610775 ATAGTTGATGTGTTCTATGTGGG - Intronic
1182185079 22:28393202-28393224 CTAGATGATCAGTTCTATGTAGG + Intronic
949844983 3:8360623-8360645 CTAATTGTTAAGTTCTTTAAAGG - Intergenic
957605012 3:82387255-82387277 CTACTTTATGAGTTCGTTGTTGG - Intergenic
959387089 3:105723309-105723331 CTAGAAAATGAGTTATTTATTGG - Intronic
959650838 3:108749298-108749320 CTAGTTGGTGAGCTCTGTAAGGG + Intronic
961588018 3:127950630-127950652 CTAGTTCCTGAGTTCCTTCTGGG - Intronic
962529157 3:136262921-136262943 CTAGTTGAATACATCTTTATGGG + Intronic
963570386 3:146987442-146987464 TTAGTTGAGGAGTTTTTTGTTGG + Intergenic
964348534 3:155779743-155779765 GTAGTTGAAGACATCTTTATTGG - Intronic
964919343 3:161876991-161877013 CTAGTGTATGGTTTCTTTATAGG - Intergenic
965305292 3:167057090-167057112 GTAGATGATGAATACTTTATAGG - Intergenic
971215910 4:24661997-24662019 CTAGGTGGTGAGTTCTTGAGGGG + Intergenic
971814819 4:31474241-31474263 CTCATGGATGAGTTATTTATGGG - Intergenic
971931420 4:33088964-33088986 CTTGTTGCTGTGTTCTGTATCGG + Intergenic
972809636 4:42568547-42568569 CTATTTTATGAGTTTTTTGTTGG - Intronic
973258309 4:48135610-48135632 CTAGGTGATGAGTTTTTGATAGG + Intergenic
975377103 4:73658598-73658620 CTATTTAATGTGTTCTTGATAGG + Intergenic
975489498 4:74973410-74973432 CAAGTTGCTGAGATCTTTATGGG - Intronic
975788813 4:77925019-77925041 CTAGGTGATGAGTAGTATATGGG - Intronic
982010981 4:151106002-151106024 CTAGTTTTTAAGTTCTTTGTAGG + Intronic
982038839 4:151374645-151374667 CTAATTGATTAGTATTTTATGGG + Intergenic
983416394 4:167460640-167460662 CTACTTTTTGAGTTCTATATGGG + Intergenic
987099514 5:14579799-14579821 CTAGTTCATGAGCTCTTTGAGGG - Intergenic
988424592 5:31048882-31048904 CTAATTGTTCAGTTCTTTGTGGG + Intergenic
989243102 5:39222267-39222289 CTAGATCATGAGTTCCTTAAGGG + Intronic
990345661 5:54868662-54868684 CTTGTTGATGTGTGATTTATAGG - Intergenic
991308479 5:65208457-65208479 CTAGTGAAGGAGATCTTTATGGG + Intronic
993130723 5:83895144-83895166 TGAGTTGATAAGTTCTATATGGG - Intergenic
993596609 5:89864450-89864472 CCATTTGATGAGTTGTTTCTAGG - Intergenic
993748386 5:91631054-91631076 ATAGTTAATGAGTTCTTTTCTGG + Intergenic
996698516 5:126424687-126424709 CTAGGTGATGAGGTCTACATGGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999468514 5:151830406-151830428 CTGGGTAATGAGTTGTTTATAGG + Intronic
999667049 5:153923609-153923631 CTAGATTATGAGTTAATTATGGG + Intergenic
1003211141 6:4067879-4067901 CTAGTTAATGAGTTATGTGTTGG + Intronic
1003455958 6:6282508-6282530 ATAGTTAATAAGTACTTTATAGG - Intronic
1004252007 6:14030556-14030578 CTAGTGGATGTGTTTTTTGTTGG - Intergenic
1005919602 6:30388618-30388640 TTAATGGATGAGTTCTTTAGTGG - Intergenic
1006817627 6:36863463-36863485 GTAGTTGCTGAGTTCTTTAAAGG - Intronic
1010867201 6:80991943-80991965 CCATTTGATAAGGTCTTTATGGG - Intergenic
1011357044 6:86481946-86481968 CTAGTTTAAGAGTTATTTAAAGG + Intergenic
1011452357 6:87507624-87507646 TTAGTTGATAAGTACTTCATTGG + Intronic
1011545073 6:88474414-88474436 CCATTTGATGAGTTTTTTAATGG + Intergenic
1011953222 6:92993908-92993930 ATAGATATTGAGTTCTTTATTGG - Intergenic
1016636520 6:146298418-146298440 CTATTGGATGAGTTCACTATGGG + Intronic
1017178169 6:151524428-151524450 CATGTTCATGAATTCTTTATTGG - Intronic
1018301289 6:162405464-162405486 CTAGATGATGAGTTCCTTGGAGG - Intronic
1018877253 6:167833613-167833635 CTAGTTCCTGATTTTTTTATAGG + Intronic
1019753957 7:2754368-2754390 CTAGATAATGAGTCCTTTGTCGG + Intronic
1021873783 7:25029492-25029514 CTTATTGATGATTTCTTTTTAGG - Intergenic
1031676567 7:124618456-124618478 CCAGTTCATGAGTTCATAATAGG - Intergenic
1034146765 7:148880360-148880382 ATAATTCATGAGTTCTTTATTGG - Intronic
1039147741 8:34468004-34468026 ATGGTTGGTGAGTTATTTATGGG - Intergenic
1039281656 8:35992167-35992189 CAAGTCTATGTGTTCTTTATAGG + Intergenic
1039664231 8:39505309-39505331 CTCATTTATGAGTTCTTCATTGG - Intergenic
1040603288 8:48905442-48905464 CTAGATGATGAATTCCTTAAGGG - Intergenic
1042739510 8:72027591-72027613 CTGGGAGATGGGTTCTTTATGGG - Intronic
1051973339 9:22918486-22918508 CTAGTTGAAGAGGACCTTATAGG - Intergenic
1054836407 9:69678989-69679011 ATATTTGATGAGTTCTTCCTGGG - Intergenic
1056082991 9:83116262-83116284 CAATTTGATGAGGTCTTTATTGG + Intergenic
1057882942 9:98807316-98807338 CTAGTTGATGGTTGTTTTATTGG + Intergenic
1058451733 9:105103252-105103274 ATAGTTCATGAGTTCTCTAAGGG - Intergenic
1187623126 X:21080795-21080817 CTAGTTGATGGGATATTTTTGGG + Intergenic
1190853444 X:54268917-54268939 ATAGTTTATGAGTTATTTGTGGG - Intronic
1191600431 X:62999535-62999557 CTAATTGAGGAGATCTCTATTGG + Intergenic
1192006164 X:67215416-67215438 CTAGTTGTTAAATCCTTTATAGG - Intergenic
1193270365 X:79522238-79522260 CTATTTGAGGAGTTTTTTTTTGG - Intergenic
1197986651 X:132272868-132272890 CTAGATGATGAGTACATTGTGGG - Intergenic
1199187605 X:144935107-144935129 TCAGTTCATGAGTTCTTTATAGG + Intergenic