ID: 1169716754

View in Genome Browser
Species Human (GRCh38)
Location 20:8628130-8628152
Sequence CTCTAGGCCATTTGTGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169716746_1169716754 21 Left 1169716746 20:8628086-8628108 CCAGAAATTGTCTCTCCACTACC 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1169716754 20:8628130-8628152 CTCTAGGCCATTTGTGGAATGGG 0: 1
1: 0
2: 0
3: 8
4: 124
1169716749_1169716754 6 Left 1169716749 20:8628101-8628123 CCACTACCTCTGGGCAAGTTGCT 0: 1
1: 0
2: 2
3: 15
4: 195
Right 1169716754 20:8628130-8628152 CTCTAGGCCATTTGTGGAATGGG 0: 1
1: 0
2: 0
3: 8
4: 124
1169716750_1169716754 0 Left 1169716750 20:8628107-8628129 CCTCTGGGCAAGTTGCTTCATCT 0: 1
1: 1
2: 9
3: 66
4: 421
Right 1169716754 20:8628130-8628152 CTCTAGGCCATTTGTGGAATGGG 0: 1
1: 0
2: 0
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169716754 Original CRISPR CTCTAGGCCATTTGTGGAAT GGG Intronic
903070548 1:20724958-20724980 CTCTTGGCCATTCCTGGAAGAGG - Intronic
903745823 1:25586002-25586024 CTCTGGGCCATCTGTAAAATGGG - Intergenic
904330361 1:29754501-29754523 CTTCAGGCAATTTGTGGAAGAGG + Intergenic
905743145 1:40389743-40389765 CTTTAGCCCTTTTGTGGGATGGG + Intronic
908380456 1:63593242-63593264 CTCTAGGCCTCCTGTGAAATGGG - Intronic
909911781 1:81267991-81268013 CCCTAGACTATTTGAGGAATAGG + Intergenic
911326510 1:96475080-96475102 CACTAGGCCACATGTGGGATTGG + Intergenic
912278803 1:108290581-108290603 CTCTGGGCCAATGGTGGAAGTGG + Intergenic
912289423 1:108403776-108403798 CTCTGGGCCAATGGTGGAAGTGG - Intronic
912840798 1:113037444-113037466 CTCAAGGGCATTAGCGGAATGGG - Intergenic
916259452 1:162826452-162826474 CTTTTGCCCATTTTTGGAATGGG + Intronic
916951497 1:169785063-169785085 CTCTGGGGCATTTTTGTAATAGG - Intronic
918570992 1:185992053-185992075 TTGTTGGCCATTTGTGGTATTGG + Intronic
1063523315 10:6760579-6760601 TTCTAGGCTATTTGGGGGATTGG + Intergenic
1065271723 10:24039897-24039919 CTATAGGCCACTTGTAGAGTTGG - Intronic
1066855840 10:40208590-40208612 TTCTAGGCCAATTGTAGAAAAGG + Intergenic
1066927081 10:41710619-41710641 TTCTAGGCCAATTGTAGAAAAGG + Intergenic
1067714036 10:48672707-48672729 CTCTGGGCTGTCTGTGGAATGGG - Intergenic
1069567647 10:69474351-69474373 CCCTAGGCCAGTGGAGGAATAGG + Intronic
1070603152 10:77879646-77879668 CTCCAAGCCAAATGTGGAATAGG - Intronic
1070905727 10:80071600-80071622 GCCTAGGGCTTTTGTGGAATGGG + Intergenic
1078010648 11:7570606-7570628 CTCTAGGCCCTGTTTGGAACTGG + Intronic
1079336664 11:19576112-19576134 CACACAGCCATTTGTGGAATGGG + Intronic
1087924696 11:103906207-103906229 TTTTAGGTCATTTGGGGAATGGG - Intergenic
1088024667 11:105163454-105163476 CTCCAGGCCTCCTGTGGAATAGG + Intergenic
1088917393 11:114238060-114238082 CTGTTGGCCAGTTGTGGAACTGG + Intronic
1091789888 12:3265938-3265960 CTGTATGGCATTTGTGGAAAGGG + Intronic
1094494130 12:30978898-30978920 CTCTAGACCATTCTTGGAAGGGG - Intronic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1101195993 12:102383035-102383057 CTCAACACCATTTGTTGAATAGG + Intergenic
1101563401 12:105881726-105881748 CTCTAGGTCATTTCTGGGATGGG - Intergenic
1106225187 13:27780367-27780389 CCCTGGGCCCTTTCTGGAATGGG + Intergenic
1106649953 13:31679515-31679537 CTCAAGGTCATCTGTGTAATGGG - Intergenic
1107318080 13:39155714-39155736 CTCTAGTCCATATCTGAAATGGG + Intergenic
1108393431 13:49970709-49970731 CCCTAGGCCATTTGAGTTATAGG + Intergenic
1111823175 13:93237798-93237820 CTCAGGACCATTTGTTGAATAGG + Intronic
1114746933 14:25158552-25158574 CTCTGCACCATTTATGGAATAGG + Intergenic
1116809425 14:49524981-49525003 CTCTAGGCCATTTAAGGAGGAGG + Intergenic
1117582352 14:57164695-57164717 CTGCAGGCCATTCCTGGAATGGG + Intergenic
1118342802 14:64909774-64909796 CTCTACTCCATCTGTGAAATGGG + Intergenic
1120057903 14:79947249-79947271 CTTTAGGCCATTTATGGAGTTGG - Intergenic
1124176287 15:27427435-27427457 TTCTAGGCCCTTTGTAAAATGGG + Intronic
1124618090 15:31256945-31256967 CTCTAGCCCAGTGGTGCAATGGG + Intergenic
1124721705 15:32116348-32116370 CTCTGCATCATTTGTGGAATGGG + Intronic
1124811174 15:32940190-32940212 CTCTTGGCCAGCTGTGGAATGGG + Intronic
1125070385 15:35546696-35546718 CTCTAGGCCCTCTGTGGCTTTGG + Intergenic
1126283853 15:46988111-46988133 GTCTAGGCTGTTTGTGGATTGGG - Intergenic
1128261873 15:66238263-66238285 CTCTGGGGCATCTGTGGACTGGG - Intronic
1129156301 15:73720339-73720361 ACCTAGGACATTTTTGGAATGGG + Intergenic
1130248147 15:82272864-82272886 CTCTAGTACTTTTGAGGAATGGG + Intronic
1133887131 16:9840704-9840726 CTCTGTGCCCTTTGTGGAAACGG - Exonic
1134537646 16:15039428-15039450 TTATATGCCATTTGAGGAATGGG - Intronic
1138946379 16:61855617-61855639 TTCTTGGCCATTTGTTCAATTGG - Intronic
1140060327 16:71564017-71564039 CTCTGAGCCATTTGTGGACTAGG + Intronic
1146591501 17:34131646-34131668 CTCTAGAGCATTTGTGGACAGGG - Intronic
1150577022 17:66439522-66439544 GCCTATGCCATTTGTGGAAATGG - Intronic
1152253384 17:79223489-79223511 CTCCAGGGCATGTGTGGAAGTGG - Intronic
1153597605 18:6743825-6743847 CTCTATGCCATATGTGATATTGG + Intronic
1155184625 18:23376506-23376528 CTCTAGGTCATTTGTGTGTTGGG - Intronic
1155837311 18:30602095-30602117 CTGCAGGCCATTGCTGGAATTGG + Intergenic
1156073625 18:33244717-33244739 CTCTCTGCCATTTGTGGTAGAGG - Intronic
1159677518 18:71304270-71304292 CTCTAGTCTATTTGTGGTACTGG + Intergenic
1160981045 19:1816790-1816812 CTCCAGGCCATATGTGGTGTAGG + Exonic
1165798661 19:38534447-38534469 CTCCAGGCCATCTGTGAACTTGG - Intronic
939863371 2:147445035-147445057 TTCTGGGCCCTTTCTGGAATGGG - Intergenic
942176295 2:173337903-173337925 GTCTGGGCCATGTGGGGAATGGG - Intergenic
942232243 2:173871308-173871330 CTCCAAACCATTTGTTGAATAGG + Intergenic
942947372 2:181684554-181684576 CTCTAAGCGATTTGTGGGGTTGG - Intergenic
946140659 2:217687981-217688003 CTCCAAGCCATTTGTGGATTCGG - Intronic
946881673 2:224182815-224182837 CTCTGGGCCATTTGTGTCACAGG - Intergenic
1169716754 20:8628130-8628152 CTCTAGGCCATTTGTGGAATGGG + Intronic
1170901597 20:20468698-20468720 CTCTGGGCCATTTGAAGAAATGG - Intronic
1171911376 20:30961028-30961050 TTTAAGGCCATTTGTGGAAAAGG - Intergenic
1173161459 20:40655680-40655702 CTCTAGGCCATCTGTGAATAGGG - Intergenic
1175110771 20:56646428-56646450 CTCAGGGCCATGTGTGGATTGGG + Intergenic
1176923568 21:14719252-14719274 CTCTAGGCCATTGTTGAAAAGGG + Intergenic
1182946985 22:34333334-34333356 CTGGAGGCCACATGTGGAATTGG - Intergenic
1184588478 22:45463910-45463932 CTCTAGGCCTGTTGTGGGAGGGG + Intergenic
949251564 3:1991008-1991030 CTATAGGCGATGAGTGGAATTGG - Intergenic
952919775 3:38276469-38276491 CTGTCAGCTATTTGTGGAATGGG - Intronic
955442064 3:58966939-58966961 CTGTAGATCATTTGTGGAGTGGG - Intronic
959209244 3:103355622-103355644 CTCTAAGCCATTTGTATATTTGG + Intergenic
960145372 3:114195092-114195114 CTTTAGGCCTTTTGGGGAACAGG + Intronic
961057363 3:123800289-123800311 TTCCAGGCCAGATGTGGAATTGG - Intronic
964370435 3:155994540-155994562 CTTTATTCCATTTGTGAAATTGG + Intergenic
965013781 3:163130166-163130188 CTCTGCTCCATTTGTTGAATAGG - Intergenic
965564696 3:170102383-170102405 CTCTAGCCCTTTTGTGCAAAAGG + Intronic
966322700 3:178718658-178718680 CTCTAGACCATGTGTTGAGTCGG + Intronic
967028130 3:185582292-185582314 TTCTAGGCCATTTGTTGGAAAGG - Intergenic
967321192 3:188196972-188196994 TTTTAGGCCATTTGTTGAACTGG + Intronic
968734786 4:2289788-2289810 CTCCAGGACACTTGTGGACTTGG + Intronic
968735833 4:2296144-2296166 CTCTAGGCCAGCTGTGAATTGGG + Intronic
974746069 4:66078138-66078160 CTCAAGGCCATTTATTGAAAAGG - Intergenic
974871666 4:67651841-67651863 TTCTAGCCCATTTGTTGAAAAGG - Intronic
982839318 4:160162061-160162083 CTCTAGGCCAATTGTGATATGGG + Intergenic
982951019 4:161696191-161696213 CTCAACACCATTTGTTGAATAGG + Intronic
992851171 5:80809966-80809988 CTCTACGACATTTGTGTGATGGG - Intronic
993016830 5:82544208-82544230 CTCTAGGCCTTTGATGGAAAAGG - Intergenic
994009677 5:94886131-94886153 CTATAGGCTTTTTGTGGAAAGGG + Intronic
997868513 5:137486368-137486390 CTCTGGGCCATTTGCAGAGTAGG + Intronic
1005366246 6:25080628-25080650 TTCTTGGCCTTTTCTGGAATTGG + Intergenic
1006060156 6:31413222-31413244 CCCTGGGCCATTTGAGGAGTGGG + Intronic
1011739035 6:90341046-90341068 TTCTAAGCCTTTTGTAGAATTGG - Intergenic
1011923591 6:92613849-92613871 CTCAACACCATTTGTTGAATAGG + Intergenic
1014315607 6:119860958-119860980 CTCTAGGCCCTTTGTCGAGCTGG - Intergenic
1017183847 6:151580248-151580270 CGCTATGTCATTTGTGGTATAGG + Intronic
1018690278 6:166338970-166338992 TTCTAGGCCAGTTGAGGAGTTGG - Intronic
1018994786 6:168702444-168702466 CTCTGTGTCATTTGTGGATTTGG + Intergenic
1019498937 7:1354881-1354903 CTCTGGGCCATTCGTGCAATGGG - Intergenic
1019862342 7:3671058-3671080 CTCTAGGCCCTTGGAGGACTGGG + Intronic
1024572371 7:50733881-50733903 CTCAAGGCCTTCTGTGGATTGGG - Intronic
1025315516 7:58021324-58021346 TTCTAGGCCTTTTGTAGAAAAGG + Intergenic
1025570893 7:62564937-62564959 ATTTAGGCCAATTGTGGAAAAGG - Intergenic
1026976192 7:74500185-74500207 CTCAAGGTCATTTGTGGCAGCGG - Intronic
1028319191 7:89438548-89438570 CTGAAGGCCACATGTGGAATTGG + Intergenic
1034892801 7:154855518-154855540 ATCTGGGCCATTTGAGCAATGGG + Intronic
1035602911 8:907678-907700 ATCTATGCCGTTTCTGGAATGGG - Intergenic
1037525098 8:19716846-19716868 CTCTATGCTATTTGTGTATTTGG - Intronic
1038252951 8:25923235-25923257 CTCTGGGCCATTTCTGGGAGTGG - Intronic
1038853875 8:31309281-31309303 CTTAAAGCCATTTGTGAAATGGG + Intergenic
1039706172 8:40009802-40009824 CTCTTGGCCATTTGAGACATTGG + Intronic
1040140825 8:43909917-43909939 CTTTAAGCCAATGGTGGAATAGG + Intergenic
1041512590 8:58668142-58668164 CTCTGGGCCATCTCTAGAATTGG + Intergenic
1057807015 9:98226609-98226631 CTGAAGTTCATTTGTGGAATGGG + Intronic
1061673054 9:132200028-132200050 CCCTGGGCCATCTGTAGAATGGG + Intronic
1187393323 X:18900112-18900134 CTCTGGGCAACATGTGGAATCGG + Intronic
1190817093 X:53938543-53938565 TTCTAGGCCACTTCTGGAAATGG + Exonic
1193508548 X:82372112-82372134 CTGGAGGCCATGTGTAGAATTGG - Intergenic
1193522248 X:82545372-82545394 TTCTAGCCCATTTGTTGAATAGG - Intergenic
1197094342 X:122575072-122575094 CTCTAGGCCTTTAATGGAAGGGG + Intergenic
1197622717 X:128768813-128768835 CTTTAAGCCAGTTGTGTAATGGG - Intergenic
1198694064 X:139317010-139317032 CTATATTCCATTTGTGGGATTGG - Intergenic
1199871521 X:151902686-151902708 CCCTATGCCAGTTGTGGAAAAGG + Intergenic