ID: 1169723967

View in Genome Browser
Species Human (GRCh38)
Location 20:8709502-8709524
Sequence CAAATTAGGACAGGTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169723967_1169723972 13 Left 1169723967 20:8709502-8709524 CCAGCAGCACCTGTCCTAATTTG 0: 1
1: 0
2: 1
3: 16
4: 131
Right 1169723972 20:8709538-8709560 TTTTTACCCTCCTTCCTATTGGG 0: 1
1: 0
2: 1
3: 21
4: 250
1169723967_1169723971 12 Left 1169723967 20:8709502-8709524 CCAGCAGCACCTGTCCTAATTTG 0: 1
1: 0
2: 1
3: 16
4: 131
Right 1169723971 20:8709537-8709559 CTTTTTACCCTCCTTCCTATTGG 0: 1
1: 0
2: 2
3: 32
4: 353
1169723967_1169723976 26 Left 1169723967 20:8709502-8709524 CCAGCAGCACCTGTCCTAATTTG 0: 1
1: 0
2: 1
3: 16
4: 131
Right 1169723976 20:8709551-8709573 TCCTATTGGGAGTCTTTCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169723967 Original CRISPR CAAATTAGGACAGGTGCTGC TGG (reversed) Intronic
905475006 1:38219817-38219839 CAAGTGAGGACAGGTGCTACAGG - Intergenic
906232266 1:44173971-44173993 CAAATTAGGAAAAGTGGGGCAGG + Intergenic
906352748 1:45078298-45078320 CCAAGAAGGACAGGTGTTGCGGG - Intronic
907669441 1:56461943-56461965 TAAACTAGGGCAGGTGCTGCAGG - Intergenic
912383314 1:109259140-109259162 CAAATCAGGACAAATGCTGGCGG + Intronic
913270913 1:117092699-117092721 CAAAAAAGGACAGGAGCAGCTGG - Intronic
915656385 1:157364517-157364539 AAAAATAAGACAGGTGTTGCAGG + Intergenic
919240717 1:194912610-194912632 AAAATTAGGCCAGGTGCCGTGGG - Intergenic
921098063 1:211903938-211903960 CAAATGAGGAAAGGAGCTGCTGG - Intergenic
1063934000 10:11058426-11058448 CAAATTAGGTGAGGTACTGTTGG + Intronic
1069719846 10:70542453-70542475 GAAAGTAGAACAGGGGCTGCTGG - Intronic
1070550927 10:77490079-77490101 CAAATTGGGGTGGGTGCTGCTGG - Intronic
1070629875 10:78076867-78076889 GCTATTAGGCCAGGTGCTGCTGG + Intergenic
1072888825 10:99303385-99303407 CAACTTAGGCCAGGTTCTGAAGG + Intergenic
1072905887 10:99453254-99453276 CAAGTTAGGACAGGGGTTTCTGG - Intergenic
1073079308 10:100848158-100848180 GAAATTAGGAGGGGTGCTACGGG - Intergenic
1074219648 10:111423953-111423975 GAAATAAGGACAGGTGCTCCAGG - Intergenic
1077431406 11:2517630-2517652 CAAGTCAGGACAGGTGCAGGAGG - Intronic
1079651015 11:22929965-22929987 TAAATTAGTACAGCTGCTGTGGG - Intergenic
1080823809 11:35831064-35831086 TAAATTAGGACAGACTCTGCTGG + Intergenic
1083245000 11:61419967-61419989 CAAACTGTGACAGGTTCTGCCGG + Exonic
1084691075 11:70727009-70727031 CAAATTAGGGTGGGTTCTGCAGG - Intronic
1085210969 11:74777921-74777943 CAAATTAAGACAGTTGAGGCTGG - Intronic
1089628106 11:119764561-119764583 CAAACTAGGTCAGGGCCTGCTGG + Intergenic
1090418556 11:126557763-126557785 GAAGTGAGGACAGGTGCTGTGGG + Intronic
1090784768 11:130039666-130039688 TAAATGAGGCCAGGTGCTGGTGG + Intergenic
1091105781 11:132918410-132918432 GAAGTCAGTACAGGTGCTGCAGG - Intronic
1092040807 12:5382536-5382558 CAAACAAGTCCAGGTGCTGCAGG - Intergenic
1095946036 12:47753841-47753863 CACATTAGGAGGGGTGGTGCTGG + Intronic
1101086161 12:101239062-101239084 CAAATTAGGGCAGGAGCTCCTGG + Intergenic
1103177268 12:118875384-118875406 CAAAGGAGGACAGGAGCTGGTGG - Intergenic
1103209093 12:119153977-119153999 CATAGCAGGGCAGGTGCTGCAGG - Intronic
1104164995 12:126219389-126219411 CAGAGTGTGACAGGTGCTGCTGG - Intergenic
1108791107 13:53970254-53970276 TTAATTAGCACAGGTTCTGCAGG + Intergenic
1112470815 13:99687068-99687090 CAAATGAAGACAGCTGCAGCGGG - Intronic
1112928612 13:104707636-104707658 CAAATTAACAGAGCTGCTGCAGG + Intergenic
1113347974 13:109499205-109499227 CCACTGAGGCCAGGTGCTGCTGG + Intergenic
1113414334 13:110116699-110116721 CACAATAGGACATGTGCTGCGGG + Intergenic
1113918412 13:113888739-113888761 AAAGTTAGCACAGATGCTGCAGG - Intergenic
1120723215 14:87909854-87909876 GAGGTTAGGACAGGTGCTGAAGG - Intronic
1121435651 14:93917525-93917547 TCAAGTAGGACAGGTGCTCCAGG + Intergenic
1125184438 15:36914469-36914491 CAAATATGGACAGGTTCTGAAGG + Intronic
1127982031 15:64042379-64042401 CAATTTGGGTCAGGTCCTGCAGG + Intronic
1129601751 15:77003154-77003176 CAAAAGAGGACAGAGGCTGCGGG + Intronic
1130517353 15:84636281-84636303 CACATAAGGAAAGGTGCTACAGG - Intergenic
1132194491 15:99901659-99901681 CTAATTAGCTCAGGTTCTGCGGG - Intergenic
1137266229 16:46871246-46871268 CAGATGAGGCCAGGGGCTGCTGG - Intergenic
1137599404 16:49745990-49746012 AAAATGAGGACAGGTGCAGGGGG + Intronic
1137879492 16:52031624-52031646 CAATTTAGGAAAAGAGCTGCTGG + Intronic
1138256791 16:55571536-55571558 CAGATTAGGACAGGTTATGGAGG + Intronic
1144733385 17:17541412-17541434 TAAGTGGGGACAGGTGCTGCGGG - Intronic
1149554939 17:57566841-57566863 CCAATTAGGAGAGTTGCTGGTGG + Intronic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1150474486 17:65464329-65464351 CAAATTAGGTCACCTTCTGCAGG + Intergenic
1153210929 18:2763263-2763285 CAAATGTATACAGGTGCTGCTGG + Intronic
1153811465 18:8755614-8755636 CAAAATAGGTCAGGTTCTCCTGG - Intronic
1154156104 18:11945461-11945483 CAAATTGTTACAGGTGATGCAGG - Intergenic
1154492612 18:14933341-14933363 CAGAACAGGACAGGAGCTGCCGG - Intergenic
1156453378 18:37279221-37279243 CACATTCAGGCAGGTGCTGCTGG + Intronic
1157381809 18:47225490-47225512 CACAATATGCCAGGTGCTGCAGG + Intronic
1158207297 18:55007555-55007577 GAAAGTAAGGCAGGTGCTGCTGG - Intergenic
1158488761 18:57891447-57891469 CAAGTCAGAACAGGTGCAGCTGG + Intergenic
1160815004 19:1031064-1031086 CATATTTGGACAGGAGCTGGTGG - Exonic
1163876399 19:19873309-19873331 CAAATCAGAACAGGTGATCCAGG + Intronic
1163900815 19:20098580-20098602 CAAATCAGGACAGGAGATCCAGG + Intronic
1163909900 19:20179978-20180000 CAAATCAGGACAGATGATGTAGG + Intronic
1163926494 19:20349513-20349535 CAAATCAGGACGGGTGATCCAGG - Intergenic
1163936154 19:20446116-20446138 CAAATCAGGACAGGTAATCCAGG + Intergenic
1163956954 19:20651784-20651806 CAAATCAGGACAGGTGATCCAGG - Intronic
1163975788 19:20850632-20850654 CAAACCAGGACAGGTGATCCAGG - Intronic
1164015132 19:21249124-21249146 CAAATCAGGATAGGTGATCCAGG - Intronic
1164044526 19:21524592-21524614 CAAATCAGGACGGGTGATCCAGG + Intronic
1164069063 19:21749528-21749550 CAAGTCAGGATAGGTGATGCAGG - Intronic
1164076557 19:21824224-21824246 CTAATCAGGACAGGTGATGCAGG - Intronic
1164102402 19:22068784-22068806 CAAATCAGGACAGGTGATCCAGG + Intronic
1164317198 19:24101635-24101657 CTAATCAGGACAGGTGATCCAGG + Intronic
1166774954 19:45306839-45306861 CGAAGTAGAACAGGTGCAGCTGG - Exonic
1167266768 19:48486831-48486853 CAAACAAGGACAGGTTCGGCCGG - Intronic
1167800688 19:51739437-51739459 CAAATAAGGACACGTTCTGAGGG + Intergenic
1167855503 19:52235441-52235463 CAAATTAGGCCAGGTGCCAGTGG + Intergenic
933110627 2:78396511-78396533 TAAATTAGGATTGCTGCTGCAGG + Intergenic
934122651 2:88855200-88855222 CAAGTGAAGACAGGTGCTGCAGG - Intergenic
936030932 2:109070034-109070056 CCAGTCAGGACAGGTGATGCTGG + Intergenic
943110952 2:183605178-183605200 CAAATCAGCACAGGTGCTCTGGG + Intergenic
945113978 2:206392845-206392867 CAATTTTGGACTGGTGGTGCTGG + Intergenic
948601389 2:239109247-239109269 CACATTAGCACAGGTGCCCCTGG - Intronic
1169723967 20:8709502-8709524 CAAATTAGGACAGGTGCTGCTGG - Intronic
1173969775 20:47143492-47143514 CAAATTAGTACAGATCCTCCTGG + Intronic
1174852328 20:54007182-54007204 CCAATCAGGACAGGAGCTGCGGG - Intronic
1178773637 21:35528635-35528657 CAAATTAGGGCGGGTGCGCCAGG - Intronic
1179166354 21:38938203-38938225 CAGATTAGGAGAGGTGCTTCTGG - Intergenic
1182395643 22:30033981-30034003 CAACCTAAGAAAGGTGCTGCAGG - Intergenic
1183388042 22:37526317-37526339 CAAAAGAGGAAAGGTGCTCCAGG + Intergenic
951799296 3:26577246-26577268 CAAATGAGGCTAAGTGCTGCTGG - Intergenic
954854344 3:53630011-53630033 AATATAAGGACAGGTGCAGCAGG - Intronic
956964905 3:74447661-74447683 GAAAATAGGACAGGTGGTGAGGG - Intronic
962685709 3:137845854-137845876 CAAACTGGGGCAGATGCTGCAGG - Intergenic
965038598 3:163474998-163475020 CATATTAGGAGAGTTACTGCAGG - Intergenic
965443908 3:168750821-168750843 CAAATTAGGTCAAGTGCTGAGGG - Intergenic
966623682 3:181993710-181993732 CAAATTAGGAAAGGTGGTAAAGG - Intergenic
971944539 4:33256238-33256260 AAAGTTGGGACAGGTGCTGGGGG - Intergenic
972913607 4:43848993-43849015 GAAATTAGGGCAGTTGCTCCAGG - Intergenic
973969924 4:56203294-56203316 CAAAATAGCACAAGTGCTCCAGG - Intronic
973992459 4:56423333-56423355 CAAATTATGCCAGGTGCAGTTGG + Intronic
975077985 4:70236983-70237005 CAAATTAGGAAAGGTCCCACAGG + Intergenic
980059895 4:128117668-128117690 AAAATTAGGCCAGGTGCAGTGGG - Intronic
982446508 4:155496646-155496668 CACATTATGCCAGATGCTGCAGG - Intergenic
982997675 4:162370506-162370528 CAAATCAGGTCAGATGCTGGAGG - Intergenic
983861772 4:172716132-172716154 CTAATTGGGAGAGGTGCTGGTGG + Intronic
985620545 5:952615-952637 CAAATGAGAACAGGGGCTGAGGG - Intergenic
986823674 5:11497359-11497381 GAAATTATGATGGGTGCTGCAGG + Intronic
987079167 5:14410860-14410882 CAAAGTAGGAAACGTGCTGCTGG - Intronic
988576107 5:32426612-32426634 CAAATTAGGCCAGGTGCTGGTGG + Intronic
989721696 5:44536668-44536690 AAAAATAGGGCAGGTACTGCAGG + Intergenic
993857157 5:93090646-93090668 CAAAATAGGACACGTTTTGCAGG - Intergenic
994318698 5:98364356-98364378 CAAATTAGGACAGGCCCTCCGGG - Intergenic
1003704728 6:8512548-8512570 AAAATGAGGCCAGGTGCTGGTGG + Intergenic
1006255686 6:32830314-32830336 CACAGGGGGACAGGTGCTGCTGG - Exonic
1007112543 6:39321270-39321292 CAAATTAGCATAAGTGCTGGGGG - Intronic
1007482723 6:42160684-42160706 CAAGATGGGACAGGGGCTGCAGG + Intronic
1014175362 6:118325891-118325913 CAATTCAGGACAGGAGTTGCAGG - Intergenic
1015080130 6:129214181-129214203 CAAGTTAGGACAGGTGCATTTGG + Intronic
1015592629 6:134837100-134837122 TAAGTTAGGACAGCTGCTGTGGG - Intergenic
1016617241 6:146065606-146065628 CAAAACAGGACATGTGATGCTGG + Intronic
1016703216 6:147077325-147077347 CAAAGTAGGTCAAGTGCTGGTGG + Intergenic
1021314498 7:19130524-19130546 AAAATTTGGATAGGTGCTACAGG + Intergenic
1025234790 7:57227369-57227391 CACACTGGGACAGATGCTGCAGG - Intergenic
1026644557 7:72156407-72156429 CACATTTGGGCAGATGCTGCCGG - Intronic
1035632944 8:1121886-1121908 CAAAATAGGACAGATGCTCATGG - Intergenic
1036229163 8:6984891-6984913 CAACAGAGGACAGGTTCTGCTGG - Intergenic
1036231616 8:7003996-7004018 CAACAGAGGACAGGTTCTGCTGG - Intronic
1041746513 8:61213413-61213435 AGAATTAGGACAGATGTTGCGGG + Intronic
1044204118 8:89471773-89471795 CAAAACAGGACAGGAGCAGCAGG - Intergenic
1046126444 8:109914708-109914730 CAAAGTAGGACAGGGACTGAAGG + Intergenic
1048210660 8:132451811-132451833 TAAAATAGGACAGGAGCAGCGGG + Intronic
1049947623 9:612815-612837 CCCATTAGGAGAGCTGCTGCTGG - Intronic
1055399293 9:75906111-75906133 CAAATTATGATAGGTGATGTTGG + Intronic
1056395752 9:86179868-86179890 CAGATTTTTACAGGTGCTGCAGG - Intergenic
1056566643 9:87778386-87778408 CCAAATAGTACAGGTGCTACTGG - Intergenic
1057180512 9:93027189-93027211 CCAAGCAGGACAGGTGCTGGGGG + Intronic
1059956888 9:119525548-119525570 CAAAGAAGCACAGGAGCTGCGGG - Intergenic
1061431960 9:130536769-130536791 CTAATCATGACAGGCGCTGCTGG - Intergenic
1061481956 9:130901811-130901833 CCACTGAGGACAGATGCTGCCGG + Intergenic
1189009502 X:37032453-37032475 CAAATTATGACATGATCTGCTGG - Intergenic
1189039071 X:37523271-37523293 CAAATTATGACATGATCTGCTGG + Intronic
1191716760 X:64199072-64199094 CAAATTAGGGGAGGAGCTGAAGG - Intronic
1192286972 X:69748493-69748515 AAAATTAGGATATGTGCTGCTGG + Intronic
1194475888 X:94359794-94359816 CCAGTTATGACAGGTGATGCAGG + Intergenic
1200251001 X:154553707-154553729 CACAACAGGACAGGTGCTACTGG - Intronic