ID: 1169717441

View in Genome Browser
Species Human (GRCh38)
Location 20:8636160-8636182
Sequence GCACATGTATTCTACCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169717441 Original CRISPR GCACATGTATTCTACCTGCA AGG (reversed) Intronic
900827960 1:4941598-4941620 GTGCATGTATTATACCTGCCTGG - Intergenic
901748549 1:11391080-11391102 GCACATGTCTTCTATGAGCAAGG + Intergenic
909429419 1:75569609-75569631 ATACGTGAATTCTACCTGCAAGG - Intronic
909933476 1:81525177-81525199 GCACATATTTTCTAACTGAAGGG + Intronic
910840592 1:91557292-91557314 GCACATGCATGCTTCCTGAAAGG + Intergenic
921417936 1:214912298-214912320 GTGCCTGTATTCTAACTGCAAGG - Intergenic
924243031 1:242057910-242057932 GCTGATGTAATCTCCCTGCAGGG + Intergenic
1064748659 10:18503177-18503199 GCATGTGCATTCTGCCTGCAGGG + Intronic
1065577888 10:27141855-27141877 AGACATGTTTTCTACCTTCATGG - Intronic
1066782299 10:38965655-38965677 GAACATGTGTTCCACCTGAATGG - Intergenic
1066951102 10:42117434-42117456 GAACATGTGTTCCACCTGAATGG + Intergenic
1075588447 10:123674302-123674324 GCAGGTGTGTTTTACCTGCAAGG - Intronic
1081277515 11:41168101-41168123 GCATATATATCCCACCTGCAGGG + Intronic
1084400686 11:68941239-68941261 GGACAGGTGTTCTTCCTGCAGGG + Intergenic
1086446535 11:86876972-86876994 TAACCTGTCTTCTACCTGCACGG + Intronic
1087548881 11:99621036-99621058 ACACATAAAGTCTACCTGCATGG + Intronic
1087606326 11:100382794-100382816 GGAAATGTCTTCTACCTGCAAGG - Intergenic
1087629989 11:100638374-100638396 GCAAATGTATTCTTCCATCAAGG + Intergenic
1095355238 12:41265250-41265272 GGACATATATTTTACATGCATGG + Intronic
1095617866 12:44213957-44213979 TCACATGTATACTATTTGCAAGG + Intronic
1097875946 12:64643405-64643427 GCACCTGTAGTCCAGCTGCATGG + Intronic
1098315033 12:69184008-69184030 GCACATGTAGTCAAGCTTCATGG + Intergenic
1099533924 12:83822759-83822781 GCACATTCATACTATCTGCAAGG + Intergenic
1102241971 12:111330100-111330122 TCACATGGATGCTACCTGAATGG + Intronic
1119981738 14:79089169-79089191 GTACATGTCTCTTACCTGCATGG - Intronic
1120879305 14:89402548-89402570 TCACATGACTTCTAGCTGCAAGG - Intronic
1124203252 15:27696580-27696602 GCACATGTTCTCTACCCACATGG - Intergenic
1125182753 15:36896095-36896117 TCACATGTATTTTAGCAGCATGG + Intronic
1125388744 15:39168818-39168840 GCACCTGTATTTTATCTGCATGG + Intergenic
1126941048 15:53765881-53765903 ACCCATGTATACTACCTGCTTGG + Intergenic
1128710999 15:69872005-69872027 GTAGTTGTCTTCTACCTGCAGGG - Intergenic
1131629760 15:94164389-94164411 GTTTCTGTATTCTACCTGCAGGG + Intergenic
1136939264 16:34505526-34505548 GAACATGTGTTCCACCTGAATGG + Intergenic
1136960555 16:34843035-34843057 GAACATGTGTTCCACCTGAATGG - Intergenic
1137219484 16:46433034-46433056 GAACATGTGTTCCACCTGAATGG + Intergenic
1144262424 17:13535272-13535294 ACATATGTATTTTCCCTGCAAGG + Intronic
1145326742 17:21837790-21837812 GAACATGTGTTCCACCTGAATGG - Intergenic
1145693578 17:26769237-26769259 GAACATGTGTTCCACCTGAATGG - Intergenic
1150145936 17:62769505-62769527 GCACAAGAATTGAACCTGCAGGG - Intronic
1152231209 17:79115000-79115022 TCACTTGTAATCTACCTGCTTGG - Intronic
1203190928 17_KI270729v1_random:188396-188418 GAACATGTGTTCCACCTGAATGG - Intergenic
1153623473 18:7001969-7001991 GCATATGTATCCAATCTGCATGG - Intronic
1154516278 18:15169388-15169410 GAACATGTGTTCCACCTGAATGG + Intergenic
1155931524 18:31713773-31713795 TCCCATGTATTTTACCTGCCTGG - Intergenic
1156882373 18:42095877-42095899 AGACATGTTTCCTACCTGCATGG + Intergenic
1157788420 18:50507540-50507562 GCACATGTATTGTTGCTGAAGGG - Intergenic
1158432342 18:57400721-57400743 ACCTATGTATTCTACCTGCTGGG - Intergenic
1159102902 18:63974863-63974885 GCACATGTATTGTGGCTGCAGGG + Intronic
1159156219 18:64586738-64586760 CCTCATGTATTCTAGCTACAAGG - Intergenic
1161240140 19:3218411-3218433 GCTCATGTTTTCCACCTTCATGG - Intergenic
1164607031 19:29606735-29606757 GCACATGTCTTCTACCCCTAAGG - Intronic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
1168397172 19:56058232-56058254 CCACATGCCTTCAACCTGCAGGG - Exonic
924991792 2:318813-318835 GCAGATGTCTTCTACTAGCAGGG - Intergenic
926608017 2:14917026-14917048 GCCCATGGATTTTACCTACATGG + Intergenic
926674222 2:15606259-15606281 ACTCAGGTATTATACCTGCAAGG + Exonic
926799320 2:16645552-16645574 CCACATGTATTCTACCTTCAAGG + Intronic
928395629 2:30941392-30941414 TGACATGTATTATGCCTGCATGG + Intronic
929378411 2:41319132-41319154 GGTCAGGTATTCTACCTGAAGGG + Intergenic
931093469 2:58913187-58913209 GCACGGGCATTCAACCTGCACGG + Intergenic
934330949 2:92068492-92068514 GAACATGTGTTCCACCTGAATGG - Intergenic
934528228 2:95066295-95066317 ACACATGTATTTTCTCTGCAAGG + Intergenic
935467832 2:103420380-103420402 ACATAGGTATCCTACCTGCAAGG - Intergenic
938516610 2:132014393-132014415 GAACATGTGTTCCACCTGAATGG + Intergenic
938612836 2:132966772-132966794 ACACATGTATTTTATCTGTAGGG + Intronic
938964816 2:136379030-136379052 ACCCATGTTCTCTACCTGCATGG + Intergenic
939172167 2:138709058-138709080 ACACATGTATTCTAGCAGCAGGG + Intronic
940488793 2:154330220-154330242 GCACATGTTTTCTAACCACAAGG + Intronic
942836780 2:180308845-180308867 TCACCTATATGCTACCTGCAAGG - Intergenic
945768284 2:214007539-214007561 GCAGATGTTTTCTACCAGAAAGG - Intronic
1169717441 20:8636160-8636182 GCACATGTATTCTACCTGCAAGG - Intronic
1172368432 20:34367640-34367662 GCACATGTCTACTACCTACTAGG - Intronic
1173402269 20:42736203-42736225 GCCCATGTATTTTCCCTGCAGGG - Intronic
1175040527 20:56045836-56045858 GCACTTGTATCATACCAGCAAGG - Intergenic
1178881842 21:36456084-36456106 CCACATGGAGTCTACCTGCCTGG + Intergenic
1181396622 22:22627577-22627599 GCACATGTTTTCTATTTGCTGGG + Intergenic
1181646997 22:24236857-24236879 GCACATGTTTTCTATTTGCTGGG - Intronic
1181704748 22:24643134-24643156 GCACATGTTTTCTATTTGCTGGG + Intergenic
1181979445 22:26755669-26755691 CTACCTGTCTTCTACCTGCAGGG - Intergenic
1184915961 22:47569201-47569223 GCACACGTATTCCCCCTGCAAGG + Intergenic
1185204957 22:49532478-49532500 TCACAGGTTTGCTACCTGCAAGG - Intronic
1203325484 22_KI270738v1_random:10517-10539 GAACATGTGTTCCACCTGAATGG + Intergenic
949179204 3:1106817-1106839 TCACATGTATTTTTACTGCATGG + Intronic
949760670 3:7466899-7466921 AAACATGGATTCTACCTTCAAGG - Intronic
951342250 3:21502409-21502431 GCACATGTATGTATCCTGCAGGG - Intronic
952778683 3:37071902-37071924 GTACATGGAATCTACCTGCAAGG + Intronic
953336252 3:42096697-42096719 TCACAGCAATTCTACCTGCAGGG - Intronic
955760107 3:62271078-62271100 GCACTTGTACTTTTCCTGCAAGG - Intronic
958486056 3:94710688-94710710 GCTCATATATTCTAGTTGCAGGG + Intergenic
960251993 3:115465738-115465760 GCTCATTTATTCTGCCTGTAAGG + Intergenic
960500499 3:118432067-118432089 GCAGAGGTCTTCTACCTACATGG + Intergenic
961456257 3:127025964-127025986 GCACATGTAAACAACCTGGAAGG + Intronic
962034963 3:131642222-131642244 GCACATGTATATTACCTTCCTGG - Intronic
963079189 3:141375591-141375613 TCACATGGATGCTGCCTGCACGG - Intronic
964513233 3:157476674-157476696 GCTCATGTATTCTACCTGCAGGG - Intronic
967099273 3:186202654-186202676 GCATATGTCTTCTACCACCAAGG - Intronic
967130319 3:186464732-186464754 GCCCATGTATTCTACCTACTGGG - Intergenic
967565873 3:190971624-190971646 ACCCAAGTATTCTACCTACAGGG + Intergenic
968498757 4:933648-933670 GCTCATGTATGTTACCTGCCTGG + Intronic
968683207 4:1936234-1936256 GCTCACGTCTTCTACATGCATGG - Intronic
968844018 4:3029715-3029737 GCACATGTGTCCTCCCTGCTGGG - Intronic
971518602 4:27520147-27520169 GCACATGTATTCTACAGGTTTGG + Intergenic
971654546 4:29326270-29326292 TCACATGTATTGTAATTGCAGGG + Intergenic
972637254 4:40895397-40895419 GCACATGTATACACACTGCAGGG + Intronic
974577550 4:63747452-63747474 GCAACTTTATTCTACTTGCAAGG + Intergenic
975248773 4:72152564-72152586 GCACCTGTGTTCTTCCTGCCAGG + Intergenic
977868421 4:102059414-102059436 ACACATGTCTGCTACCTGCCTGG - Intronic
981433736 4:144693717-144693739 ACACATTTATTCTATCTGAATGG + Intronic
982244571 4:153338110-153338132 GCAAGTGTGTTCTAGCTGCATGG - Exonic
983793204 4:171825060-171825082 GAACATGTATTCTGCCCTCAGGG + Intronic
986023936 5:3832076-3832098 TCACTTGTATTCTGCATGCAGGG - Intergenic
986886836 5:12248632-12248654 GAACATGTATTCTACTTTTAGGG + Intergenic
987539117 5:19230706-19230728 CAACATGCATGCTACCTGCAGGG + Intergenic
990684657 5:58287999-58288021 GCAAATGCATTTTAGCTGCAAGG - Intergenic
991295589 5:65076684-65076706 GCACATGTATTTCCCCTGCTTGG - Intergenic
991955353 5:71988806-71988828 ACACATGTATTCTTCCTGTTGGG - Intergenic
994604355 5:101948217-101948239 GTACATTTATTCTACCTTCATGG - Intergenic
994795981 5:104300220-104300242 CCACAGCGATTCTACCTGCATGG - Intergenic
1002692043 5:181056760-181056782 GCACATGGAATCTCACTGCATGG - Intronic
1007581325 6:42961894-42961916 GCACACGTATTTTAACTTCAAGG + Intronic
1009299113 6:61992372-61992394 GCACATTTCTTCTTCTTGCAAGG + Intronic
1013589654 6:111609384-111609406 GCACTTGTGTTCTTCCTACAGGG - Intergenic
1016980525 6:149849881-149849903 AGACAGGTATTCAACCTGCAAGG - Intronic
1016987288 6:149905008-149905030 GCACATGGACTCAGCCTGCAGGG + Intergenic
1028230868 7:88305321-88305343 CTGCATGTATTCTACCTGCATGG - Intronic
1028293507 7:89097961-89097983 GAATATGTATTTTACCTGCTAGG - Intronic
1030312647 7:108083729-108083751 GCCCATGTATTCTATCTGTTAGG - Intronic
1031811447 7:126374572-126374594 GCACATGTATTCCCACTGCAAGG - Intergenic
1036020735 8:4842580-4842602 GCACATGTATCCCTGCTGCAGGG + Intronic
1037136876 8:15473364-15473386 TGACATGTATTCTACTAGCAAGG - Intronic
1039608800 8:38902744-38902766 TGACATGTATTATACATGCAAGG + Intronic
1048427245 8:134334160-134334182 GGACATGTAGTCCATCTGCATGG - Intergenic
1048479909 8:134779862-134779884 CCACATTTATCCTACCTTCAGGG - Intergenic
1052431753 9:28375679-28375701 ACCCATGTATTCTACCTGTTGGG - Intronic
1053945564 9:43306561-43306583 GAACATGTGTTCCACCTGAATGG - Intergenic
1055693563 9:78859074-78859096 CCACATGTATACTACCTGCCTGG + Intergenic
1056885978 9:90444258-90444280 GCACACAGAGTCTACCTGCACGG - Intergenic
1057864182 9:98666289-98666311 ACCCATGTATTCTACCTGTTGGG - Intronic
1058046428 9:100362466-100362488 GTACATGTTTTCTACCTGATGGG + Intergenic
1058933262 9:109743279-109743301 GCAGAAGTATTCTACATGCTGGG + Intronic
1062584354 9:137242204-137242226 ACACACGTAATCTCCCTGCAGGG + Intronic
1203588699 Un_KI270747v1:35139-35161 GAACATGTGTTCCACCTGAATGG - Intergenic
1193903220 X:87209424-87209446 ACACATGCACTCTACCAGCAGGG + Intergenic
1194967195 X:100302113-100302135 GCACATGGCTTCTATCTTCAGGG - Intronic
1196772060 X:119304090-119304112 CTCCATGTCTTCTACCTGCAAGG + Intergenic
1197656727 X:129124917-129124939 TCCCATGTCTTCTACCCGCAAGG + Intergenic
1197673389 X:129303280-129303302 GCAACTGTATTCTACATGCTGGG + Intergenic
1198451546 X:136771113-136771135 GTACATGTCTTATACCTGCTTGG - Intronic