ID: 1169722765

View in Genome Browser
Species Human (GRCh38)
Location 20:8697148-8697170
Sequence CCTGATGAGAATTTATTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 1, 2: 2, 3: 15, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169722765_1169722769 22 Left 1169722765 20:8697148-8697170 CCCAACAATAAATTCTCATCAGG 0: 1
1: 1
2: 2
3: 15
4: 182
Right 1169722769 20:8697193-8697215 GAGTTTTGATGCTATAATCCTGG 0: 1
1: 0
2: 0
3: 13
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169722765 Original CRISPR CCTGATGAGAATTTATTGTT GGG (reversed) Intronic
908836589 1:68234353-68234375 CCTTCTGAGAATGTGTTGTTAGG - Intergenic
909707200 1:78600278-78600300 CCTGACGATAATTGATTGTTTGG + Intergenic
909996992 1:82292188-82292210 CATGCTGAGAATCTGTTGTTGGG + Intergenic
911702807 1:100974214-100974236 CCTCATGAGAAATTATCTTTTGG - Intronic
911831243 1:102553615-102553637 CCAGGTGAGAAATTATTGATGGG + Intergenic
913103817 1:115594189-115594211 CCAGACCAGAATTTATTGTGTGG + Intergenic
914734968 1:150407195-150407217 TCTGATGAGATGTTCTTGTTGGG - Intronic
914867127 1:151440631-151440653 CCTGTTAAGATTTTTTTGTTTGG - Intronic
915010534 1:152681895-152681917 CTTGAGGATAATTTATTCTTTGG + Intergenic
916775226 1:167955124-167955146 GCTGAGGAGCATTTATTGTATGG + Intronic
917435771 1:175019589-175019611 CCTGATGAGGATAGATTATTGGG + Intronic
917707556 1:177649443-177649465 CCAGAGGAGAATAGATTGTTGGG - Intergenic
919443884 1:197676793-197676815 ACTGATGAAAATTTATATTTTGG + Intronic
922093809 1:222423751-222423773 CCTGATGAGAGTTTGTTTTTTGG + Intergenic
1064124016 10:12643579-12643601 CCTGATGAGACTCTAATGTGTGG + Intronic
1066618324 10:37318792-37318814 CCTTATGTTAATTTAATGTTTGG + Intronic
1068686705 10:59877797-59877819 CCTGATGAACAATTATTGGTTGG - Intronic
1072455406 10:95571111-95571133 CCTGATTAGAATAGATGGTTTGG - Intergenic
1073699222 10:105906842-105906864 CCTTATGAGAATCTAATGTCTGG + Intergenic
1074602002 10:114924013-114924035 ACTCATAAGCATTTATTGTTGGG + Intergenic
1074939865 10:118223824-118223846 CATGATGAGAATGTTTTGCTGGG + Intergenic
1075505713 10:123019972-123019994 GCTGAATAGAATTTATTGTGAGG + Intronic
1077780058 11:5317782-5317804 CCTCATGAGAATCTGTTTTTTGG + Intronic
1080119012 11:28654589-28654611 CCTGACCAGAATGTATTATTCGG + Intergenic
1081297457 11:41409503-41409525 CATTATGAGAATTTACTATTGGG + Intronic
1082232383 11:49783289-49783311 AATCATGAGAATTTATGGTTTGG - Intergenic
1085359563 11:75874569-75874591 CTTCATGTGGATTTATTGTTAGG + Intronic
1085775012 11:79357766-79357788 ATTGATGACAATTTATTTTTTGG + Intronic
1086618250 11:88850666-88850688 AATCATGAGAATTTATGGTTTGG + Intronic
1088099255 11:106136477-106136499 ACTGATCACAATTTATTATTAGG - Intergenic
1089976119 11:122732839-122732861 ATTGATTAGAATCTATTGTTTGG - Intronic
1092928111 12:13290539-13290561 CCTGAAGAGACTTGATTGCTGGG + Intergenic
1093943691 12:25083866-25083888 CCTGATTAGAACATATCGTTAGG - Intronic
1096787782 12:54027486-54027508 GTTGGTGAGAATTTATTATTTGG - Intronic
1097234027 12:57527826-57527848 CCTGTTGAGAAATTATAGTCAGG - Exonic
1098823736 12:75267610-75267632 CATGATTAGAATTTATTCCTAGG + Intergenic
1098881091 12:75918356-75918378 CCTCATGAGTGTTCATTGTTGGG + Intergenic
1098971317 12:76859947-76859969 CCTGATGCGAATTCAGTGTGTGG - Intronic
1099438329 12:82669673-82669695 CCTTATGAGAATCTAATGCTTGG - Intergenic
1108119774 13:47172201-47172223 CCTTATGAGAATCTAATGCTTGG - Intergenic
1108493073 13:51000357-51000379 CCTGATGAGTAATTATTGGATGG - Intergenic
1108927103 13:55764554-55764576 CCTAATGTCAATTTCTTGTTTGG - Intergenic
1112110543 13:96292696-96292718 CCTAATGAGAATTCATTGTAAGG + Intronic
1112222663 13:97506833-97506855 CCTTATGAGAATCTAATGTCTGG + Intergenic
1115404849 14:33003176-33003198 ACTGATAAGTATTTATTTTTTGG - Intronic
1115929412 14:38474122-38474144 AATAATGATAATTTATTGTTAGG + Intergenic
1116087766 14:40263222-40263244 CCTTATGAGAATCTAATGTCTGG - Intergenic
1116280838 14:42904831-42904853 CCTGCTGAAACTTCATTGTTGGG - Intergenic
1118245561 14:64106830-64106852 TACAATGAGAATTTATTGTTAGG + Intronic
1118245565 14:64106882-64106904 CATAACTAGAATTTATTGTTAGG + Intronic
1118622435 14:67625804-67625826 CCTGATAAGATTCTAGTGTTCGG + Intronic
1119952663 14:78761605-78761627 CCTGATAAGAGTTTATAGATGGG - Intronic
1120796799 14:88642544-88642566 CATGATGAGAATAGATGGTTTGG - Intronic
1131588631 15:93723271-93723293 TCTGATGTGTGTTTATTGTTTGG + Intergenic
1134057181 16:11177962-11177984 CCTGATGATAAATACTTGTTTGG - Intronic
1140976641 16:80065866-80065888 CCTGTTGAGAATTCAGTGCTAGG + Intergenic
1141764645 16:86050436-86050458 CGTGCTGAGAGTTTATTCTTTGG + Intergenic
1141765477 16:86055919-86055941 CCTGATGAAGATTCATTGATAGG + Intergenic
1141834035 16:86526599-86526621 CCTGGTGAGATTTTGCTGTTCGG + Intergenic
1143968058 17:10771108-10771130 CTTGATGAGTATTTATTGAATGG + Intergenic
1144613868 17:16751041-16751063 TCTGGTGAGAATTTATAGCTGGG + Intronic
1144898843 17:18564625-18564647 TCTGGTGAGAATTTATAGCTGGG - Intergenic
1145112923 17:20180287-20180309 GCTGATGAGTATTTACTGTGGGG - Intronic
1145133531 17:20381093-20381115 TCTGGTGAGAATTTATAGCTGGG + Intergenic
1150981869 17:70151448-70151470 CCTTATGAGAATTTAGGGATAGG + Intergenic
1151742275 17:75991711-75991733 CCTGATGAGACATTGCTGTTGGG - Intronic
1155947398 18:31870851-31870873 GATGAAGATAATTTATTGTTTGG - Intronic
1156724325 18:40109836-40109858 GCTGATGAGAATTTACATTTAGG - Intergenic
1159112354 18:64074017-64074039 CCTGATGAGAATGTATTTTCTGG - Intergenic
1159594198 18:70367162-70367184 TCTGATGAGAATTTATGGTTTGG - Intergenic
1161944458 19:7426520-7426542 AATGATGAGAATTTACTCTTAGG + Intronic
1163245172 19:16088958-16088980 CCTTTGGAAAATTTATTGTTGGG + Intronic
1163280986 19:16317619-16317641 CCTGATGATGATTTGTTTTTTGG - Intergenic
1163483223 19:17570956-17570978 ACTGATGACACTTTATTGATGGG - Intronic
1164775436 19:30849780-30849802 CCTGATGAGTCTTTAGTGGTGGG + Intergenic
1166584879 19:43936957-43936979 TCTCATGAGACTTTATGGTTTGG - Intergenic
1167436787 19:49483414-49483436 TCTGATAAAAATTTATTGTCTGG - Intronic
925588320 2:5485311-5485333 CCTGAGGAGAAAATATTGCTCGG - Intergenic
926380848 2:12287704-12287726 CCAAATGAGAATTTGTTTTTGGG + Intergenic
926629779 2:15125829-15125851 CCAGATGAGACTTTAGTCTTTGG + Intergenic
928276422 2:29904857-29904879 CCTGATGATAATTGAGTGTGAGG + Intronic
928503553 2:31924700-31924722 CCAGATGACATTTTATTCTTTGG - Intronic
929420303 2:41783624-41783646 TCTGATTAGTATTGATTGTTGGG - Intergenic
929847308 2:45542842-45542864 CCTGAACAGTATTCATTGTTTGG - Intronic
931056443 2:58477628-58477650 CCTGATGCGTATATATTGTTGGG + Intergenic
932083137 2:68733319-68733341 CTTGATGAGAATATATTTTGTGG + Intronic
932886894 2:75556763-75556785 CCTTATGAGAATCTAATGTTTGG - Intronic
937194738 2:120143198-120143220 CTTGATTAGAATTTAGAGTTGGG - Intronic
940192084 2:151052272-151052294 CCTGATGATAAATCATTGCTTGG - Intergenic
940697985 2:157003660-157003682 GGTGATGAGAATTTATGTTTTGG + Intergenic
941247569 2:163119281-163119303 CCTGAACAGAATACATTGTTGGG + Intergenic
942145981 2:173026652-173026674 CCAGATGACAATTTATGATTGGG + Exonic
942909018 2:181219172-181219194 CCTGAAGAGTATGTTTTGTTTGG - Intergenic
943710234 2:191085102-191085124 CTTTATTAGATTTTATTGTTTGG + Intronic
946631019 2:221669220-221669242 CTGGATGAGAATTTTTTGTTGGG + Intergenic
947172129 2:227322478-227322500 TCTGATGTGCATTTATGGTTTGG + Intergenic
1169722765 20:8697148-8697170 CCTGATGAGAATTTATTGTTGGG - Intronic
1170232035 20:14059646-14059668 CCTGATGAGGTTTCATTTTTTGG + Intronic
1175109103 20:56633666-56633688 CCCGATTAGAATTCAGTGTTAGG - Intronic
1177488054 21:21784180-21784202 CATGATGATGATTTACTGTTAGG + Intergenic
1178039062 21:28619326-28619348 CCTTATGAGAAGTTATTTTCTGG + Intergenic
1184485673 22:44777394-44777416 GATCATGAGATTTTATTGTTGGG - Intronic
951397702 3:22190001-22190023 CCTGATGTGTTTGTATTGTTTGG + Intronic
952225330 3:31369628-31369650 AATGATGAGAAGTTAATGTTGGG - Intergenic
952656478 3:35792509-35792531 CCTGATAAGAAGACATTGTTGGG - Exonic
952815130 3:37441138-37441160 CATTCTGAGAATGTATTGTTAGG - Intergenic
953857981 3:46516360-46516382 CCTGTTGAGAATAAAATGTTTGG + Exonic
954219733 3:49145678-49145700 TGTGGGGAGAATTTATTGTTTGG - Intergenic
955075586 3:55610136-55610158 CCTGATGACAAATAATTGTCTGG - Intronic
955470091 3:59277804-59277826 CCTGATAAGAATTTATTGTTTGG - Intergenic
955509742 3:59667606-59667628 TCTTTGGAGAATTTATTGTTTGG + Intergenic
956547553 3:70421495-70421517 CCTGATTAGATTTTATTTGTAGG - Intergenic
957775545 3:84753898-84753920 CCTGATGAGAATGTAATGTTGGG - Intergenic
957821977 3:85388317-85388339 GAGGATGAGAATTAATTGTTTGG + Intronic
960286458 3:115835427-115835449 CCAGAAGAGAATTTAATCTTAGG - Intronic
965107871 3:164381091-164381113 CCAGATGTGAAGTTATTATTTGG + Intergenic
967009747 3:185421665-185421687 CCTCATGGGAACTGATTGTTTGG - Intronic
967703357 3:192620447-192620469 CCTGCTGAGAATTATTTGCTTGG + Intronic
968215298 3:196884395-196884417 CCTGAGGGGAAGTTATTGTTTGG - Intronic
969851611 4:9961741-9961763 TCTGATGATAGTTTTTTGTTTGG - Intronic
971500598 4:27314183-27314205 ACTGATGGGAATTTATTTTCAGG - Intergenic
973042364 4:45486400-45486422 CCAGATGAGAAATGATGGTTTGG - Intergenic
973306316 4:48655252-48655274 CCTGATTTGAATTTACTTTTTGG - Intronic
973832709 4:54778236-54778258 TCTGATGAGAGTGTATTGTAAGG + Intergenic
976006660 4:80438562-80438584 TCAGATGAGAATTTATTTTATGG - Intronic
976660339 4:87534205-87534227 CCTGATGAAAATCTATTTTCTGG - Intergenic
976678240 4:87726383-87726405 CCAGATGGAAATATATTGTTTGG + Intergenic
978696906 4:111592461-111592483 CTTGATGAGCCTTTATGGTTTGG - Intergenic
979269019 4:118737467-118737489 CCTGCTGAGGATTTACTTTTAGG + Intronic
979413019 4:120402461-120402483 TCTTATAATAATTTATTGTTTGG + Intergenic
979968372 4:127105006-127105028 CTTCATGAGGATTTATTTTTAGG + Intergenic
980164232 4:129205425-129205447 CAGGATGAGAATTTAGTGTGAGG + Intergenic
980508199 4:133750939-133750961 TCTGATGATAATTTATAGTAAGG - Intergenic
981257610 4:142680983-142681005 CCTCAAGAGAATTTATTGAAGGG - Intronic
982461546 4:155675738-155675760 CCTGATAAGAGTTTATACTTTGG + Intronic
985957650 5:3276841-3276863 CCTGATCTGACTTTTTTGTTGGG + Intergenic
989358996 5:40578027-40578049 CCTGCTTAAAATTTATTATTAGG + Intergenic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
990935067 5:61139304-61139326 CATGATGAGAAGGTATTGTATGG + Intronic
992135964 5:73745700-73745722 ACTGATGAGTATTTTTTATTTGG + Intronic
994084434 5:95743191-95743213 CTTGATGAGATTTTATTTTATGG + Intronic
995345253 5:111107007-111107029 TCTGATTAGAATCTCTTGTTAGG + Intronic
995663245 5:114510133-114510155 TCTGAGGAGAATTTATGGTTTGG - Intergenic
995939289 5:117559810-117559832 CCTTATGTGAATTTTTTATTAGG - Intergenic
996144952 5:119962946-119962968 TATGAAGAGAATTTAATGTTGGG - Intergenic
996323407 5:122245212-122245234 CTTGTTGAAAATTAATTGTTTGG + Intergenic
996964796 5:129295037-129295059 TCTGATGAGAATTGATTGTAGGG + Intergenic
998657992 5:144204307-144204329 CCTGATAAGAATATAGTGCTTGG - Intronic
998743106 5:145227610-145227632 CATGATGAGAATCCATTTTTTGG + Intergenic
1000998606 5:167983741-167983763 CCAGTTGAGAATTTATGCTTAGG - Intronic
1001253959 5:170169588-170169610 CATGATGAGACATTATTGCTAGG - Intergenic
1003896509 6:10612997-10613019 GCTGATGAGAATATATTGAAAGG - Intronic
1004816358 6:19315613-19315635 ACTGCTGAAAAGTTATTGTTTGG + Intergenic
1005643320 6:27817402-27817424 TCTAATGAGATTGTATTGTTCGG - Intergenic
1008411361 6:51183722-51183744 CATGATTAGGATTTTTTGTTAGG - Intergenic
1011150038 6:84261486-84261508 TGTGATGATAATTTATTTTTTGG - Intergenic
1013227079 6:108127574-108127596 CCTTATGAGAATCTAATGTCTGG - Intronic
1014125452 6:117771831-117771853 CCTTAGGAGAAATTAATGTTAGG + Intergenic
1014302374 6:119698439-119698461 CCTGATAAGACTTTATTGGTAGG + Intergenic
1015201201 6:130583353-130583375 CCTTATGAGAATCTAATGTCTGG - Intergenic
1016575095 6:145561353-145561375 CCTTCTGAGAATGTGTTGTTAGG - Intronic
1017292106 6:152750085-152750107 CCTGACAACAATTTATTTTTTGG + Intergenic
1020772405 7:12411302-12411324 CCTGATGATTATTTGATGTTGGG + Intergenic
1021243822 7:18237238-18237260 CATGATTAGAAGTTATTTTTAGG + Intronic
1023336521 7:39176182-39176204 CCTGCTGTGAATTTGTTCTTGGG + Intronic
1024868741 7:53936507-53936529 ACTTATGAAAGTTTATTGTTTGG - Intergenic
1024905490 7:54374371-54374393 CCTGATGAGAATTTAATGCCTGG + Intergenic
1026409789 7:70108164-70108186 CTTGATGAGATTTTAATTTTTGG + Intronic
1033372038 7:140717985-140718007 CTTGATAACATTTTATTGTTTGG + Intronic
1034133168 7:148739827-148739849 CCTCATAAGACTTTATGGTTTGG + Intronic
1035812998 8:2507933-2507955 CCTGCTGAGAATTTAATGCCTGG + Intergenic
1043013617 8:74910732-74910754 CCTTATGAGAATCTAATGTTTGG + Intergenic
1043399436 8:79869174-79869196 CTTGATGAGAGTTTATGTTTCGG - Intergenic
1043766588 8:84141632-84141654 CGTTCTGAGAATTCATTGTTAGG - Intergenic
1044454198 8:92373437-92373459 CCTGTTGTTAATTTATTGTCTGG - Intergenic
1050055848 9:1653300-1653322 CTTGAACAGCATTTATTGTTTGG + Intergenic
1051027492 9:12630669-12630691 CCTGCTAACAATTCATTGTTGGG - Intergenic
1051363979 9:16307397-16307419 CTTGATGAGAATGTTTTGGTTGG - Intergenic
1053531375 9:38884885-38884907 TATAATTAGAATTTATTGTTGGG + Intergenic
1054203599 9:62109314-62109336 TATAATTAGAATTTATTGTTGGG + Intergenic
1054634763 9:67479050-67479072 TATAATTAGAATTTATTGTTGGG - Intergenic
1054743704 9:68833573-68833595 GCTGATGAGTATTTGTTGTCGGG - Intronic
1055569915 9:77606239-77606261 CCTTCTTAGAATTTATTTTTTGG - Intronic
1058279180 9:103089948-103089970 CTTGATGAGAAGTGATTGGTTGG + Intergenic
1059066940 9:111095382-111095404 CCTGGTATGAATTTATTATTAGG + Intergenic
1060830430 9:126710978-126711000 GCTCATGAGAATTTATTTTTTGG + Intergenic
1186060267 X:5697929-5697951 CCTGATCTGAATTTATCTTTGGG - Intergenic
1187189948 X:17024856-17024878 ACTGATGAGATTTTATTCTCTGG + Intronic
1189814720 X:44813327-44813349 CCTGCAGTGAATTTATTATTAGG + Intergenic
1191676418 X:63796287-63796309 CCTTGTGAGAATTTATTGGAAGG - Intergenic
1192087615 X:68116422-68116444 TCTGATGAGAATTTATGGCTTGG + Intronic
1192295379 X:69842246-69842268 CCTTATGAGAATCTAATGTCTGG + Intronic
1192549366 X:72041849-72041871 CCTGCAGAGAATTTATAGCTGGG - Intergenic
1192834598 X:74786045-74786067 CCGAATGAGATTTTAGTGTTGGG - Intronic
1193630890 X:83887005-83887027 CCTGACAAAAATTTTTTGTTTGG + Intergenic
1193817754 X:86124658-86124680 CCTGATGTGAAATTCTTGGTTGG + Intergenic
1194292261 X:92088775-92088797 CCTTAGAAAAATTTATTGTTTGG + Intronic
1195230977 X:102846853-102846875 TGTGATGAGTATCTATTGTTAGG + Intergenic
1195445911 X:104952111-104952133 CCTGATGCAAAATTATTGGTGGG + Intronic
1199425458 X:147695898-147695920 AATGATGAGCATTTTTTGTTTGG - Intergenic
1200609765 Y:5313401-5313423 CCTTAGAAAAATTTATTGTTTGG + Intronic