ID: 1169725371

View in Genome Browser
Species Human (GRCh38)
Location 20:8723677-8723699
Sequence CTTGACTCATTTGTAAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1367
Summary {0: 1, 1: 1, 2: 4, 3: 140, 4: 1221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169725371_1169725373 11 Left 1169725371 20:8723677-8723699 CCTAATTTTACAAATGAGTCAAG 0: 1
1: 1
2: 4
3: 140
4: 1221
Right 1169725373 20:8723711-8723733 GCAATTAAGTAAGTTGCCCAAGG 0: 1
1: 5
2: 39
3: 387
4: 1700
1169725371_1169725374 19 Left 1169725371 20:8723677-8723699 CCTAATTTTACAAATGAGTCAAG 0: 1
1: 1
2: 4
3: 140
4: 1221
Right 1169725374 20:8723719-8723741 GTAAGTTGCCCAAGGTTGCCCGG 0: 1
1: 1
2: 4
3: 62
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169725371 Original CRISPR CTTGACTCATTTGTAAAATT AGG (reversed) Intronic
901250883 1:7778821-7778843 GTTTCCTCATTTGTAAAATGGGG + Intronic
902403422 1:16170578-16170600 GTTTCCTCATTTGTAAAATGTGG - Intergenic
902428099 1:16340816-16340838 CTTTCCTCATTTGTGAAATAAGG - Intronic
902774694 1:18667210-18667232 CTTTCCTCATCTATAAAATTGGG + Intronic
903009999 1:20323059-20323081 ATTTACCCATTTGTAAAATGGGG - Intronic
903022571 1:20404487-20404509 AGTGACTCATCTGTAAAATGGGG - Intergenic
903375363 1:22862441-22862463 GTTTTCTTATTTGTAAAATTAGG - Intronic
903988845 1:27250517-27250539 ATTTCCTCATTTGTAAAATGGGG - Intronic
904093945 1:27963325-27963347 CTTGTTTCATCTGTAAAATGAGG - Intronic
904234269 1:29104109-29104131 GTTTCCTCATTTGTAAAATGTGG + Intronic
904272832 1:29361864-29361886 CCTGACTCATCTGTACAATGGGG - Intergenic
904416380 1:30363459-30363481 GTTTCCTCATTTGTAAAATGGGG + Intergenic
904568871 1:31445593-31445615 CTTTTCTCATTAGTAAAATAAGG + Intergenic
904673903 1:32186062-32186084 CTTTACTCATCTTTAAAATGGGG + Intronic
904803867 1:33117614-33117636 GTTTGCTCATTTGTAAAATGGGG - Intronic
904804817 1:33123500-33123522 GTTTACTCATTTGTACAATGTGG + Intergenic
904962812 1:34347990-34348012 CTTTTCTCATCTGTAAAATAGGG + Intergenic
905543526 1:38779349-38779371 GTTGTCTCCTTTGTAAAATGGGG + Intergenic
906022190 1:42639664-42639686 CTTTCCTCATCTGTAAAATGAGG + Intronic
906361022 1:45159356-45159378 CTTCTTTCATTTGTAAAATGAGG + Intronic
906362304 1:45173649-45173671 ATTTCCTCATATGTAAAATTGGG + Intronic
906415124 1:45615696-45615718 GTTGACCGATTTGTAAAATGGGG + Intronic
906455248 1:45990363-45990385 TTTTGCTCATTTTTAAAATTGGG + Intronic
906616040 1:47233386-47233408 GTTTTCTCATTTGTAAAATGGGG + Intergenic
906634243 1:47397679-47397701 GTTTCCTCATTTGTAAAATAAGG - Intergenic
906651294 1:47514882-47514904 ATTTTCTCATCTGTAAAATTGGG - Intergenic
906727953 1:48057794-48057816 GTTTCCTCATTTGTAAAATAGGG - Intergenic
906916741 1:50020403-50020425 GTTTCCTCATTTGTAAAATGGGG - Intronic
907016524 1:51020548-51020570 GTTTCCTCATTTGTAAAATGAGG - Intergenic
907270236 1:53286951-53286973 GTTTACTCATCTGTAAAATGTGG - Intronic
907336794 1:53704953-53704975 CTTTACTCATCTGCAAAATGGGG - Intronic
907488525 1:54793805-54793827 GTTGCCTCATCTGTAAACTTGGG - Intronic
907579346 1:55557602-55557624 GTTGCCTCATGTGTAAAATAGGG + Intergenic
907822047 1:57979746-57979768 TTTTACTCATCTGTAAAATGGGG + Intronic
907953122 1:59203085-59203107 CTTTACTCACCTGTAAAATGAGG + Intergenic
907955688 1:59226136-59226158 ATTTCCTCATTTGTAAAATGAGG - Intergenic
908007148 1:59738793-59738815 ATTTCCTCATTTATAAAATTTGG - Intronic
908138225 1:61155055-61155077 GTTTCCTCATTTGTAAAATGGGG + Intronic
908175859 1:61554477-61554499 CTTAACTGATCTGTAAATTTGGG - Intergenic
908364741 1:63409109-63409131 CTTTTCTCATTTGCAAAATGTGG + Intronic
908624588 1:66026527-66026549 GTTGTCTGATTTGTAAAATGAGG + Intronic
908679031 1:66638745-66638767 CTCCACCCATTTGTCAAATTGGG + Intronic
908716037 1:67070120-67070142 CTTTGCCCATTTATAAAATTGGG + Intergenic
908766605 1:67559991-67560013 ATTTCCTCATTTGTAAAATTAGG - Intergenic
908768794 1:67577200-67577222 GTTTCCTCATTTGTAAAATAGGG + Intergenic
908953563 1:69592804-69592826 CGTTCCTTATTTGTAAAATTGGG - Intronic
909153255 1:72035810-72035832 ATTTACTCATATGTAAAATTGGG - Intronic
909547321 1:76862159-76862181 GTTCACTCATTTGTGAAATGGGG + Intergenic
909684137 1:78326993-78327015 CTTTCCCCATTTGTAAAATCAGG + Intronic
909977913 1:82067115-82067137 CTTAACTTTTTTCTAAAATTTGG + Intergenic
909997594 1:82299496-82299518 GTTTTCTCATTTGTAAAATGGGG + Intergenic
910145445 1:84075482-84075504 TTCTACTCATTTGTAAAATGGGG + Intergenic
910340171 1:86177869-86177891 ATTTCATCATTTGTAAAATTGGG - Intergenic
910398263 1:86812909-86812931 CTTTCCTCATCTGTAAAATATGG - Intergenic
910519775 1:88106588-88106610 CTTGACTTATCTATAAAATAGGG - Intergenic
910650728 1:89563812-89563834 CTTTTCTCATCTGTAAAATAGGG - Intronic
910711974 1:90191466-90191488 ATTTACTCATCTGTAAAATTGGG - Intergenic
910782809 1:90959077-90959099 CTTTGCTCATTTAAAAAATTAGG - Intronic
911052874 1:93686542-93686564 CTTTTCTCATTTGTGAAATGGGG - Intronic
911572729 1:99537337-99537359 CTTTTCTCATTTGTAAAATGGGG - Intergenic
911587941 1:99712749-99712771 GTTTCCCCATTTGTAAAATTGGG - Intronic
911651599 1:100395180-100395202 GTTTTCTCATTTGTAAAATTTGG + Intronic
911716521 1:101139584-101139606 GTTTACTCATATGTAAAATGAGG - Intergenic
911864773 1:103004017-103004039 GTTTCCTCATTTGTAATATTTGG + Intronic
912296068 1:108472114-108472136 CCTGACACATTTCTAATATTTGG + Intergenic
912455040 1:109791629-109791651 ATTGCCTCATCTGTAAAATGGGG - Intergenic
912482036 1:109990248-109990270 CTTTTCTCATCTGTAAAATGGGG + Intronic
912489923 1:110057022-110057044 GTTGACTCATCTGTAAAAATTGG + Intronic
912634393 1:111278515-111278537 GTTTCCTAATTTGTAAAATTGGG - Intergenic
912944567 1:114074441-114074463 CTTTGTTCATTTGTAAAATTAGG - Intergenic
912971279 1:114285977-114285999 GTTTTCTCATTTGTAAAATGAGG - Intergenic
912982706 1:114391197-114391219 CTTGGCTTATTTGTGAAATGAGG - Intergenic
913243374 1:116850226-116850248 CTTTCCTCATTTGAAAAATTGGG - Intergenic
913520033 1:119636648-119636670 CCTGACTCATCTGTAAAATAGGG - Intronic
913542314 1:119833374-119833396 CTTGACACACTTCTAATATTTGG - Intergenic
913545618 1:119866281-119866303 CTTTGCTGATTTTTAAAATTAGG + Intergenic
913676143 1:121142463-121142485 CTTTGCCCATTTTTAAAATTGGG + Intergenic
913965397 1:143373040-143373062 CTTTTCTCATTTGTAAAGTGAGG + Intergenic
914028036 1:143930407-143930429 CTTTGCCCATTTTTAAAATTGGG + Intergenic
914059772 1:144198642-144198664 CTTTTCTCATTTGTAAAGTGAGG + Intergenic
914119378 1:144767729-144767751 CTTTTCTCATTTGTAAAGTGAGG - Intergenic
914885806 1:151583455-151583477 GTTCCCTCATTTGTAAAATGAGG + Exonic
915258374 1:154653876-154653898 CTGGTCTCATATGTCAAATTAGG + Intergenic
915369177 1:155333649-155333671 ATTTCCTCATTTATAAAATTGGG + Intergenic
915937156 1:160096282-160096304 CCTTTCTCATCTGTAAAATTGGG - Intronic
916465418 1:165069581-165069603 ATTTACTCATTTGCAAAATGAGG + Intergenic
916627831 1:166578252-166578274 ATTTCCTCATTTGTAAAAATGGG + Intergenic
916732356 1:167577855-167577877 CTTTGCCCATTTTTAAAATTGGG + Intergenic
916820636 1:168394825-168394847 ATTTGCTCATTTGTAAAATTGGG + Intergenic
917559224 1:176128054-176128076 CTTTACTCATTTTAAAAATAGGG + Intronic
917877514 1:179299293-179299315 CTAAACTCATCTGTAAAATGAGG + Intronic
917918580 1:179729617-179729639 CTAGATTCATTTGTAAAACCAGG - Intergenic
917922773 1:179764824-179764846 GTTGCCTCATTTGTAAAAAGGGG + Intronic
917930502 1:179819298-179819320 GTTTTCTCACTTGTAAAATTGGG + Intergenic
917996562 1:180445068-180445090 GTTTCCTCATTTGTAAAAATGGG + Intronic
918365148 1:183799628-183799650 CCTGTCTCATTTTTAAAATCAGG + Intronic
918413643 1:184285895-184285917 GTTCACTCATCTGTAAAATGAGG + Intergenic
918431467 1:184465072-184465094 GTTTTCTAATTTGTAAAATTAGG + Intronic
918694540 1:187528090-187528112 CTTGAATCATTTGAAAATTCAGG - Intergenic
919139051 1:193547184-193547206 CTTGATTCATTTTTAAAAATAGG - Intergenic
919659169 1:200226688-200226710 TGTGCCTCATTTGTAAAATCGGG - Intergenic
919706375 1:200680310-200680332 GTTTCCTCATTTGTAAAATGGGG - Intergenic
919746034 1:201009797-201009819 GTTTTCTCATCTGTAAAATTAGG - Intronic
920454310 1:206086576-206086598 GTTTTCTCATATGTAAAATTGGG + Intronic
920463511 1:206161301-206161323 CTTTGCCCATTTTTAAAATTGGG + Intergenic
920764648 1:208820256-208820278 CTTGCCTTATTTATAAAATGTGG - Intergenic
921045563 1:211475003-211475025 CTTGACTCATTTGTTAAAAGGGG - Intergenic
921185795 1:212668314-212668336 GTTTTCTCATTTGTAAAATGGGG - Intergenic
921276399 1:213524962-213524984 CTTTTCTCATTTGCAAAATGTGG + Intergenic
922027120 1:221760554-221760576 GTTTTCTTATTTGTAAAATTGGG + Intergenic
922107917 1:222528247-222528269 ATTTATTCATTTGTAAAATGGGG + Intronic
922204469 1:223434595-223434617 GTTTACTCATCTGTAAAGTTGGG + Intergenic
922468997 1:225864027-225864049 GTTTACTCATCTGTAAAATGGGG - Intronic
922878147 1:228957427-228957449 GTTGTCTCATTTGTAAAGTGGGG - Intergenic
923394166 1:233544156-233544178 CTTTCCTCATTTGTACAAATGGG + Intergenic
923642998 1:235784614-235784636 GTTGCCTCATATGTAAAATTGGG + Intronic
923906318 1:238389096-238389118 CTTTTCTCATTTGTAAAACAGGG + Intergenic
923987350 1:239396095-239396117 CTTGACAAATTGCTAAAATTTGG - Intronic
924480371 1:244426164-244426186 CATGACTGATTTGCAAAATCAGG - Intronic
1062868487 10:877609-877631 GTTTCCTCATTTGTAAAATGGGG + Intronic
1063993321 10:11591048-11591070 CTTTACTCATTCGTAAATGTAGG - Intronic
1064048329 10:12039175-12039197 GTTTACTCATTTATAAAATAGGG - Intronic
1064318507 10:14279915-14279937 GTTTACTCATTTGTAAAACGTGG - Intronic
1064383647 10:14869954-14869976 TTTTACTCATTTGTAAAATAAGG - Intronic
1064548163 10:16472014-16472036 ATTGACTCATTTGTGAAAATAGG - Intronic
1064952181 10:20865372-20865394 GTTTCCTCATTTGTAAAATAGGG - Intronic
1065023500 10:21519507-21519529 CTTGGCTGCTTTGCAAAATTCGG + Exonic
1065067146 10:21981596-21981618 ATTTCCTCATTTGTAAAATGGGG + Intronic
1065346400 10:24752079-24752101 CTTTAATCATTTCTGAAATTGGG + Intergenic
1065417586 10:25505016-25505038 CTTTTCTCATCTGTAAAATGGGG + Intronic
1066610195 10:37237272-37237294 GTTGCCTCTTTTGTAAAATGAGG + Intronic
1067341247 10:45406142-45406164 CTTCCCTCATCTGTAAAATGAGG + Intronic
1067361368 10:45582558-45582580 GTTTACTCATTTATAAAAATGGG - Intronic
1067766174 10:49089135-49089157 TTTTACCCATTTGTAAAATGGGG + Intronic
1067770224 10:49117097-49117119 ATTTACTAATTTGTAAAATGAGG - Intergenic
1068494481 10:57769380-57769402 TTTGACCTATTTTTAAAATTGGG - Intergenic
1068876768 10:62005307-62005329 CTTGCCCCATCTGTAAAATCGGG + Intronic
1068958062 10:62838618-62838640 TTTTTCTCATTTGTAAAATGGGG - Intronic
1069061316 10:63897522-63897544 GTTTCCTCATCTGTAAAATTAGG + Intergenic
1069305713 10:66966082-66966104 GTTTCCTAATTTGTAAAATTGGG + Intronic
1069837287 10:71317501-71317523 CTTTCCTCATCTGTAAAATGGGG + Intergenic
1070408549 10:76118108-76118130 CATGACTCACTGGTAAAATTTGG + Intronic
1070544011 10:77438636-77438658 GTTTCCTCATTTGTAAAAATGGG - Intronic
1070580785 10:77717589-77717611 GTTGACTCATATGTAAAATGGGG - Intergenic
1070630089 10:78078365-78078387 GTTGTCTCATCTGTAAAATGGGG - Intergenic
1070974843 10:80598161-80598183 GTTTCCTCATTTGTAAAATGGGG + Intronic
1071130038 10:82379631-82379653 TTTGACTCAAATGTAGAATTTGG + Intronic
1071359776 10:84834793-84834815 ATGGCCTCATATGTAAAATTGGG + Intergenic
1071498477 10:86187217-86187239 ATTTCCTCATTGGTAAAATTGGG + Intronic
1071861163 10:89674127-89674149 ATTTTCTCATTTGTAAAATAAGG - Intergenic
1071867512 10:89752006-89752028 TTTTCCTCATTTGTAAAATGTGG + Intronic
1071957306 10:90772883-90772905 GTTTCCTCATTTGTAAAATAGGG - Intronic
1072127169 10:92457020-92457042 GTTTTCTCATCTGTAAAATTGGG - Intronic
1072181628 10:92987912-92987934 CTTTCCTCATCTGTAAAATGAGG + Intronic
1072425737 10:95328939-95328961 GTTTTCTCATTTGTAAAATGAGG - Intronic
1072741019 10:97909432-97909454 GTTTCCTCATTTGTAAAATGGGG + Intronic
1073055186 10:100695533-100695555 GTTGTCTTATTTGTAAAATATGG - Intergenic
1073442956 10:103563758-103563780 CTTTCCTCATCTGTAAAATGGGG - Intronic
1073818327 10:107232371-107232393 CTTGTCTCCTCTGTAAAATGGGG + Intergenic
1074148119 10:110734706-110734728 ATTTTCTCATTTGTAAAATAGGG + Intronic
1074426426 10:113355445-113355467 ATTTCCTCATTTGTAAAATGGGG + Intergenic
1074663636 10:115691762-115691784 CTTTGCTCATTTTTAAATTTTGG + Intronic
1074883420 10:117676220-117676242 TTTTCCTCATTTGTAAAATGGGG - Intergenic
1074928542 10:118099355-118099377 GTTTGCTCATTTGTAAAATCGGG - Intergenic
1075281576 10:121143502-121143524 TTTGGCTGATTTCTAAAATTTGG - Intergenic
1075880712 10:125848420-125848442 TTTTTCTCATCTGTAAAATTAGG - Intronic
1076285437 10:129291318-129291340 TTTGTCTCATCTGTAAAATGGGG - Intergenic
1076831034 10:132994361-132994383 CTTTCCTCATTGGTGAAATTGGG + Intergenic
1077416552 11:2426734-2426756 CCTGCCTCATTTGTGAGATTTGG + Intergenic
1077896173 11:6455255-6455277 GTTAACTCATGTGTAAAATTAGG - Intronic
1077951136 11:6958714-6958736 TTGGACTCTTATGTAAAATTGGG - Intronic
1078000035 11:7486235-7486257 TTTGTCTCATCTGTAAAATGGGG + Intronic
1078065366 11:8075419-8075441 GTTGCTTCATTTGTAAAATGGGG + Intronic
1078337869 11:10477955-10477977 CTCGACTCCTTTGTAAAACAAGG + Intronic
1078563795 11:12396103-12396125 GTTTCCTCATCTGTAAAATTGGG - Intronic
1078586188 11:12591719-12591741 GTTTTCTCATTTGTAAAATGGGG - Intergenic
1078667008 11:13334112-13334134 GTTGCCTCATTGGTAAAATGAGG - Intronic
1078686791 11:13539356-13539378 CTTGACTCATTCTTATATTTGGG + Intergenic
1079059819 11:17238804-17238826 CTTTCCTCACTTGTAAAATGGGG + Intronic
1079152314 11:17911199-17911221 TTTTTCTCATTTGTAAAATGAGG - Intronic
1079351820 11:19698230-19698252 CTTTTCTCATCTGTAAAATGAGG + Intronic
1079568350 11:21911319-21911341 ATTTCCTCATTTGTAAAATAAGG + Intergenic
1079778749 11:24570510-24570532 GTTGACTGATTTTTTAAATTGGG + Intronic
1079895050 11:26108477-26108499 ATTTTCTCATCTGTAAAATTAGG - Intergenic
1080202708 11:29692037-29692059 CTTTCCTCATCTGTAAAATTAGG + Intergenic
1080262140 11:30360772-30360794 CTTGACTCTTTTGCAAAAGTTGG - Intergenic
1080376286 11:31716431-31716453 GTTTTCTCATTTGTAAAATGGGG + Intronic
1080378936 11:31747087-31747109 CTACACTCATTTTTCAAATTAGG - Intronic
1080666088 11:34337637-34337659 GTTTCCTCATTTGTAAAATGAGG + Intronic
1080689375 11:34543508-34543530 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1080729443 11:34934492-34934514 CTTGAATCATAATTAAAATTAGG - Intronic
1080755073 11:35189533-35189555 GTTTCCTCATTTGTAAAATGGGG - Intronic
1080800696 11:35607578-35607600 GTTTTCTCATTTGTAAAAATAGG - Intergenic
1081503529 11:43690793-43690815 GTTTCCTCATCTGTAAAATTGGG + Intronic
1081524699 11:43918834-43918856 ACTTACTCATTTGTAAAATGGGG - Intronic
1081635552 11:44719131-44719153 CTTTACTCATCTGTAAAATGGGG + Intergenic
1081741993 11:45447423-45447445 ATTGGCTCATCTGTAAAATGGGG - Intergenic
1081798826 11:45842995-45843017 GTTTCCTCATTTGTAAAATGGGG - Intergenic
1082568113 11:54705376-54705398 CTTGCATCATTTTTAAAATGAGG - Intergenic
1082824204 11:57566446-57566468 ATTTCCTCATTTGTAAAATGCGG + Intronic
1083121148 11:60512896-60512918 CATTTCTCATCTGTAAAATTAGG - Intergenic
1084029458 11:66472800-66472822 GTTTACTCATCTGTAAAATGAGG + Intronic
1084152228 11:67293818-67293840 CTTCACCCATTTAAAAAATTGGG + Intronic
1084323456 11:68386081-68386103 GTTCTCTCATTTGTAAAATGAGG + Intronic
1084521940 11:69668610-69668632 CTGGCCTCATCTGTAAAATGGGG + Intronic
1084852871 11:71957548-71957570 TTTGCCCCATTTGTAAAATGAGG + Intronic
1084947498 11:72646393-72646415 CTTTCCTTATTTGTAAAATGGGG - Intronic
1085134173 11:74070116-74070138 TTTGTCTCATTTGTAAAACAGGG + Intronic
1085251983 11:75150119-75150141 CATGCCTCATTTGTAAAATCAGG + Intronic
1085709974 11:78820457-78820479 CTTTCCTCATTTGTGAAATGGGG + Intronic
1085912717 11:80847479-80847501 GTTTTCTCATTTGTAAAATGGGG - Intergenic
1085933905 11:81121395-81121417 ATTTTCTCATTTGTAAAATTGGG - Intergenic
1086182360 11:83968656-83968678 CTTTTCTCATCTGTAAAATAAGG - Intronic
1086223411 11:84477724-84477746 ATTAACTCATTTGTAATCTTGGG + Intronic
1086236351 11:84635731-84635753 CTTTCCTCATCTGTAAAATGAGG - Intronic
1086379951 11:86242261-86242283 GTTTCCTCATTTGTAAAATGTGG + Intergenic
1086393820 11:86393439-86393461 CTTTTCTCAATTGTAAAATTAGG - Intronic
1086581948 11:88409465-88409487 GTTGTCTCATTTCTAAAATAAGG - Intergenic
1086867653 11:91999593-91999615 GTTTTCTAATTTGTAAAATTAGG - Intergenic
1087017528 11:93568420-93568442 GTTGCCTCATCTGTAAAAATGGG + Intergenic
1087520131 11:99222480-99222502 TTTTAATCATATGTAAAATTGGG - Intronic
1087765058 11:102141900-102141922 TTTTCCTCATTTGTAAAATTCGG + Intronic
1087879690 11:103401655-103401677 CTTTTCTCATTTGTAAAATGAGG + Intronic
1088141748 11:106625249-106625271 CTTGACTTGTTTGGAAAATGTGG - Intergenic
1088221503 11:107574942-107574964 CAGAGCTCATTTGTAAAATTGGG - Intergenic
1088402180 11:109433293-109433315 GTTTGCTCATTTATAAAATTAGG - Intergenic
1088545792 11:110957393-110957415 GTTTCCTCATTTGTAAAATTGGG + Intergenic
1088873473 11:113912867-113912889 CTTCTCTTATTTTTAAAATTGGG + Intronic
1088967164 11:114735479-114735501 GTTGTCTCATTTGCAAAATGGGG + Intergenic
1089006831 11:115098930-115098952 CTTGTCTCATCTGTAAAATGGGG - Intergenic
1089206310 11:116766586-116766608 ATTTCCTCATTTGTAAAAGTGGG + Intronic
1089549451 11:119260484-119260506 ATTGTCTCATCTGTAAAATGGGG + Intronic
1089602794 11:119625611-119625633 GTTTTCTCATTTGTAAAATAAGG - Intronic
1089775953 11:120835987-120836009 AGTGACTCATTTGCAAACTTGGG - Intronic
1089802962 11:121052387-121052409 GTTTCCTCATTTGTAAAATAGGG - Intronic
1089805585 11:121085496-121085518 ATTTCCTCATTAGTAAAATTAGG - Intronic
1089856874 11:121553214-121553236 GTTTTCTCATTTGTAAAATTTGG + Intronic
1090211580 11:124924438-124924460 CTTTCCTCATCTGCAAAATTAGG + Intronic
1090590282 11:128259961-128259983 GTTGACTTATTTGTAAAAGGAGG - Intergenic
1090681329 11:129060916-129060938 GTTTCCTCATTTGTAAAATGGGG - Intronic
1091090552 11:132767336-132767358 GTTTACTCATGTGTAAAATAAGG - Intronic
1091365673 11:135017990-135018012 TTTGGCTCATTTAAAAAATTGGG - Intergenic
1091386043 12:95232-95254 GTTTTCTCATTTGTAAAATGAGG + Intronic
1091536678 12:1416741-1416763 CTTTCTTCATTTGTAAAATCAGG + Intronic
1091754599 12:3043288-3043310 TTTGCCTCATCTGTAAAATGGGG - Intergenic
1091958201 12:4666209-4666231 CTTGGCTAATTTTTAAAATTGGG + Intronic
1092026295 12:5243562-5243584 CCTTGCTTATTTGTAAAATTTGG - Intergenic
1092037301 12:5347837-5347859 CTTCTTTTATTTGTAAAATTAGG - Intergenic
1092156912 12:6288994-6289016 CTTTGCTCATTTTTCAAATTGGG + Intergenic
1092491659 12:8950813-8950835 ATTTACTCATCTGTAAACTTGGG - Intronic
1092648062 12:10601297-10601319 GTTTCCTCATTTGTAAAATGGGG - Intergenic
1092821101 12:12354236-12354258 CTTAACTTTTCTGTAAAATTAGG + Intergenic
1092900043 12:13050164-13050186 GTTGACTGATTTGTGAAAGTGGG + Intronic
1093577795 12:20754312-20754334 CCTGTTTCATTTGTAAAATGGGG - Intergenic
1093938007 12:25021847-25021869 CTTGCCTCAGTAGTAAAATATGG + Intronic
1094024161 12:25944946-25944968 CTTCTTTAATTTGTAAAATTGGG - Intergenic
1094071759 12:26423894-26423916 CTTTATTCATTTCTAAAACTAGG - Intronic
1094333083 12:29317801-29317823 ATTTCCCCATTTGTAAAATTGGG - Intronic
1094491494 12:30963664-30963686 ATTTCCTCATCTGTAAAATTGGG + Intronic
1094495256 12:30985224-30985246 AGTTACTCATTTGTAAAATGGGG + Intronic
1094782605 12:33809789-33809811 CTTTAATGATTTGTTAAATTAGG + Intergenic
1095338571 12:41060987-41061009 ATTTACTTATTTGTAAAATTGGG - Intronic
1095638656 12:44461037-44461059 GTTGCCTCATTTGTAAAATACGG + Intergenic
1095679695 12:44959865-44959887 GTTTTCTCAATTGTAAAATTTGG + Intergenic
1096517894 12:52167943-52167965 CTTTCCTCATCTGTAAAATGGGG - Intergenic
1096639671 12:52984100-52984122 GTTTCCTCATTTGTAAAATTAGG - Intergenic
1096810088 12:54163770-54163792 CTTTCCTCATCTGTAAAATGGGG + Intergenic
1096924506 12:55128525-55128547 ATTTACTCATCTGTAAACTTGGG + Intergenic
1096952738 12:55490840-55490862 CTTGATTCAGGTGTAATATTAGG - Intergenic
1097171646 12:57117937-57117959 GTTTCCTCATTTGTAAAATGAGG - Intronic
1097544774 12:60985167-60985189 CTTTGCTCATTTTAAAAATTGGG + Intergenic
1097780684 12:63700386-63700408 CTTTTCTCATCTGTAAAATAAGG + Intergenic
1098084788 12:66830698-66830720 GTTTTCTCATTTGTAAAATGGGG - Intergenic
1098213860 12:68195101-68195123 TTTTAGTCATTTGCAAAATTTGG - Intergenic
1098351003 12:69560333-69560355 ATTCCCTCATTTGTAAGATTAGG - Intronic
1098480517 12:70953525-70953547 ATTTCCTCATTTGTAAAATGGGG - Intergenic
1098619229 12:72571848-72571870 ATTTCCTCATTTGTAAAATGGGG - Intronic
1098933244 12:76446046-76446068 GTTTCCTCATTTGTAAAATGGGG + Intronic
1098942643 12:76555664-76555686 GTTTTCTCATTTGTAAAATCAGG - Intronic
1098964137 12:76767991-76768013 TTTTTCTCATTTGTAAAGTTGGG + Intronic
1099044621 12:77700589-77700611 CTTGTCACATTTGTTATATTAGG + Intergenic
1099959322 12:89381342-89381364 GTTTTCTCATTTGTAAAATCAGG - Intergenic
1100180930 12:92085657-92085679 GTTGACTCAGTTGTAGAATTTGG - Intronic
1100222950 12:92525762-92525784 GTTTACTCATTTCTAAAATGGGG - Intergenic
1100400968 12:94229229-94229251 CTTTGCCCATTTTTAAAATTGGG + Intronic
1100484550 12:95012261-95012283 GTTTACTCATTTGTAAAATGGGG + Intergenic
1100619549 12:96258075-96258097 GTTGCCTCATCTGTAAAATGGGG - Intronic
1100689654 12:97026262-97026284 CTTTCCTCATCTGTGAAATTGGG + Intergenic
1100770629 12:97918409-97918431 CTTCACCTATTTTTAAAATTGGG + Intergenic
1100775052 12:97964752-97964774 ATTGCCTCATCTGTAAAATGGGG - Intergenic
1100781545 12:98032172-98032194 GTCTACTTATTTGTAAAATTAGG - Intergenic
1100908026 12:99323609-99323631 CTTGCCTTATTTGTCACATTTGG + Intronic
1101238113 12:102810655-102810677 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1101257466 12:102992709-102992731 TTTCCCTCATTTGTAAACTTAGG + Intergenic
1101272645 12:103163795-103163817 GTTTTCTCATCTGTAAAATTGGG + Intronic
1101446014 12:104737401-104737423 GTTGACTCATTTGTAAGTTGGGG + Intronic
1101450166 12:104768823-104768845 GTTGATCCATTTGTAAAATTGGG - Intergenic
1101666517 12:106821148-106821170 CTGTCCTCATTTGTCAAATTGGG - Intronic
1101717360 12:107322018-107322040 GTTGCCTCATCTGTAAAATAGGG + Intronic
1101854683 12:108432457-108432479 GTTTCCTCATTTGTAAAATGGGG - Intergenic
1102169765 12:110833478-110833500 GTTGCCTCATCTGTAAAATGGGG + Intergenic
1102530989 12:113546762-113546784 GTTTCCTCATTTGTAAAAATGGG - Intergenic
1102788204 12:115621252-115621274 GTTGCCTCATCTGTAAAATGGGG + Intergenic
1103058903 12:117843160-117843182 CTTTCCTCATCTGTAAAATGGGG - Intronic
1103063956 12:117881645-117881667 ATTTCCTCATTTGTAAAATGAGG - Intronic
1103176100 12:118864813-118864835 GTTGACCCATCTGTAAAATGGGG + Intergenic
1103302268 12:119937160-119937182 CTTGACTCTTTCCAAAAATTAGG + Intergenic
1103319649 12:120084356-120084378 GTTTCCTCATCTGTAAAATTGGG - Intronic
1103717108 12:122951185-122951207 TTTTTCTCATTTGTAAAATGGGG - Intronic
1104097535 12:125571272-125571294 GTTCCCTCATTTGTAAAATGAGG + Intronic
1105043496 12:132981497-132981519 TTTTGCTCATTTGCAAAATTGGG + Intergenic
1105793188 13:23823280-23823302 ATTTTCTCATTTGTAAAATGAGG + Intronic
1106444506 13:29814495-29814517 CTTTACTCATGTACAAAATTTGG - Intronic
1106525023 13:30532985-30533007 ATTGCCTCTTTTGTAAAAGTGGG - Intronic
1106567799 13:30901370-30901392 ATTTTCTCATTTTTAAAATTAGG - Intergenic
1106666155 13:31852814-31852836 CTTGACTCTTTTAAAACATTAGG + Intergenic
1106871504 13:34026702-34026724 ATTGGCTCATTTGAATAATTCGG + Intergenic
1107257645 13:38447741-38447763 CTTCACCCATTTTTTAAATTGGG + Intergenic
1107313464 13:39105403-39105425 ATTGTCTGATTTTTAAAATTTGG + Intergenic
1107572295 13:41675744-41675766 CTTTCTTCATTTGTAAAATGGGG + Intronic
1107573327 13:41687019-41687041 ATTTGCTCATTTGTAAAATTAGG + Intronic
1107830241 13:44368626-44368648 TTTTACTCATTTGTGAAATTTGG + Intergenic
1108028983 13:46208460-46208482 GTTTCCTCATTTGTAAAACTGGG - Intronic
1108441705 13:50459888-50459910 CTTTCCTCATCTGTAAAATGGGG + Intronic
1108488049 13:50947832-50947854 GTTTTCTCATTTGTAAAATGGGG - Intronic
1108500481 13:51065741-51065763 GTTGTCTCATTTGGAAAATGGGG + Intergenic
1108615680 13:52129363-52129385 TTTAGCTCATTTGTAAAACTGGG - Intergenic
1108812308 13:54242795-54242817 TTTGACTCATATGTATATTTTGG + Intergenic
1108868747 13:54955788-54955810 CTTAGCCCATTCGTAAAATTGGG + Intergenic
1109279591 13:60340688-60340710 TATGACTCATTTGAAAAATGGGG + Intergenic
1109502705 13:63258185-63258207 CCTGCCTCATTTATCAAATTAGG - Intergenic
1109659058 13:65435304-65435326 GTTTTCTCATTTGTAAAATGTGG - Intergenic
1110053357 13:70933967-70933989 CCTGACTCATGTCTAAAATTGGG + Intergenic
1110124887 13:71930373-71930395 CTCTTGTCATTTGTAAAATTTGG - Intergenic
1110144725 13:72176892-72176914 GTTCACTCATTTCTAAAATGAGG + Intergenic
1110285258 13:73742675-73742697 TTTTACTCATCTGTAAAATGGGG - Intronic
1110301663 13:73936102-73936124 ATTGATTCATTTTTAAAACTTGG + Intronic
1110401881 13:75101405-75101427 GTTGATTTATTTTTAAAATTAGG - Intergenic
1110420827 13:75306000-75306022 CTTGACTCATTTTCATCATTTGG - Intronic
1110461640 13:75751640-75751662 CTTCACTCATTTTCAGAATTAGG + Intronic
1110634959 13:77756107-77756129 GTTTTCTCAGTTGTAAAATTAGG + Intronic
1112043529 13:95572450-95572472 GTTTCCTCATTTGTAAAATGAGG + Intronic
1112161415 13:96872315-96872337 TTTAACTCTTTTATAAAATTAGG + Intergenic
1112329451 13:98465675-98465697 CTTAACTCTTATGTAAAAATGGG - Intronic
1112877768 13:104066464-104066486 ATTTTCTCGTTTGTAAAATTTGG + Intergenic
1112997670 13:105594265-105594287 GTTTTCTCATCTGTAAAATTGGG - Intergenic
1113046150 13:106157567-106157589 TTTGACTCATTTGTCAATTTGGG + Intergenic
1113179054 13:107604381-107604403 ATTTTCTCATTTGTATAATTAGG + Intronic
1113606743 13:111613293-111613315 CTTTTCACATTTGTAAAATGGGG + Intronic
1113726511 13:112606650-112606672 ATAGACTCATTTGTAGAACTGGG - Intergenic
1114789370 14:25639231-25639253 GTTTTCTCATTTGTAAAATGAGG - Intergenic
1114866415 14:26599215-26599237 GTTTACTCATCTGTAAAATGAGG - Intergenic
1115049636 14:29042109-29042131 CTTGACTCAGTTTTGTAATTAGG + Intergenic
1115208737 14:30942914-30942936 CTTTCCTTATTTGTAAAATGAGG - Intronic
1115232281 14:31174000-31174022 GTTCCCTCATTTGTAAAATGGGG + Intronic
1115257062 14:31414612-31414634 ATTGACTCATTTTTAAAAGGGGG - Intronic
1115402494 14:32978253-32978275 GTTGGCTCATTTGTAAGATTGGG + Intronic
1115426507 14:33266614-33266636 CTTATCTCATCTGTAAAATGAGG - Intronic
1115908288 14:38226091-38226113 CTTGTCTCATTTGCAAACCTAGG + Intergenic
1116695771 14:48175595-48175617 ATTTATTCATTTATAAAATTTGG - Intergenic
1116882548 14:50185889-50185911 GTTTCCTCATTTGTAAAATGAGG - Intronic
1116965712 14:51012872-51012894 CTTTGCCCATTTTTAAAATTGGG + Intronic
1117065739 14:52011897-52011919 TTTGTCTCATTTGCAAAATGAGG + Intronic
1117226657 14:53667939-53667961 GTTTTCTCATCTGTAAAATTAGG - Intergenic
1117378521 14:55137504-55137526 CTGGACTCATTTGTCCAATGAGG + Intronic
1117688860 14:58284496-58284518 CTTGCCTCATCTGTAACATGGGG - Intronic
1117714934 14:58571002-58571024 GTTTCTTCATTTGTAAAATTAGG - Intergenic
1117876133 14:60250956-60250978 ATTTTCTCATTTGTAAAATAAGG - Intronic
1117882348 14:60324418-60324440 GTTGTCTTATTTGTAAAATCGGG + Intergenic
1117998679 14:61502751-61502773 CTTGCTTCATTTGCAAGATTTGG - Intronic
1118021420 14:61719428-61719450 GTTCCCTCATTTGTAAAATAGGG + Intronic
1118472009 14:66082737-66082759 ATTTCCTCATTTGTAAAATTAGG + Intergenic
1118525946 14:66643079-66643101 TTTTATTCATTTTTAAAATTGGG - Intronic
1118859690 14:69653035-69653057 GTTTCCTCATTTGTAAAATGGGG - Intronic
1118939094 14:70316114-70316136 CTTGAGTCATGGGTAATATTAGG + Intergenic
1119137611 14:72234985-72235007 GTTGACTCAATTGTAAAACGAGG - Intronic
1119425583 14:74532700-74532722 GTTTCCTCATTTGTAAAATGAGG + Intronic
1119506246 14:75175814-75175836 GTTTCCTCATTTGTAAAATGGGG + Intronic
1119548387 14:75490259-75490281 GTTTCCTCATTTGTAAAATGAGG - Intergenic
1119993928 14:79230863-79230885 TTTTACTCATCTGTAAAATGGGG + Intronic
1120762343 14:88296324-88296346 CTTGTTTCATGTGTAAAACTGGG - Intronic
1120764891 14:88319879-88319901 GTTAACTCATCTGTAAAATTAGG + Intronic
1121085946 14:91146176-91146198 ATTTACTCATTTTTAAAATGGGG - Intronic
1121149708 14:91621037-91621059 TTTTCCTCATTTGTAAAATGAGG + Intronic
1121152477 14:91648311-91648333 CTTGACTCAAATGGAAAACTGGG + Intronic
1121305118 14:92901585-92901607 CTTGACTATTTTGTAGATTTGGG - Intergenic
1121428078 14:93867450-93867472 ATTTTCTCATCTGTAAAATTGGG - Intergenic
1121608081 14:95256022-95256044 GTTTCCTCATTTGTAAAATGGGG - Intronic
1121975515 14:98400212-98400234 CTTTGCCCATTTTTAAAATTAGG - Intergenic
1122004743 14:98692859-98692881 CTTTCCTCATCTGTAAAATAAGG - Intergenic
1122618997 14:103042617-103042639 CTTTACTCATTTAAAAAATCGGG - Intronic
1124189357 15:27560195-27560217 CTTTGCCCATTTTTAAAATTGGG + Intergenic
1124486068 15:30117755-30117777 GTTTCCTCATCTGTAAAATTGGG + Intergenic
1124757516 15:32420846-32420868 GTTTCCTCATCTGTAAAATTGGG - Intergenic
1124846678 15:33298235-33298257 GTTAACTCATTTGTAAAACGTGG + Intergenic
1124855989 15:33389497-33389519 CTTGACTATTTTGTAACAATGGG + Intronic
1125040563 15:35181125-35181147 ATTTTCTCATTTGTAAAATGGGG + Intergenic
1125065811 15:35485123-35485145 GTTTTCTCATTTTTAAAATTAGG - Intronic
1125493683 15:40169377-40169399 GTTTCCTCATTTGTAAAATGGGG - Intronic
1125580849 15:40784519-40784541 GTTTCCTCATTTGTAAAATGAGG - Intronic
1125588844 15:40842275-40842297 GTTTGCTCATTTGTAAAATGGGG + Intergenic
1125930624 15:43597329-43597351 GTTTCCTCATCTGTAAAATTGGG + Intronic
1125943793 15:43697150-43697172 GTTTCCTCATCTGTAAAATTGGG + Intronic
1126385224 15:48087350-48087372 GTTTTCTCATTTGTAAAATGTGG + Intergenic
1126392491 15:48174607-48174629 CTTTTCTCATTTTTTAAATTGGG - Intronic
1126458139 15:48886896-48886918 CTCCACTCTTTAGTAAAATTTGG - Intronic
1126458145 15:48886942-48886964 CTTTTCTCGTTTGTAAAATGTGG - Intronic
1126670465 15:51111033-51111055 ATTTCCTCATCTGTAAAATTGGG - Intergenic
1126887057 15:53162491-53162513 GTTGACTCATCTGTAAAATGGGG - Intergenic
1126916396 15:53470946-53470968 GATTACTCATTTGTAAAATAGGG + Intergenic
1127137471 15:55939519-55939541 CTTGGTTCATTTTTTAAATTAGG - Intronic
1127597988 15:60506251-60506273 GTTTCCTCATTTGTAAAATGAGG + Intronic
1127617287 15:60699644-60699666 CCTGACTTCTTTGTAAAATGGGG + Intronic
1127771647 15:62236120-62236142 CTGGGCTCATTTGTACAATGCGG + Intergenic
1128745215 15:70109612-70109634 GTTTCCTCATCTGTAAAATTGGG + Intergenic
1128823302 15:70682859-70682881 ATTGACTCAATTGTATAGTTAGG - Intronic
1129151310 15:73689639-73689661 GTTTGCTCATTTGTAAAATGGGG - Intronic
1129236749 15:74228319-74228341 CTTTCCTCATCTGTAAAATGAGG + Intergenic
1129464117 15:75714217-75714239 GTTTCCTCATTTGTAAAATTGGG + Intergenic
1129643658 15:77409864-77409886 GTTTCCTCATTTGTAAAATAAGG - Intronic
1129647721 15:77452920-77452942 CTTTGCTCATTTTTAAAATTGGG - Intronic
1129721076 15:77878487-77878509 GTTTCCTCACTTGTAAAATTGGG - Intergenic
1129739005 15:77980883-77980905 CTTTGCTCATCTGTAAAATGGGG + Intergenic
1129772338 15:78210338-78210360 CTTAATTCATTTGGAGAATTAGG - Intronic
1129773531 15:78218126-78218148 CTTAACCCATTTGTAAAATGGGG + Intronic
1129798593 15:78396580-78396602 GTTGCCTCATCTGTAAAATAAGG - Intergenic
1129846950 15:78772292-78772314 CTTTGCTCATCTGTAAAATGGGG - Intronic
1129850889 15:78793157-78793179 CTTACCTCATTTGTAAAACGAGG - Intronic
1129900709 15:79146496-79146518 GTGTTCTCATTTGTAAAATTGGG - Intergenic
1130254951 15:82321597-82321619 CTTTGCTCATCTGTAAAATGGGG + Intergenic
1130257062 15:82330716-82330738 GTTTTCTCATCTGTAAAATTGGG + Intergenic
1130416610 15:83700405-83700427 GTTTACTCATTTTTAAAATAAGG + Intronic
1130597888 15:85259274-85259296 GTTTTCTCATCTGTAAAATTGGG - Intergenic
1130600023 15:85268409-85268431 CTTTGCTCATCTGTAAAATGGGG - Intergenic
1130633499 15:85593937-85593959 GTTTCCTCATTTGTAAATTTGGG + Intronic
1131198609 15:90377390-90377412 GTTTTCTCATTTGTAAAATGAGG + Intergenic
1131324470 15:91429265-91429287 GTTTCCTCATTTGTAAAATGAGG + Intergenic
1131363109 15:91812642-91812664 TTTGACCCATTTTTAAAATTGGG - Intergenic
1131542594 15:93287668-93287690 CTTTCCTCATTTGAAAAATGGGG + Intergenic
1131570150 15:93526434-93526456 CTTGAGTAATTTGAAAAATAAGG + Intergenic
1133299935 16:4776310-4776332 CTTTCCTCATCTGTAAAATGGGG - Intergenic
1133427168 16:5702683-5702705 ATTGACCCATCTGTAAAATGGGG + Intergenic
1133773479 16:8881240-8881262 CCTGCCTCATCTGTAAAATAGGG - Intergenic
1133825705 16:9276227-9276249 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1133853500 16:9527708-9527730 GTTTCCTCATCTGTAAAATTGGG - Intergenic
1133958037 16:10464165-10464187 CTTGAGCAATTTGAAAAATTGGG - Intronic
1134209705 16:12265986-12266008 GTTTCCTCATTTGTAAAATGGGG - Intronic
1134317450 16:13132221-13132243 GTTGCCTCATTTGTAGAATGGGG + Intronic
1135033603 16:19058456-19058478 ATTTCCTCATTTGTAAAATAGGG - Intronic
1135086373 16:19477778-19477800 GTTTTCTCATCTGTAAAATTGGG + Intronic
1135089605 16:19502704-19502726 GTTTCCTCATTTGTAAAATGAGG + Exonic
1135152561 16:20021808-20021830 CTTGACTGATTTGTAGAATCGGG + Intergenic
1135460558 16:22638666-22638688 CCAGAATCATTTTTAAAATTTGG + Intergenic
1135919859 16:26640100-26640122 CTTTTCTCATCTGTAAAATGGGG - Intergenic
1135982514 16:27159294-27159316 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1136122154 16:28144811-28144833 GTTTCCTCATTTGTAAAATGAGG - Intronic
1136159376 16:28408613-28408635 CTTTTCTCATTTGTAAAATGAGG - Intergenic
1136203711 16:28706681-28706703 CTTTTCTCATTTGTAAAATGAGG + Intronic
1137251046 16:46741130-46741152 CTTTCCTCATCTGTAAAATGGGG + Intronic
1137322790 16:47402426-47402448 ACTGTCTCATTTGTAAAAGTGGG - Intronic
1137416723 16:48289128-48289150 CTCAACCCATTTGTAATATTAGG + Intronic
1137769649 16:51005640-51005662 CTTTGCTCATATGTAAAATGGGG + Intergenic
1137806071 16:51306691-51306713 CTTTTCTCATCTGTAAAATAAGG + Intergenic
1138176641 16:54905978-54906000 CTTGGCCCATTTTTAAAATCAGG - Intergenic
1138432459 16:56977791-56977813 CTTTCCTCATCTGTAAAATGGGG - Intronic
1138590001 16:57994482-57994504 GTTGCCTCATCTGTAAAATGGGG - Intergenic
1138959488 16:62011495-62011517 CTTGACCCTTTTTTAAAATTGGG + Intronic
1139337254 16:66241505-66241527 GTTGCCCCATTTGTAAAATGAGG + Intergenic
1139351014 16:66335766-66335788 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1139419515 16:66841813-66841835 CTTTTCTCATCTGTAAAATGGGG + Intronic
1139688202 16:68620897-68620919 CCTGACTCTGTTGTAACATTAGG + Intergenic
1139840520 16:69874847-69874869 GTTTTCTCATTTATAAAATTAGG + Intronic
1140751591 16:78029110-78029132 TTTTCCTCATCTGTAAAATTAGG - Intronic
1140778304 16:78270972-78270994 ATTGATTCATTTGTAAGATGAGG - Intronic
1140957009 16:79875259-79875281 CTCGACTCATTGGTAAAATGGGG - Intergenic
1141194001 16:81845964-81845986 GTTTCCTCATTTGTAAAATAGGG + Intronic
1141466475 16:84209123-84209145 ATTTTCTCATTTGTAAAATGAGG + Intergenic
1141720346 16:85752113-85752135 CTTGAGTCATTCCTAAAAATGGG + Intergenic
1141789149 16:86221726-86221748 CTTTACTCCTTTGTAAAATGGGG + Intergenic
1141806730 16:86346938-86346960 TTTGTCTCATCTGTAAAATGGGG - Intergenic
1141822590 16:86457256-86457278 GTTGCCTCATCTGTAAAATGGGG + Intergenic
1142689386 17:1595955-1595977 CCTTACTCATTTTTAAAAGTGGG - Intronic
1142730470 17:1851707-1851729 CTGGAGTGATTTGTATAATTTGG + Intronic
1143091814 17:4453336-4453358 CTTTACTGATCTGTAAAATGGGG - Intronic
1143746062 17:8995036-8995058 GTTTCCTCATTTGTAAAATGAGG + Intergenic
1143964994 17:10750732-10750754 GTTTCCTCATTTGTAAAATCGGG + Intergenic
1144022320 17:11248346-11248368 GTTGCCTCACTTGTAAAACTAGG - Intronic
1144239955 17:13300875-13300897 GTTTACTCATCTGTAAAATATGG + Intergenic
1145892969 17:28430953-28430975 CTTTGCCCATTTGTAAAAATTGG - Intergenic
1145975740 17:28983190-28983212 GTTTTCTCATCTGTAAAATTGGG + Intronic
1146176901 17:30670939-30670961 CTTTCCTCATTTATAAAATGAGG + Intergenic
1146309094 17:31753291-31753313 CTTTCCTCATCTGTAAAATTGGG + Intergenic
1146511926 17:33456849-33456871 GTTGCCTCATCTGTAAAATGGGG + Intronic
1146686858 17:34846978-34847000 GTTTCCTCATTTGTAAAATAGGG - Intergenic
1146692306 17:34884730-34884752 CTTTCCTCATCTGTAAAATGAGG + Intergenic
1146729935 17:35184644-35184666 GTTTCCTCATTTGTAAAATAGGG - Intronic
1146818019 17:35960246-35960268 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1147185269 17:38709996-38710018 GTTTACTCATCTGTAAAATGGGG - Intronic
1147216632 17:38903268-38903290 GTTTCCTCATTTGTAAAAATGGG + Intronic
1147344002 17:39775055-39775077 CTTTACTCATCTGTGAAATGAGG - Intronic
1147414004 17:40275349-40275371 CTTCCCTTATTTGTAAAATTAGG + Intronic
1147469548 17:40647263-40647285 CTTGTTTCATCTGTAAAATGGGG - Intronic
1147800400 17:43081860-43081882 CTTGACTCTATTGCATAATTAGG + Intronic
1147976743 17:44252358-44252380 GTTTCCTCATCTGTAAAATTGGG - Intronic
1148338030 17:46854522-46854544 GTTGCCTCATCTGAAAAATTGGG - Intronic
1148416931 17:47513983-47514005 GTTTATTCATCTGTAAAATTAGG - Intergenic
1148754633 17:49966404-49966426 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1148799352 17:50213527-50213549 GTTTCCTCATTTGTAAAATGAGG - Intergenic
1149135107 17:53354802-53354824 TTTAACACATTTGTGAAATTTGG + Intergenic
1149253531 17:54797650-54797672 CTTTCCTCATCTGTAAAAATGGG - Intergenic
1149439559 17:56663258-56663280 CTTTCCTCATCTGTAAAATGAGG - Intergenic
1149445915 17:56713351-56713373 ATTAACTCATATGTAAAATGGGG + Intergenic
1149456584 17:56793211-56793233 ATTTCCTCATTTGTAAAATGAGG - Intronic
1150031748 17:61744700-61744722 CTTTTCTCATTTATAAAATGAGG + Intronic
1150060839 17:62066499-62066521 CTTTACTCATCTGTAAAATGGGG + Intergenic
1150159708 17:62885769-62885791 CTTTGCTCACTTTTAAAATTGGG + Intergenic
1150198211 17:63323846-63323868 ATTTCCTCATTTGTAAAATGGGG - Intronic
1151498763 17:74475380-74475402 GTTTACTCATCTGTAAAATGGGG - Intronic
1151858445 17:76739454-76739476 TTTTACCCATCTGTAAAATTGGG - Intronic
1153307745 18:3647806-3647828 CTTTCCTCATCTGTAAAATGGGG - Intronic
1153387874 18:4519399-4519421 ATTTCCTCATCTGTAAAATTAGG - Intergenic
1153578416 18:6546262-6546284 CTTGCCTCATTTATAAACTTAGG - Intronic
1153668630 18:7389124-7389146 ATGAACTCATTTGTTAAATTGGG - Intergenic
1153680124 18:7492537-7492559 ATTTCCTCATTTGTAAAATGGGG + Intergenic
1153690539 18:7589008-7589030 CTTGGCTGATTTTTAAATTTTGG + Intronic
1153942477 18:9990033-9990055 GTTTCCCCATTTGTAAAATTTGG - Intergenic
1154040657 18:10852529-10852551 ATTGATTTATGTGTAAAATTTGG - Intronic
1155217024 18:23652305-23652327 CTTTCCTCATCTGTAAAATGGGG - Intronic
1155417772 18:25618811-25618833 CTTTTCTCATCTGTAAAATGGGG - Intergenic
1155432784 18:25778737-25778759 GTTTCCTCATCTGTAAAATTAGG - Intergenic
1155434532 18:25797850-25797872 CTTGCCCCATCTGTAAAATGGGG - Intergenic
1155678819 18:28464136-28464158 AATTACTCATTTTTAAAATTAGG - Intergenic
1156284045 18:35673448-35673470 GTTTCCTCATCTGTAAAATTTGG + Intronic
1156966934 18:43105813-43105835 CTTTTCTCATCTGTAAAATGGGG - Intronic
1157099575 18:44717043-44717065 TTTGAGTCATCTGTAAAATGGGG - Intronic
1157158537 18:45290884-45290906 CTTCTCTAATTTGGAAAATTAGG + Intronic
1157283613 18:46362139-46362161 CTTGACTCATTTGTCACCTTGGG - Intronic
1157343925 18:46806254-46806276 CCTGTTTCATTTGTAAAATGGGG + Intergenic
1157482941 18:48067349-48067371 CTTCCCTTATTTGTAAAATCAGG + Intronic
1157521458 18:48348302-48348324 GTTTACTCATCTGTAAAATTGGG - Intronic
1157699697 18:49753343-49753365 CATGACTCAGTTGTTAAGTTAGG - Intergenic
1157853688 18:51083712-51083734 GTTGCCTCATCTGTAAAATGAGG + Exonic
1157903862 18:51548027-51548049 CTTTGCCCATTTTTAAAATTGGG + Intergenic
1158061732 18:53351883-53351905 CTTACCTAATTTTTAAAATTGGG - Intronic
1158149236 18:54348571-54348593 CCTTATTCATTTGTAAAATGGGG + Intronic
1158179589 18:54698859-54698881 TTTGATTCTTTTGTAAAATGTGG - Intergenic
1158194017 18:54864324-54864346 CTTTGCTCATTTTTAAAGTTTGG + Intronic
1158241344 18:55381843-55381865 TTTTACTCATTTGTGAAATAAGG + Intronic
1158315385 18:56206648-56206670 GATGACTAATTTGTAAAAGTTGG + Intergenic
1158364671 18:56719813-56719835 ATTTCCTCATCTGTAAAATTAGG + Intronic
1158811412 18:61040809-61040831 CTTGACTTATTTGTATCTTTTGG + Intergenic
1159163035 18:64668816-64668838 GCTGACTCATTGGTAATATTGGG + Intergenic
1159364073 18:67443509-67443531 CTTAACTCAGTTGCACAATTTGG - Intergenic
1159874125 18:73791426-73791448 ATAGACTCATTTGTAGAAATTGG + Intergenic
1160062704 18:75547333-75547355 GTTTGCTCATTTGTAAAATGAGG + Intergenic
1160085198 18:75770833-75770855 CTTGGGTCATTTTTTAAATTAGG + Intergenic
1160153745 18:76415939-76415961 ATTGACTCATTTGCAAACTGAGG - Intronic
1160161451 18:76474993-76475015 CTTGACTCATCTCTCACATTTGG - Intronic
1160315562 18:77842519-77842541 CCAGACTAATTTGGAAAATTGGG - Intergenic
1160356941 18:78236235-78236257 CTTGTCTCTTTTTTAAATTTAGG + Intergenic
1161258765 19:3323986-3324008 TTTTCCTCATTTGTAAAATAAGG + Intergenic
1162123614 19:8487326-8487348 CCTGACTCATCTGTGAAATGGGG - Intronic
1162329830 19:10021010-10021032 CTTGGCTAATTTTTAAATTTTGG - Intronic
1162846927 19:13399981-13400003 GTTGTCTCATCTGTAAAATGGGG + Intronic
1162981918 19:14245971-14245993 CTTTCCTCATTTATAAAATGAGG - Intergenic
1165289913 19:34874688-34874710 CTGTCCTCATTTGTAAAATGAGG + Intergenic
1165759338 19:38311519-38311541 CTTTTCTCATATGTAAAATGGGG - Intronic
1166178764 19:41092539-41092561 GTTTCCTCATTTGTACAATTGGG - Intronic
1166225602 19:41393119-41393141 TTTCTCTCATTTGTAAAATGGGG + Intronic
1166520979 19:43479825-43479847 TTTTGCTCATTTGTAAAATGGGG - Intronic
1202699176 1_KI270712v1_random:150528-150550 CTTTTCTCATTTGTAAAGTGAGG + Intergenic
925810824 2:7698769-7698791 GTTCACTCATTTGGAAAATAAGG - Intergenic
925892122 2:8443159-8443181 ATTTTCTCATCTGTAAAATTAGG - Intergenic
926130266 2:10298695-10298717 CTTTCCTCATCTGTAAAATATGG + Intergenic
926274242 2:11391500-11391522 GTTGCCTCATCTGTAAAATGGGG - Intergenic
926473985 2:13299200-13299222 GTTTCCTCATTTGTAAAATATGG + Intergenic
926584674 2:14673147-14673169 GTTTACTCATCTGTAAAATGGGG - Intergenic
926825008 2:16897696-16897718 CTTGGAGCATTTTTAAAATTGGG - Intergenic
926886865 2:17606035-17606057 GTTTCCTCATTTGTAAAATGGGG - Intronic
926887436 2:17611214-17611236 ATTGCCTCATCTGTAAAATGGGG - Intronic
927032622 2:19138190-19138212 TTTAACTCATCTGTAAAATGGGG + Intergenic
927226700 2:20773232-20773254 GTTTCCTCATTTGTAAAATGGGG - Intronic
927449707 2:23198218-23198240 GTTTTCTCATTTGTAAAATAGGG - Intergenic
927818528 2:26242649-26242671 GTTTTCTCATTTGTAAAATGGGG - Intronic
927905564 2:26853457-26853479 GTTGCCTCATTTGTAAAATGAGG - Intronic
927970465 2:27302892-27302914 CTTTCCTCATGTGTAAAATTAGG + Intronic
928102935 2:28449944-28449966 TGTGACTCATTTGTAGAAGTGGG - Intergenic
928408986 2:31039402-31039424 GTTTCCTCATCTGTAAAATTAGG - Intronic
928487370 2:31746323-31746345 CTAGATTCTTTTGTAAAAGTTGG - Intergenic
928587837 2:32779466-32779488 CCTTACCCATTTTTAAAATTGGG + Intronic
928687559 2:33764541-33764563 CTTTCCTCATTTGTAAAAAGGGG - Intergenic
929003971 2:37377775-37377797 GTTCACTTATTTGTAAAATGAGG - Intergenic
929056964 2:37886615-37886637 CTTTACTCATTTTCAAATTTTGG + Intergenic
929071876 2:38039215-38039237 GTTTTCTCATTTGTAAAATAAGG - Intronic
929241103 2:39654296-39654318 GTTTCCTCATTTGTAAAATGGGG + Intergenic
929324553 2:40592739-40592761 GTAGACTCAATTGGAAAATTAGG - Intronic
929427082 2:41854631-41854653 ATTGCCTCATCTGTAAAATGGGG - Intergenic
929865179 2:45711438-45711460 ATTGCCTCATCTGTAAAATGGGG + Intronic
930183021 2:48384019-48384041 CTTTACTCAGTTTTAATATTAGG - Intergenic
930515676 2:52404836-52404858 CTTGTGTCATTTATAAAATGGGG - Intergenic
930572135 2:53100392-53100414 GTTTAGTCATTTGTACAATTTGG - Intergenic
930618805 2:53623344-53623366 GTTCACTCATCTGTAAAATGGGG - Intronic
931173225 2:59827097-59827119 GTTTCCTCATTTGTAAAATGAGG - Intergenic
931175725 2:59852586-59852608 CTTTTCTCATCTGTAAAATGGGG - Intergenic
931616076 2:64159579-64159601 GTTTTCTCATTTGTAAAATGAGG - Intergenic
931618612 2:64187206-64187228 CTTTCCTCATTTGTATAATGAGG + Intergenic
931706849 2:64953433-64953455 CTTTACCCATTTTTAAAATCGGG + Intergenic
931722029 2:65073611-65073633 GTTTGCTCATTTGTAAAATGTGG + Intronic
931769916 2:65488580-65488602 TTTTTCTCATTTGTAAAATGGGG + Intergenic
931909387 2:66880323-66880345 TTTTGCTCATTTTTAAAATTGGG + Intergenic
932023986 2:68115436-68115458 CTTTCCTCATCTGTAAAATAGGG - Intergenic
932298626 2:70647046-70647068 CATGACGAATTTGTAAAACTAGG + Intronic
932586311 2:73031857-73031879 CTTGTATTATTTTTAAAATTAGG + Intronic
932618613 2:73252228-73252250 CTTGCCTCATCTGTAAAATCGGG + Intronic
932806158 2:74785246-74785268 ATTTCCTCATTTGTAAAATGAGG + Intergenic
932943954 2:76204866-76204888 GTTTCCTCATTTGTAAAATGGGG + Intergenic
933312482 2:80677849-80677871 GTTTCCTCATTTGTAAAATGGGG + Intergenic
933334188 2:80935752-80935774 TTTTACCCATTTTTAAAATTGGG - Intergenic
933364736 2:81337043-81337065 GTTTCCTCACTTGTAAAATTAGG + Intergenic
933429640 2:82159486-82159508 CTTTTCTCATTTATAAACTTAGG - Intergenic
933473483 2:82758259-82758281 GTTTTCTCATTTGTAGAATTGGG - Intergenic
934170125 2:89534013-89534035 CTTTTCTCATTTGTAAAGTGAGG + Intergenic
934280427 2:91608321-91608343 CTTTTCTCATTTGTAAAGTGAGG + Intergenic
934593660 2:95583308-95583330 ATTTACACATTTGAAAAATTAGG - Intergenic
934913198 2:98277506-98277528 CTTGACTGCTTTGGAAAATCTGG + Intronic
934941088 2:98502580-98502602 CATAACTCAGATGTAAAATTTGG + Intronic
935030325 2:99315366-99315388 CTTTACTCATTTTTTAAATTGGG + Intronic
935327437 2:101949402-101949424 CTTCTCTCATTTGTAAAATGGGG - Intergenic
935359271 2:102233670-102233692 GTTGTCTCATCTGTAAAATGGGG + Intronic
935771370 2:106425506-106425528 GTTGCCTCATATGTAAAATGAGG - Intronic
935812550 2:106813206-106813228 ATAGGCTCATTTGTAAAAATTGG - Intronic
935908703 2:107870443-107870465 GTTGCCTCATATGTAAAATGAGG + Intronic
935995108 2:108762661-108762683 GTTGCCTCATATGTAAAATGAGG + Intronic
936130486 2:109835557-109835579 GTTGCCTCATATGTAAAATGAGG + Intronic
936175535 2:110216906-110216928 CTTGACTCATTTGTAAAATAAGG + Intergenic
936214211 2:110535928-110535950 GTTGCCTCATATGTAAAATGAGG - Intronic
936261349 2:110962098-110962120 CTTGCTTCATCTGTAAAATAGGG + Intronic
936328007 2:111522257-111522279 GTTGCCTCATCTGTAAAATGGGG - Intergenic
936362705 2:111820309-111820331 GTTGCTTCATTTGTAAAAGTAGG - Intronic
936434010 2:112487637-112487659 CGTGTCTCATCTGTAAAATGGGG + Intronic
936525511 2:113238952-113238974 TTTGATGCATTTGTAAAATAGGG + Intronic
936960092 2:118063970-118063992 GTTGACTCACCTGTAAAATGAGG - Intergenic
937704746 2:124906966-124906988 CTTTACAGATTTCTAAAATTAGG - Intronic
937846941 2:126589569-126589591 CTTTTCTCATTTAAAAAATTGGG - Intergenic
937950170 2:127379402-127379424 CCTCACTCCTCTGTAAAATTGGG - Intronic
938611986 2:132957477-132957499 CTTTCCTCATCTGTAAAATGGGG + Intronic
939018574 2:136931303-136931325 ATTTCCTCAATTGTAAAATTCGG - Intronic
939037031 2:137144956-137144978 ATTTTCTCATTTGTAAAAGTAGG + Intronic
939727211 2:145736452-145736474 CGTGTTTCATTTATAAAATTAGG - Intergenic
939880184 2:147622636-147622658 GTTTCCTCATTTGTAAAATGTGG - Intergenic
939986368 2:148833329-148833351 GTTTCCTCATTTGTAAAATGGGG + Intergenic
940590193 2:155714116-155714138 GTTCCTTCATTTGTAAAATTGGG - Intergenic
941127519 2:161602951-161602973 CTTTACTCATTTTAAAAACTGGG - Intronic
941161068 2:162034823-162034845 CTCGTCTCATTTGTAGAAGTTGG - Intronic
941222646 2:162803456-162803478 CTTTCCTCATCTGTAAAATAGGG - Intronic
941341173 2:164305999-164306021 CTTTGCTCATTTAAAAAATTGGG - Intergenic
941378459 2:164761038-164761060 CTTGACTCAGTTATATAATCTGG - Intronic
941465042 2:165815486-165815508 ATTTCCTCATTTGTAAACTTAGG + Intergenic
941516221 2:166482501-166482523 CTTTCCTCATATATAAAATTTGG + Intronic
941579903 2:167282840-167282862 GTCTTCTCATTTGTAAAATTAGG - Intergenic
941727831 2:168883570-168883592 TTTTGCTCATTTGTAAAATGGGG + Intronic
941787378 2:169512979-169513001 CTTTCCTCATTGTTAAAATTAGG - Intronic
942076350 2:172360066-172360088 GTTTCCTCATTTGTAAAATAGGG + Intergenic
942089680 2:172477755-172477777 GTTTCCTCATTTGTAAAATAAGG - Intronic
942126151 2:172827683-172827705 CTTCCCTCATTTGTCAAATGGGG + Intronic
942290508 2:174465340-174465362 GTTTCCTCATTTGTAAAACTAGG - Intronic
942322393 2:174747057-174747079 ATTTTCTCATTTGTAAAATAGGG + Intergenic
942408259 2:175678756-175678778 CCTTTCTCATTTCTAAAATTAGG - Intergenic
942559440 2:177204843-177204865 TTTGGCTCATTTGTAAATTAAGG - Intergenic
942587276 2:177495360-177495382 TTTGAGTCATTTGTAAAGTGGGG - Intronic
942712326 2:178850880-178850902 CATTCCTCATTTGTAAAATGTGG - Intronic
943053757 2:182949407-182949429 CTTTCCTAATTTGTAAAATAAGG + Intronic
943232661 2:185275212-185275234 CTTGACTCCTTTGTAATTTGTGG + Intergenic
943482808 2:188442674-188442696 GTTTCCTCATCTGTAAAATTGGG + Intronic
943513027 2:188850145-188850167 GTTTCCTCATTTGTAAAATGTGG + Intergenic
943736236 2:191358209-191358231 ATTTTCTCATTTGTAAAATAGGG + Intronic
943991624 2:194701150-194701172 CTTTTCTCATTTTTAAAATCAGG - Intergenic
944346728 2:198675422-198675444 ATTCTCTCATTGGTAAAATTGGG + Intergenic
945562166 2:211352439-211352461 ATTCACTCATTTTTAAAAGTAGG + Intergenic
945592055 2:211746005-211746027 ATTTCCTCAATTGTAAAATTGGG + Intronic
945693015 2:213065665-213065687 GTTTCCTCATTTGTAAAATGAGG - Intronic
945697922 2:213132101-213132123 GTTACCTCATTTGTAAAATAGGG - Intronic
945797687 2:214385236-214385258 AGTGCCTCATTTGTAAAATGGGG + Intronic
946208441 2:218128118-218128140 GTTTACTCATCTGTAAAATGGGG - Intronic
946631706 2:221676563-221676585 GTTGTCTCATATGTAAAATGAGG + Intergenic
947075259 2:226336366-226336388 CTTTGCTCATTTAAAAAATTTGG - Intergenic
947216886 2:227758022-227758044 CTTTGCTCATCTGTAAAATGGGG + Intergenic
947755342 2:232559598-232559620 CTTTCCTCATTTGTAAAACATGG - Intronic
947944589 2:234090736-234090758 TTTTCCTTATTTGTAAAATTGGG - Intergenic
1168808410 20:686754-686776 CTTTTCTCATCTGTAAAATGGGG + Intergenic
1168831965 20:850582-850604 GTTTTCTCATTTGTAAAATGAGG + Intronic
1168832042 20:851294-851316 ATTTACTTATTTGTAAAATGAGG + Intronic
1169106923 20:3004317-3004339 GTTTCCTCATCTGTAAAATTGGG - Intronic
1169154309 20:3316435-3316457 GTTTCCTCATTTGTAAAATGAGG + Intronic
1169189130 20:3646121-3646143 GTTTCCTCATTTGTAAAATGGGG - Intronic
1169256438 20:4103553-4103575 CTTTGCCCATTTTTAAAATTGGG - Intergenic
1169498878 20:6140369-6140391 ACTGCCTCATTTGTAAAATGGGG - Intergenic
1169599821 20:7245326-7245348 GTTTTCTCATTTATAAAATTGGG - Intergenic
1169627282 20:7585636-7585658 CTTTACTCTTTTGCTAAATTGGG - Intergenic
1169725371 20:8723677-8723699 CTTGACTCATTTGTAAAATTAGG - Intronic
1169767323 20:9161128-9161150 GTTTCCTGATTTGTAAAATTGGG - Intronic
1169887089 20:10411418-10411440 CCAGACTCATTTTTAAAATATGG - Intronic
1169973009 20:11291172-11291194 CTTCACTCATGTTTTAAATTTGG + Intergenic
1170013963 20:11759561-11759583 CTTTGCCCATTTTTAAAATTGGG + Intergenic
1170033131 20:11963066-11963088 ATTTCCTCATTTGTAAAATTTGG + Intergenic
1170065601 20:12306725-12306747 CTTTACTCATTCCTAAAATATGG + Intergenic
1170184941 20:13578310-13578332 CTTTACTGATTTTTAAAATTTGG + Intronic
1170216526 20:13897570-13897592 CTTTACCCATTTTAAAAATTGGG - Intronic
1170794084 20:19531545-19531567 CTTTACTCATTTATAAAATAGGG - Intronic
1172248025 20:33459319-33459341 CTTTTCTCATCTGTAAAATGAGG + Intergenic
1172328326 20:34055054-34055076 GTTTTCTCATTTGTAAAAATGGG - Intronic
1172385365 20:34530383-34530405 GTTTTCTCATTTGTAAAATGTGG + Intronic
1172632530 20:36388670-36388692 TGTGCCTCATTTGTTAAATTGGG + Intronic
1172871606 20:38139136-38139158 CTTGATTTATTTTTAAAAATTGG - Intronic
1172876556 20:38167911-38167933 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1172973397 20:38889458-38889480 GTTGTCTCATCTGTAAAATGGGG + Intronic
1173073072 20:39788372-39788394 CTTTTCTAATTTGTAAAATGGGG - Intergenic
1173092239 20:39984245-39984267 GTTTACTCATCTGTAAAATGAGG - Intergenic
1173184822 20:40832491-40832513 GTTGCCTCATGTGTTAAATTGGG - Intergenic
1173401491 20:42730035-42730057 CCTTTCTCATTTGTAAAATTAGG - Intronic
1173818328 20:46004644-46004666 CTTTTCTCATTTGTAAAGTGGGG - Intergenic
1173862961 20:46296349-46296371 GTTTACTCATCTGTAAAATGAGG - Intronic
1173909038 20:46650627-46650649 GTTTACTCATGTGTAAAAATGGG - Intronic
1174698264 20:52582018-52582040 CTTGCTTCACTTGTAAAATGGGG - Intergenic
1174815776 20:53685660-53685682 CTTTCCTCATCTGTAAAATGTGG - Intergenic
1174852014 20:54004884-54004906 ATTTGCTCATTTGTAAAAGTGGG + Intronic
1175043436 20:56078288-56078310 CTTTCCTCATTTGCAAAATGTGG + Intergenic
1175395455 20:58656137-58656159 TTTGCCTCATTTGTAAACTGAGG + Intronic
1175470931 20:59227430-59227452 CTTGACTCAGATGTAACATTTGG + Intronic
1175681716 20:60994192-60994214 GTTTCCTCATTTGTAAAATTAGG + Intergenic
1176918751 21:14660120-14660142 CTTTGCTCATTTTTAAAATTTGG + Intergenic
1176921719 21:14695616-14695638 ATTTACTCATTTGTAGAATGAGG - Intergenic
1177535183 21:22417329-22417351 CCTTCCTCATTTTTAAAATTAGG + Intergenic
1177715178 21:24831233-24831255 CTTGCATCATATGTAAAATAGGG + Intergenic
1178124098 21:29498971-29498993 TTTGCCTCATTTGGAAAATCAGG + Intronic
1178201902 21:30416442-30416464 CATGACTTGTGTGTAAAATTGGG - Intronic
1178220394 21:30651033-30651055 CTTGGCTCACTTTTAAAATCAGG - Intergenic
1178590194 21:33903019-33903041 CTTTCCTCATTTGTAAAGTGGGG + Intronic
1178782515 21:35617686-35617708 CTTGACTATTTTGTATAATTTGG - Intronic
1179066928 21:38033739-38033761 CTTTGCCCATTTTTAAAATTAGG + Intronic
1179403926 21:41110026-41110048 CTTTCCTCATTTGTAAAGTAGGG - Intergenic
1181471147 22:23140869-23140891 GTTTCCTCATTTGTAAAATGTGG - Intronic
1181515202 22:23406763-23406785 CTTTGCTCATTTTTTAAATTGGG - Intergenic
1181526877 22:23494769-23494791 GTTGCCTCATCTGTAAAATGGGG + Intergenic
1181539509 22:23565924-23565946 CTTTCCTCATTTGTAAAACGGGG + Intergenic
1181893122 22:26082384-26082406 GTTTACTCATTTGTTAAATATGG - Intergenic
1182046380 22:27277475-27277497 GTTTACTCATCTGTAAAATGGGG + Intergenic
1182209453 22:28662466-28662488 CTTGTCTCATATGTAAGATGGGG + Intronic
1182382179 22:29900634-29900656 ATTGTCTCATCAGTAAAATTGGG - Intronic
1182459291 22:30472558-30472580 CTTGCTTCATTTATAAAATGGGG + Intergenic
1182572597 22:31249934-31249956 GTTGCCTCATCTGTAAAATGGGG - Intronic
1182677749 22:32053086-32053108 CTGGACTCCTTGGTAAAGTTTGG + Intronic
1182764305 22:32747556-32747578 CTTTCCTCATCTGTAAAATAGGG - Intronic
1182792153 22:32961774-32961796 GTTGACTCATTTGTAAAAGGAGG - Intronic
1182824891 22:33256465-33256487 CTTTTCTCATCTGTAAAATGGGG + Intronic
1182896912 22:33866575-33866597 ATTTCCTCATTTGTAAAATGGGG + Intronic
1183004211 22:34887237-34887259 TTTCATTCATTTGCAAAATTTGG + Intergenic
1183138533 22:35914208-35914230 CTTTTCTCATCTGTAAAATTGGG + Intronic
1183640627 22:39090425-39090447 CTTTACTCATCTGTAAAGTGGGG + Intergenic
1183723590 22:39576341-39576363 CTTTCCTCATCTGTAAAATGGGG - Intronic
1184014360 22:41774693-41774715 GTTTTCTCATTTGAAAAATTGGG + Intronic
1184578992 22:45399765-45399787 CTCCACTCATTTCTAGAATTAGG - Intronic
1184802985 22:46773838-46773860 GTTTCCTCATTTGTAAAATAGGG - Intronic
1184813651 22:46854262-46854284 CTTTCCTCATTTGTAAAATGGGG + Intronic
949104061 3:182165-182187 ATTTTCTCATGTGTAAAATTTGG + Intergenic
949276739 3:2292123-2292145 CCTGTCTCATTTGTAAAAAGTGG + Intronic
949297375 3:2541399-2541421 CTTGACTTATTTGCAAAATAAGG - Intronic
949537559 3:5007521-5007543 GTTGCCCCATTTGTAAAATGGGG + Intergenic
949635691 3:5979316-5979338 GTTGCCTCATTTGGAAAATGGGG - Intergenic
949746590 3:7300841-7300863 CTTCACTAGTTCGTAAAATTAGG + Intronic
949795868 3:7850308-7850330 GTTTACTCATTTGTAAAGTAAGG - Intergenic
949806091 3:7957483-7957505 GTTAACTCATCTGTAAAATGAGG - Intergenic
950078148 3:10201951-10201973 GTTTACTCATTTGTAAAATGAGG + Intronic
950317539 3:12017354-12017376 GTTTCCTCATTTGTAAAATTAGG - Intronic
950434173 3:12968496-12968518 GTTTACTCATTGGTAAAATGAGG - Intronic
951213716 3:20003887-20003909 TTTGATTCTTTTGTAACATTTGG - Intronic
951800401 3:26589480-26589502 GTTTCCTCATTTGTAAAATGAGG - Intergenic
952052680 3:29404475-29404497 CTTCACTCATTTATATAAGTTGG - Intronic
952061718 3:29518668-29518690 CTTTATTCATTTTTTAAATTTGG + Intronic
952152802 3:30610655-30610677 CTGGTCTCATTTGTAAAATGAGG + Intronic
952242621 3:31548397-31548419 AATGACTCATTTGTAAAATAGGG + Intronic
952428218 3:33196959-33196981 AGTTACTCATCTGTAAAATTTGG + Intronic
952665380 3:35897836-35897858 TTTTTCTCATTTGTAAAATGGGG - Intergenic
953041370 3:39257679-39257701 CTTGACCCATTAGCAGAATTAGG - Intergenic
953139374 3:40213249-40213271 TTGGCCTCATTTGTAAAATGGGG + Intronic
953298033 3:41741193-41741215 CTTTACTCATTTGTATTTTTAGG - Intronic
953312657 3:41894681-41894703 GTTTCCTCATCTGTAAAATTGGG - Intronic
953357173 3:42265428-42265450 CTTGACGCAGCTGTAAAATGCGG + Exonic
953665098 3:44920098-44920120 ATTGGCTCATTGGTAAAACTTGG - Intronic
954184746 3:48908329-48908351 GTTTGCTCATTTGTGAAATTAGG - Intergenic
954426536 3:50446343-50446365 GTTGCCTCATCTGTAAAATAAGG - Intronic
955014674 3:55058865-55058887 ATTGCCTCATCTGTAAAATCAGG + Intronic
955023981 3:55149274-55149296 CTTGATGCATTTGTAAAATAGGG + Intergenic
955159482 3:56449691-56449713 CTTTTCTCATCTGTAAAATGGGG + Intronic
955169947 3:56553493-56553515 TTTGGCTCATTTTTAAAATTGGG + Intergenic
955260634 3:57386244-57386266 CTGTACTCATTTGTAAAATGAGG + Intronic
955539274 3:59956711-59956733 CTTTAATCATCTGTAAAATGGGG + Intronic
955544105 3:60009252-60009274 CTTGACTCGTTTGTAGAATATGG - Intronic
955809221 3:62769086-62769108 GTTTTCTCATTTGTAAAATGGGG + Intronic
955836407 3:63060423-63060445 CTTCCCTCATCTGTAAAATGGGG - Intergenic
956091385 3:65671128-65671150 GTTGTCTCATCTGTAAAATGGGG - Intronic
956144883 3:66182612-66182634 GTTGCCTCATCTGTAAAATAGGG - Intronic
956149121 3:66222625-66222647 CTTCCCTCATTTGGAAAATTAGG - Intronic
956169310 3:66420116-66420138 CTTGGCTCATTTTAAAAATCAGG - Intronic
956914292 3:73854741-73854763 TTTTCCTCATTTGTAAAATGTGG - Intergenic
957363477 3:79189990-79190012 CACAACTCATTTGTAAACTTGGG - Intronic
957549206 3:81682090-81682112 CTTTGCTCATTTTAAAAATTGGG - Intronic
957933133 3:86908227-86908249 GTTTTCTCACTTGTAAAATTAGG + Intergenic
958163946 3:89854901-89854923 GTTTCTTCATTTGTAAAATTTGG + Intergenic
959689301 3:109181131-109181153 CTTGACTCATCAGCAACATTAGG + Intergenic
959719738 3:109473172-109473194 CTTTGCTCATTTTTAAAATTGGG + Intergenic
959944121 3:112109789-112109811 TTTTTCTCATTTGTAAAATAAGG - Intronic
960185157 3:114629213-114629235 CTTTTCCCATTTGTAAAATAGGG + Intronic
960205861 3:114897145-114897167 GTTTACTCATTTGTAAAACTGGG - Intronic
960487691 3:118273076-118273098 CTTCACTTATTGGTAGAATTAGG - Intergenic
960674517 3:120181434-120181456 ATTTCCTCATCTGTAAAATTAGG + Intronic
960933980 3:122884653-122884675 CTCTACTGATTTGTAAAATGAGG - Intergenic
961865491 3:129950761-129950783 CATGGCTCATTTATAAAATGGGG - Intergenic
962200772 3:133399702-133399724 GTTTACTCATCTGTAAAATGGGG + Intergenic
962215507 3:133517452-133517474 GTTTCCTCATTTGTAAAATGGGG + Intergenic
962218646 3:133544355-133544377 GTTTCCTCATTTGTAAAATGAGG + Intergenic
962328721 3:134458295-134458317 AAAGACTCATTTGTAAAGTTTGG - Intergenic
962445518 3:135460101-135460123 ATTGACTCTTCTGTAAAATGGGG + Intergenic
962453330 3:135540219-135540241 CTTCCCTCATCTGTAAAATGGGG + Intergenic
962537217 3:136340886-136340908 GGTTCCTCATTTGTAAAATTGGG - Intronic
962831207 3:139142922-139142944 CTTGCCTCATTTCTAATCTTTGG - Intronic
962848797 3:139292413-139292435 GCTGACTCATCTGTAAAATGGGG + Intronic
963062669 3:141237501-141237523 GTTTCCTTATTTGTAAAATTTGG + Intronic
963278537 3:143357740-143357762 GTTGCCTCATTTATAAAACTGGG + Intronic
963327936 3:143882381-143882403 GTTTACTCATTTATAAAATGAGG + Intergenic
963382563 3:144550368-144550390 CTTTCCTCATGTGTAAGATTGGG - Intergenic
963717152 3:148816372-148816394 CTGGAGTCATTTGAAAAAGTTGG - Intronic
964207823 3:154194310-154194332 CTTTCCTCATCTGTAAAACTGGG - Intronic
964294034 3:155213836-155213858 ATTTTCTCATTTGTAAAATAAGG - Intergenic
964692614 3:159468545-159468567 GTTCACTCATATGTAAAATGAGG - Intronic
964772297 3:160237321-160237343 CTTTTCTCATCTGTAAAATGGGG - Intronic
964775776 3:160275058-160275080 ATTTCCTCATTTGTAAAATGGGG + Intronic
965256057 3:166412937-166412959 CTTTGCACAGTTGTAAAATTGGG - Intergenic
965428012 3:168551264-168551286 CTTGAGTAATTTGTTAATTTAGG - Intergenic
965453890 3:168873661-168873683 GCTGTCTCATTTGTGAAATTTGG - Intergenic
965596556 3:170417018-170417040 CTTTTCTCATTTGTAAAATAAGG - Intergenic
965727158 3:171730302-171730324 CTTTGCTCATTTGTAAAATGGGG - Intronic
965833259 3:172821980-172822002 CATGTATCATGTGTAAAATTAGG + Intergenic
966020852 3:175207514-175207536 AATGACTCATTTGTATATTTTGG + Intronic
966377421 3:179310762-179310784 CTTGATCCATTTTTAAAATAAGG - Intergenic
966469533 3:180273608-180273630 CCTTTCTCATTTGTAAAATGGGG - Intergenic
966558878 3:181296192-181296214 GTTTGCTCATCTGTAAAATTAGG - Intergenic
966579815 3:181547802-181547824 CTTTGCCCATTTGTTAAATTGGG + Intergenic
966704439 3:182895457-182895479 CTTTCTTCATTTGTAAAATGAGG - Intronic
966811355 3:183847749-183847771 ATTCCCTCATTTGTAAAATGAGG + Intronic
967029787 3:185595102-185595124 CCTGCCTCATCTGTAAAATGGGG - Intronic
967326633 3:188247104-188247126 CTTGACCCATCTGTGAAATGGGG + Intronic
967433615 3:189418712-189418734 GTTTTCTCATTTGTAAAATAAGG - Intergenic
967782302 3:193453354-193453376 CTAGGCTCATTTTTAAATTTAGG - Intronic
968021235 3:195391649-195391671 CTTTCCTCATGTGTAAAACTGGG + Intronic
969029667 4:4201730-4201752 CTTTTCTCATTTGTAAAGTGAGG - Intronic
969147590 4:5137601-5137623 GTTATCTCATTTGTAAAATAGGG - Intronic
969962835 4:10962959-10962981 GTTTCCTCATTTGTAAAATGTGG + Intergenic
970039160 4:11776465-11776487 CTTGAATCATAACTAAAATTCGG + Intergenic
970498209 4:16649646-16649668 GTTCCCTCATTTGTAAAATGGGG + Intronic
970722914 4:19008933-19008955 GTTTACTCATCTGTAAAATTGGG - Intergenic
970830555 4:20334818-20334840 GTTTCCTCATGTGTAAAATTAGG + Intronic
971189678 4:24415407-24415429 CTTCTCTCATTTGTAACATAAGG - Intergenic
971243152 4:24906696-24906718 TTTTATTCATTTTTAAAATTTGG - Intronic
971253528 4:24993063-24993085 GTTGATTCATTTGTAAAATGGGG + Intergenic
971268645 4:25116754-25116776 TTTGACTCATCAGTAAAATGGGG - Intergenic
971866412 4:32177761-32177783 CTTTACTCATCTGTTAAATTAGG - Intergenic
971981502 4:33757115-33757137 TTTTACTCATTTTTTAAATTTGG - Intergenic
972092111 4:35300266-35300288 CTTCATTCATCTGTAAAATAGGG + Intergenic
972308862 4:37860446-37860468 GATTCCTCATTTGTAAAATTGGG - Intronic
972646844 4:40976541-40976563 CTTTACTAATTTTTAAAAGTTGG - Intronic
973616068 4:52679159-52679181 CGTGGGTCATGTGTAAAATTTGG + Intergenic
973760594 4:54111279-54111301 CTTGCCTCATTTGTAAAATAAGG + Intronic
974120576 4:57632939-57632961 CTTGACTCTTTTCTTAAAGTGGG + Intergenic
974397918 4:61363804-61363826 ATTTACTCATCTGTAAAATCGGG - Intronic
974617131 4:64304697-64304719 CTTGACTCAGATGAAACATTTGG - Intronic
974700461 4:65437751-65437773 ATATAGTCATTTGTAAAATTGGG + Intronic
975174270 4:71269742-71269764 CTTTCTTCATTTGTAAAATATGG - Intronic
975603746 4:76130919-76130941 ATTTCCTCATTTGTAAAATAGGG - Intronic
975624646 4:76332955-76332977 TTTGACAGATTTGTAAACTTAGG - Intronic
975831957 4:78378696-78378718 CTTCACCCATTTTAAAAATTGGG + Intronic
975892593 4:79047072-79047094 GTTTACTGATCTGTAAAATTTGG + Intergenic
976204131 4:82608622-82608644 GTTTCCTCATTTGTAAAATGGGG - Intergenic
976218695 4:82738875-82738897 TTTGCCTCATCTGTAAAATGGGG - Intronic
976250252 4:83043054-83043076 ATTTATTCATTTATAAAATTGGG + Intronic
976266443 4:83189961-83189983 TGTGACTCTTGTGTAAAATTTGG - Intergenic
976470273 4:85420243-85420265 CTTGACTTCTTTTTAAAATATGG - Intergenic
976594633 4:86883570-86883592 GTTTTCTCATTTGTAAAATGGGG - Intronic
976946525 4:90776739-90776761 GTTTCCTCATTTGTAAAATGGGG - Intronic
977032619 4:91905716-91905738 CTTTTCTCATTTGTCAACTTTGG - Intergenic
977180019 4:93862496-93862518 CTTGACACCTTTGTCAAAATAGG - Intergenic
977267342 4:94871087-94871109 GTTTTCTCATCTGTAAAATTGGG - Intronic
977778798 4:100955846-100955868 TTTTCCTCATTTATAAAATTAGG - Intergenic
977888735 4:102282048-102282070 GTTCCCTCATTTGTAAAATGGGG - Intronic
978018290 4:103776282-103776304 CTTTCCTCATCTGTAAAATGGGG + Intergenic
978312453 4:107399580-107399602 CTTGATTCATCTGTAAGATGGGG - Intergenic
978652914 4:111029313-111029335 CTTTATTCATTTTCAAAATTAGG + Intergenic
978893726 4:113859853-113859875 CTTTACTCATCTCTAAAATGGGG - Intergenic
979014080 4:115410099-115410121 TTTGTCTCATTTTTAGAATTAGG - Intergenic
979129300 4:117020662-117020684 GTTTTCTCATTTGTAAAATGAGG - Intergenic
979234374 4:118383454-118383476 GTTTCCTCATTTGTAAAATGAGG - Intergenic
979441920 4:120760008-120760030 CTTTCCTCATTTGTAAACTAGGG - Intronic
979660654 4:123250515-123250537 CTGGAATTATTTGCAAAATTGGG + Intronic
980211413 4:129792981-129793003 GTTTCCTCATTTGTAAAATAGGG - Intergenic
980310201 4:131118040-131118062 CTTGGCTGCTTTGTAAAATTGGG + Intergenic
980543254 4:134222973-134222995 CATTCCTAATTTGTAAAATTAGG + Intergenic
980841686 4:138268939-138268961 GTTCCCTCATTTGTAAAATAGGG - Intergenic
981057239 4:140375389-140375411 GTTTCCTCATTTGTAAAATGTGG - Intronic
981272761 4:142863914-142863936 TTTGTCTAATTTTTAAAATTTGG + Intergenic
981357408 4:143805478-143805500 CTTTTCTCATTTGTAAAGTAAGG - Intergenic
981368818 4:143934721-143934743 CTTTTCTCATTTGTAAACTAAGG - Intergenic
981378618 4:144044975-144044997 CTTTTCTCATTTGTAAACTAAGG - Intergenic
981667286 4:147244020-147244042 CTTGAATCTCTTGTAAGATTTGG - Intergenic
982199031 4:152942227-152942249 GTTTTCTCATTTGTAAAATTAGG - Intronic
982534217 4:156588553-156588575 CTTTGCCCATTTTTAAAATTGGG - Intergenic
982548433 4:156764419-156764441 GTTCACTCATGTGTAAAATAGGG - Intronic
982689043 4:158527878-158527900 CTTAACTCACTTTTAAAAGTGGG + Intronic
983632831 4:169867058-169867080 CTTAACTGATTGGTAAACTTGGG - Intergenic
983799619 4:171910463-171910485 TTGGAATTATTTGTAAAATTTGG + Intronic
984514025 4:180716202-180716224 CTTTACTCAGTTGTAAAATGAGG + Intergenic
984574954 4:181437384-181437406 GTTTCCTCATTTGTAAAACTGGG - Intergenic
984582679 4:181528635-181528657 CTTTCCTTATTTGTAAAATGAGG - Intergenic
984689159 4:182706296-182706318 GTTGCCTCATTTGTGAAATAAGG + Intronic
985907217 5:2849121-2849143 CTTGACTAAATTGTACATTTTGG - Intergenic
986098431 5:4583161-4583183 CTTTGCTTATTTGTAAATTTTGG + Intergenic
986671249 5:10145012-10145034 ATTTACTCATTTGTAAAATGAGG - Intergenic
987215239 5:15729850-15729872 TTTTTCTCATTTGTAAAATGGGG - Intronic
987754535 5:22083934-22083956 TTTAGCTCTTTTGTAAAATTAGG + Intronic
987970708 5:24940287-24940309 ATTGACTCATTTGTACCCTTTGG - Intergenic
988491421 5:31708593-31708615 CATGATTTATTTGTAAAGTTGGG + Intronic
988865802 5:35333252-35333274 GTTGTCTCATATGTAAAATTGGG + Intergenic
989030167 5:37110704-37110726 CTTTCCTCATTTGCAAAATGGGG - Intronic
989446057 5:41530025-41530047 CTTTGCTCATTTTTAAAATCAGG - Intergenic
989748468 5:44860862-44860884 GTTGCCTCATTTGTAAAACTGGG - Intergenic
990041683 5:51384336-51384358 CTTGACTCATTTTTAAAAGGAGG - Intronic
990308480 5:54516947-54516969 CTTTCCTCATCTGTAAAATAGGG + Intergenic
990434450 5:55774029-55774051 CTTCACTCATTTTAACAATTGGG + Intronic
990458559 5:56012658-56012680 CTTTCCTCATCTGTAAAATGGGG - Intergenic
990506052 5:56446644-56446666 CTTTAGTCCTTTGGAAAATTTGG + Intergenic
990641969 5:57796430-57796452 CTTTTCTCATCTGTAAAATAAGG + Intergenic
991032546 5:62097706-62097728 CTTTCCTCATCTGTAAAATGGGG - Intergenic
991140563 5:63236115-63236137 CTTGTCTCATTTTTTTAATTGGG + Intergenic
991184477 5:63791320-63791342 CTTTACACATTAATAAAATTAGG - Intergenic
991203319 5:64019838-64019860 CTTGTGTTAATTGTAAAATTAGG - Intergenic
991422166 5:66452871-66452893 ATTCACCCATCTGTAAAATTGGG - Intergenic
991456740 5:66811982-66812004 ACTGCTTCATTTGTAAAATTAGG - Intronic
991532049 5:67626313-67626335 TTTGGCTCATTTTTAAAATCAGG + Intergenic
992051721 5:72947171-72947193 ATTTTCTCATTTGTAAAATTGGG + Intergenic
992446213 5:76836504-76836526 GTTTCCTCACTTGTAAAATTAGG + Intergenic
992872017 5:81016513-81016535 CTTCAGTTGTTTGTAAAATTTGG + Intronic
993088197 5:83391133-83391155 TTTTCCTCATTTGTAAAATGTGG + Intergenic
993157331 5:84242282-84242304 CTTTCCTCATCTGTAAAACTGGG - Intronic
993237142 5:85326311-85326333 CTTGGACCATTTTTAAAATTAGG + Intergenic
993520391 5:88892323-88892345 GTTTCCTCATTTGTAAAATGTGG + Intronic
993585633 5:89724132-89724154 CTTTAGTCATTAGTAAAAATGGG + Intergenic
993617290 5:90129194-90129216 GTTGACTCATTTGCAACATGGGG + Intergenic
993628484 5:90254846-90254868 CTTGACCCAGTTGTAAAATGTGG + Intergenic
993929210 5:93917306-93917328 ATTTTCTCATTTGTAAAATGGGG - Intronic
994190294 5:96861703-96861725 CTTTCCTCATTTGTAAAGTGGGG - Intronic
994332113 5:98518640-98518662 GTTTACTCATCTGTAAAATGGGG + Intergenic
994680204 5:102877131-102877153 GTTTTCTCATCTGTAAAATTGGG + Intronic
994683502 5:102920148-102920170 GTTTTCTCATCTGTAAAATTGGG + Intronic
994707171 5:103220652-103220674 GTTGCCTCATTGGTAAAACTGGG + Intergenic
995140600 5:108731417-108731439 CTTTCCTCATCTGTAAAATAAGG - Intergenic
995259775 5:110089795-110089817 GTTTCTTCATTTGTAAAATTGGG - Intergenic
995261631 5:110110839-110110861 CTTTCCTCATTTGTAAAATATGG + Intergenic
995949582 5:117694292-117694314 TTTGTCTCATTTGGAAAATATGG - Intergenic
996252314 5:121350840-121350862 CTTGAATTACTTGTAAAATATGG + Intergenic
996253098 5:121362713-121362735 TTTTACTCATTTGTTAAAATGGG - Intergenic
996351673 5:122549739-122549761 CTTTGCTCATTTAAAAAATTCGG - Intergenic
996446317 5:123555988-123556010 GTTCCCTCATCTGTAAAATTGGG - Intronic
996734012 5:126742233-126742255 TTTGAGTCCTTTGTAAAATCTGG + Intergenic
996805211 5:127446950-127446972 CTTGACTCGATTTTAAATTTAGG + Intronic
996866437 5:128128663-128128685 ATTTTCTCATTTGTAAAATGAGG + Intronic
996949292 5:129106742-129106764 GTTTATTCATTTGTAAAATCAGG - Intronic
997121753 5:131180858-131180880 ATTTTCTCATTTGTAAAAATAGG - Intronic
997701579 5:135904721-135904743 CAGAACTCATTTGTAAAATCTGG + Intergenic
998135472 5:139671970-139671992 GTTGCCTCATCTGTAAAATGAGG + Intronic
998671502 5:144359082-144359104 CTTTTCTCATTTGAAAAATAAGG - Intronic
998741253 5:145204810-145204832 CTTTCCTCATTAGTAAAATAAGG + Intergenic
998774035 5:145578850-145578872 GTTTACTCATTTATAAAATTGGG - Intronic
998822775 5:146071786-146071808 GTTTTCTCATTTGTAAAATGAGG + Intronic
998852458 5:146364224-146364246 AGTTTCTCATTTGTAAAATTGGG - Intergenic
999045489 5:148464410-148464432 TTTGGCCCATTTTTAAAATTAGG - Intronic
999294087 5:150447205-150447227 GTTTCCTCATATGTAAAATTAGG - Intronic
999453877 5:151698761-151698783 TTTTGCTCATTTGTAAAATGAGG + Intergenic
999526616 5:152413277-152413299 CTTTTCTCATCTGTAAAATGTGG - Intronic
999566103 5:152863664-152863686 ATTGACTCAGATGTGAAATTTGG - Intergenic
999742753 5:154568976-154568998 GTTTCCTCATTTGTAAAATGAGG + Intergenic
999773018 5:154789701-154789723 CTTGTCTAATTTGTATCATTAGG + Intronic
999823842 5:155255435-155255457 ATTCCCTCATTTGTAAAATGAGG - Intergenic
999854283 5:155576902-155576924 CTTTCCTCATGTGTAAAATGGGG - Intergenic
999861276 5:155649295-155649317 CTTTCCTCATCTGTAAAATGGGG + Intergenic
999877513 5:155824279-155824301 GTTGCCTCATTTGTAAAATGGGG + Intergenic
999908761 5:156172483-156172505 ATTTCCTCATTTATAAAATTAGG + Intronic
999948334 5:156621592-156621614 CTTCCCTTACTTGTAAAATTTGG - Intronic
1000021097 5:157320163-157320185 TTTTCCTCATTTGTAAAATGGGG + Intronic
1000046924 5:157529752-157529774 GTGGTCTCATTTGTAAAATGTGG - Intronic
1000171967 5:158711509-158711531 ATTTTCTCATCTGTAAAATTGGG - Intronic
1000445477 5:161313754-161313776 GTTCCCTCATTTGTAAAATGGGG - Intronic
1000652912 5:163839045-163839067 CTTTGCCCATTTGTAAAATCTGG + Intergenic
1000849904 5:166327445-166327467 ATTGTCTCATCTGTAAAATTAGG - Intergenic
1000899803 5:166899000-166899022 GTTTTCTCATTTGTAAAATCTGG + Intergenic
1000990598 5:167908015-167908037 GTTTCCTCATTTGTAAAATGAGG + Intronic
1001024508 5:168212717-168212739 TTCTACTCATTTTTAAAATTTGG - Intronic
1001052955 5:168427369-168427391 GATGCCTCATTTGTAAAACTTGG - Intronic
1001589739 5:172857187-172857209 GTTTCCTCATTTGTAAAATGGGG + Intronic
1001682230 5:173566688-173566710 CTTTCCTCATCTGTAAAATGGGG + Intergenic
1001827288 5:174755446-174755468 CTTTACTCATTTAAAAAATTGGG + Intergenic
1001867147 5:175115603-175115625 ACTTACTCATCTGTAAAATTAGG - Intergenic
1001875024 5:175192685-175192707 CTTTGCTCATCTGTAAAATGGGG - Intergenic
1001889862 5:175329866-175329888 CTTTCCTCATCTGTAAAATGGGG - Intergenic
1003128032 6:3371610-3371632 GTTTTCTCATTTGTAAAATGGGG + Intronic
1003388927 6:5695570-5695592 ATTTCCTCATCTGTAAAATTGGG - Intronic
1003714198 6:8628121-8628143 CTTGACTTTTCTGTAGAATTTGG + Intergenic
1003744938 6:8990081-8990103 GTTTCCTCATCTGTAAAATTTGG + Intergenic
1003774718 6:9347437-9347459 TTTTTCTCATTTGTAAAATGAGG + Intergenic
1003831765 6:10019560-10019582 ATTTACTCATCTGTAAAATGGGG + Intronic
1004724960 6:18302456-18302478 GTTTCCTCATTTGTAAAATATGG - Intergenic
1004892509 6:20114990-20115012 CTTTCCTCATCTGTAAAATGGGG + Intronic
1005329867 6:24739462-24739484 GTTTTCTCATTTGTAAAATGGGG + Intergenic
1005398601 6:25408566-25408588 CTTTCCTCATCTGTAAAATATGG - Intronic
1005424710 6:25690263-25690285 TTTTTCTTATTTGTAAAATTAGG + Intronic
1005502457 6:26441700-26441722 ATTGACTAATTTGTAGAAATGGG + Intronic
1005669917 6:28094981-28095003 CTAGACTCATTTGGAAGATGCGG - Intergenic
1006785499 6:36664027-36664049 GTTGCCTCATCTGTAAAATGGGG + Intergenic
1006793210 6:36716905-36716927 CTGGGCTCATTTGTAAAATGGGG - Intronic
1006794797 6:36725006-36725028 CTTTCCTCATCTGTAAAATGGGG - Intronic
1006837814 6:37009640-37009662 GTTTCCTCATTTGTAAAATGGGG + Intronic
1006962468 6:37947431-37947453 GTTTCCTCATTTGTCAAATTGGG + Intronic
1007216311 6:40242375-40242397 ATTTGCCCATTTGTAAAATTGGG + Intergenic
1007405565 6:41634261-41634283 GTTGCCTCATCTGTAAAATGGGG + Intergenic
1007449088 6:41929764-41929786 GTTTCCTCATTTGTAAAATAGGG - Intronic
1007819461 6:44550287-44550309 CTTCTCCCATTTGTAAAATGGGG - Intergenic
1008148786 6:47924530-47924552 GTTATCTCATTTGTAAAATGAGG + Intronic
1008421669 6:51307966-51307988 ATTTCCTCATTTGTAAAATGGGG + Intergenic
1008497726 6:52150166-52150188 GTTTACTCATCTGTAAAATGGGG + Intergenic
1008628483 6:53341521-53341543 GTTTCCTCATCTGTAAAATTGGG + Intronic
1008868434 6:56243693-56243715 GTTTCCTCATTGGTAAAATTGGG - Intronic
1009843713 6:69109563-69109585 ATTTTCTCATTTGTAAAATAGGG - Intronic
1009941683 6:70296728-70296750 TTTTACTCAATTGTGAAATTGGG + Intronic
1010348582 6:74843124-74843146 CTTAGCCCATTTTTAAAATTTGG + Intergenic
1010665275 6:78621971-78621993 ATTTAATCATTTTTAAAATTTGG + Intergenic
1010977800 6:82336099-82336121 CTTTTCTCATCTTTAAAATTAGG + Intergenic
1011049940 6:83135071-83135093 ATTCCCTCACTTGTAAAATTAGG - Intronic
1011638413 6:89397043-89397065 CTTGTTTCACTTTTAAAATTGGG - Intronic
1012077019 6:94701626-94701648 ATTGACTCACTTTTAAACTTTGG - Intergenic
1012080622 6:94753500-94753522 TTTTACTCATTTTTTAAATTGGG + Intergenic
1012431337 6:99166752-99166774 CTTTCCTCATCTGTAAAATGGGG - Intergenic
1012464579 6:99503140-99503162 GTTTACTTATTTATAAAATTAGG - Intronic
1012708668 6:102569104-102569126 TTTGACTAATTTCTAACATTAGG + Intergenic
1012829775 6:104189402-104189424 ATTTTCTCATTTGTAAAACTTGG + Intergenic
1012886720 6:104855060-104855082 GTTTTCTCATTTGTAAAATGAGG - Intronic
1012910302 6:105110294-105110316 CTTTACTCATCTATAAAATGAGG + Intronic
1013492172 6:110658981-110659003 GTTTACTCATCTGTAAAATGGGG - Intronic
1013678931 6:112500775-112500797 CTTTTCTCATTTGTAAAATGGGG + Intergenic
1013846302 6:114456357-114456379 ATTTGCTCATTTGTAAAATATGG + Intergenic
1013980685 6:116124662-116124684 GTTTCCTCATTTGTAAAATAAGG - Intronic
1014015459 6:116525141-116525163 GTTCCCTCATTTGTAAAATGAGG + Intronic
1014022004 6:116602065-116602087 ATTTCCTCATCTGTAAAATTAGG + Intergenic
1014155328 6:118102985-118103007 CTTTACCCATCTGTAAAATTAGG + Intronic
1014222112 6:118808132-118808154 TTTCTCTCATTTGTAAAATAGGG + Intergenic
1014271580 6:119342492-119342514 GTTTCCTCATTTGTAAAATGAGG - Intronic
1014360584 6:120468480-120468502 CTTTTCTCATCTGTAAAATAAGG + Intergenic
1014520125 6:122432653-122432675 CTTGGCTTATTTTTAAAACTGGG + Exonic
1014611705 6:123556179-123556201 ATTCACTCATTTGTAAAGTAAGG - Intronic
1014879556 6:126706234-126706256 GTTGACTCATCTGAAAAATGAGG - Intergenic
1014910474 6:127086827-127086849 CTTGCCTCTTTTGTAAAAACTGG + Intergenic
1014969755 6:127800104-127800126 TTTTTCTCATCTGTAAAATTGGG + Intronic
1015491621 6:133833090-133833112 TTTTCCTCATTTGTAAAATGAGG - Intergenic
1016247557 6:142001996-142002018 CTTGAAAAATTGGTAAAATTTGG + Intergenic
1016583037 6:145650662-145650684 TTTGGCTTATTTATAAAATTAGG - Intronic
1016772954 6:147872508-147872530 GTTTCCTCATTTGTAAAATGAGG - Intergenic
1017071723 6:150580769-150580791 TTTTACTCATTTACAAAATTAGG - Intergenic
1017315579 6:153027645-153027667 CTTTGCTCATCTGTAAAATGGGG - Intronic
1017412635 6:154185454-154185476 CTGAACTGATTTGTAAAGTTTGG - Intronic
1017432945 6:154388919-154388941 CTTGGCCCATTTGTAAAAATTGG + Exonic
1017435301 6:154410195-154410217 GTTTTCTCATCTGTAAAATTAGG - Intronic
1017436324 6:154418984-154419006 CTTTACCCATTTTTAAAATCAGG - Intronic
1018036422 6:159886511-159886533 CTTTCCTCATCTGTAAAATGGGG + Intergenic
1018161477 6:161048136-161048158 CTTTTCTCATTGATAAAATTAGG - Intronic
1018204108 6:161420800-161420822 CTTTCTTCATTTGTAAAATCAGG - Intronic
1018205582 6:161434654-161434676 ATTTTCTCATTTGTAAAATGAGG + Intronic
1018622484 6:165744032-165744054 AATGCCTCCTTTGTAAAATTGGG + Intronic
1019152443 6:170017812-170017834 GTTTTCTCATTTGTAAAATTGGG + Intergenic
1020258303 7:6515102-6515124 GTTTCCTCATTTGTAAAATGGGG + Intronic
1020509022 7:9029250-9029272 GTTTCCTCATCTGTAAAATTGGG + Intergenic
1020634205 7:10676848-10676870 TTTGGTTCATTTTTAAAATTTGG + Intergenic
1020766149 7:12323838-12323860 ATTCCCTCATTTGTAAAATGGGG - Intergenic
1020904496 7:14048424-14048446 TTTTTCTCATTAGTAAAATTAGG - Intergenic
1021233824 7:18118180-18118202 CTTGGCTCATTTGTGAAGTAGGG - Intronic
1021945589 7:25723665-25723687 ATTTACTCATCTGCAAAATTAGG + Intergenic
1022189520 7:28003820-28003842 CTTGACTCAAATATAAATTTAGG + Intronic
1022226525 7:28369156-28369178 TTTGACTCATTTTTAGCATTGGG - Intronic
1022291127 7:29004666-29004688 ATTTTCTCATTTGTAAAATGGGG + Intronic
1022351662 7:29571851-29571873 CTCTACTCTTCTGTAAAATTGGG + Intergenic
1022496128 7:30854240-30854262 CTTTCCTCATTTGTAAAATGTGG + Intronic
1022521094 7:31007349-31007371 ATTTCCTCATCTGTAAAATTAGG + Intergenic
1022627858 7:32056558-32056580 GTTTCCTCATCTGTAAAATTTGG + Intronic
1022824598 7:33995982-33996004 CTTTCCTCATTTATAAAATGGGG + Intronic
1022883622 7:34618501-34618523 TTTAACACATTTGAAAAATTGGG + Intergenic
1022939270 7:35216432-35216454 CTTTTCTCATCTGTAAAATAAGG + Intronic
1023589176 7:41763040-41763062 CTTGAAAGATTTTTAAAATTGGG - Intergenic
1023593854 7:41808475-41808497 GTTTATTCATTTGTAAAATCTGG + Intergenic
1023944662 7:44794202-44794224 CTTTACGCATCTGTAAAATGGGG + Intergenic
1023991765 7:45132919-45132941 CCTTCCTCATTTGTAAAATGGGG + Intergenic
1024193255 7:47034092-47034114 CTTGACAAATTTCTAAAATACGG + Intergenic
1024909797 7:54433773-54433795 TTTTTCTCATTTGTTAAATTAGG - Intergenic
1025870942 7:65433755-65433777 GTTCACTCATATGTAAAATGAGG - Intergenic
1025925068 7:65952099-65952121 CTTTTCTCAACTGTAAAATTGGG - Intronic
1025941188 7:66077042-66077064 CTTTCCTCATTTGTGAAATAGGG + Intronic
1026095234 7:67341564-67341586 CAGTCCTCATTTGTAAAATTGGG + Intergenic
1026501780 7:70948862-70948884 ATTGACTCAGCTGTAAAGTTGGG - Intergenic
1027655239 7:80921951-80921973 CATGACTCATCTGTATAATAGGG - Intronic
1027754723 7:82198215-82198237 GTTTCCTCATTTGTAAAATATGG - Intronic
1028005568 7:85562178-85562200 CTTGACTCATTGGTGAAAACTGG - Intergenic
1028028929 7:85884305-85884327 GTTGACTCATTTGTAAAGCAAGG - Intergenic
1028124382 7:87095098-87095120 CTTTCCTCATTTGTAAAATAGGG - Intergenic
1028208870 7:88049228-88049250 CTTTTCTCACTTGTAAAATGGGG + Intronic
1028611406 7:92716211-92716233 ATTGATTCATTTGTAAAAGCAGG + Intronic
1028630932 7:92932937-92932959 GTTTCCTCATTAGTAAAATTAGG - Intergenic
1028680166 7:93519436-93519458 GTTTACTCATTTGTACAATTAGG + Intronic
1028791758 7:94861270-94861292 GTTTTCTCATTTGTAAAATATGG + Intergenic
1028920001 7:96300357-96300379 CTTTCCTCATTTATAAAATGGGG + Intronic
1029993204 7:104981237-104981259 ATTTTCTCATTTGTAAAATGAGG - Intergenic
1030096774 7:105907598-105907620 GTTTACTCATCTGTAAAATGGGG - Intronic
1030229509 7:107192289-107192311 CTTGACTAATTTCTAGAACTTGG - Intronic
1030349762 7:108470806-108470828 CATATCTCATTTGTAAAATGAGG - Intronic
1030481458 7:110110051-110110073 CATGCCTCATTTTTTAAATTGGG + Intergenic
1030596552 7:111546886-111546908 TTTGTTTCATTTTTAAAATTTGG - Intronic
1030680862 7:112432586-112432608 ATTTCCTCATTTGTAAAATGGGG - Intronic
1030724819 7:112914688-112914710 CTTGACTCATTAATAAATTATGG - Intronic
1030908678 7:115219099-115219121 CTTCATTCATCTGTAAAACTGGG + Intergenic
1030916018 7:115314422-115314444 GTTTGCTCATATGTAAAATTAGG + Intergenic
1031269397 7:119627414-119627436 CTTGGCACATTTGTTAAATTAGG + Intergenic
1031680768 7:124671519-124671541 GTTTCCTCATTTTTAAAATTGGG + Intergenic
1031746709 7:125507123-125507145 TTTTACTCATCTGTAAAATAGGG - Intergenic
1032126938 7:129202221-129202243 GTTGCCTCATCTGTAAAATGGGG - Intronic
1032230829 7:130072532-130072554 CTTTACTCATTCTCAAAATTGGG + Intronic
1032270103 7:130397270-130397292 CTTGAATCTTGTGGAAAATTGGG + Exonic
1032278785 7:130484570-130484592 GTTTTCTCATTAGTAAAATTAGG + Intergenic
1032612673 7:133432318-133432340 CTTTACTCATTTGTAAAATGTGG + Intronic
1032938509 7:136761796-136761818 GTTTCCTCATCTGTAAAATTAGG - Intergenic
1033193137 7:139301581-139301603 TTTGACTCATGTATAGAATTAGG + Exonic
1033249163 7:139743946-139743968 CTTCATTCATTTAAAAAATTAGG - Intronic
1033441684 7:141385871-141385893 CTGGAATCATTTTTAAAGTTAGG - Intronic
1033802258 7:144915049-144915071 ATTCCCTCATTTGTAAAATAAGG + Intergenic
1034217066 7:149415937-149415959 GCTTTCTCATTTGTAAAATTGGG - Intergenic
1034217071 7:149415987-149416009 TTTTTCTCATTTGTAAAATTGGG - Intergenic
1034701910 7:153103907-153103929 CTTGACTTATTAGTAAAGTGGGG + Intergenic
1034734160 7:153413257-153413279 CTTGATTGAGTTGTAAAGTTGGG + Intergenic
1035342980 7:158176390-158176412 CTTTCCTCATTTGCAAAATGTGG - Intronic
1035588047 8:791122-791144 CTTGCATTATTTTTAAAATTCGG - Intergenic
1036027943 8:4931049-4931071 CTTGACTTATCTGTAATAATTGG + Intronic
1036123626 8:6044059-6044081 CTAGAGTCATGTGTAAAATGTGG - Intergenic
1037062249 8:14528942-14528964 GCTGATTCATCTGTAAAATTAGG - Intronic
1037451109 8:19015710-19015732 GTTTCCTCATTTATAAAATTGGG + Intronic
1037555314 8:20016637-20016659 GTTTCCTCATTTGTAAAATTAGG + Intergenic
1037633764 8:20681229-20681251 ATTATCTCATTTGTAAAATGAGG - Intergenic
1037835999 8:22215026-22215048 GTTGGCTCAGTTGTAAAATAAGG + Intergenic
1038073573 8:24045761-24045783 CTTTGCTCATTTTTAAAACTGGG + Intergenic
1038352337 8:26788648-26788670 TTTTCCTCATTTGTAAAATGGGG - Intronic
1038628034 8:29213373-29213395 CTTCCCTCATTTATAAAATGTGG - Intronic
1038737388 8:30183959-30183981 CTTGAATTATTTTAAAAATTTGG - Intergenic
1039007587 8:33057423-33057445 CTAGCATCATTTGTAGAATTGGG + Intergenic
1039030585 8:33304942-33304964 CTTGAGTTCTTTGTAAATTTTGG - Intergenic
1039341132 8:36651397-36651419 ATTTACTCACTTGTAAACTTAGG - Intergenic
1039787738 8:40848622-40848644 GTTGACTCATCTGTAAAACAGGG + Intronic
1040775527 8:51038533-51038555 CTTTTCTTATTTGAAAAATTGGG + Intergenic
1041325191 8:56655799-56655821 GTTGTCTCATTTGTAAAATTGGG - Intergenic
1041688370 8:60665306-60665328 CATGAGACATTTATAAAATTTGG + Intergenic
1041748763 8:61236770-61236792 ATTTCCTCATTTGTAAAATGAGG - Intronic
1041896904 8:62935451-62935473 GTTTACTCATCTGTAAAATGAGG - Intronic
1041973584 8:63771677-63771699 TTTTACTCATTTGTAAACTGTGG + Intergenic
1042080184 8:65043129-65043151 GTTTACTCATTTGTAAAATACGG - Intergenic
1042281034 8:67056254-67056276 TTTGTCTCATCTGTAAAATAAGG + Intronic
1042450676 8:68941780-68941802 TTTTTCTCATTTGTAAAATTAGG + Intergenic
1042651128 8:71042465-71042487 GTTTACTCATCTGTAAGATTAGG + Intergenic
1042809869 8:72812430-72812452 CTTGTCTCATTTGTAACAGCAGG + Intronic
1043359818 8:79459193-79459215 TTTTACTCATTTGTAAATTGGGG - Intergenic
1043633118 8:82362342-82362364 CTTTCCTCATTTATAAAATAAGG - Intergenic
1043769117 8:84175291-84175313 CTTTCCTCATCTGTAAAATGAGG + Intergenic
1044146078 8:88715449-88715471 GTTTACTCATTTATAAAATAAGG - Intergenic
1044388809 8:91624084-91624106 GTTTCCTCATTTGTAAAATGAGG - Intergenic
1044465547 8:92499545-92499567 ATTGTCTTATGTGTAAAATTCGG - Intergenic
1044513927 8:93116667-93116689 GTTTTCTCATTTGTAAAATGGGG + Intergenic
1044607918 8:94063147-94063169 TTAGTCTCATTTGTAAAATGAGG + Intergenic
1044761205 8:95519705-95519727 GTTTCCTCATTTGTAAAATGCGG + Intergenic
1044786959 8:95804578-95804600 CTTTGCCCATTTTTAAAATTGGG - Intergenic
1044789012 8:95826800-95826822 CTTCACCCATTTTTAAAAATTGG + Intergenic
1044818839 8:96141761-96141783 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1044917374 8:97129396-97129418 GTTTACTCATCTGTAAAATGAGG + Intronic
1045008199 8:97934272-97934294 GTTGCCTCATCTGTAAAATGGGG + Intronic
1045118571 8:99011603-99011625 ATTAATTCATTTGTATAATTTGG + Intergenic
1045258473 8:100550489-100550511 TTTGGCTCATTTTTAAAATCAGG + Intronic
1045287180 8:100802192-100802214 GTTCACTCATATATAAAATTAGG + Intergenic
1045365580 8:101472770-101472792 CTTGTCTGATTTGAAAATTTAGG + Intergenic
1045457529 8:102396335-102396357 TTTTACTCATTTGTAAGATGAGG - Intronic
1045468750 8:102492339-102492361 GTTTCCTCATTTGTAAAATAGGG - Intergenic
1046190036 8:110782650-110782672 CTTTGCTCATTTTTAAAATTGGG + Intergenic
1046516156 8:115263908-115263930 CATGACTTATTTGTGAAATTTGG + Intergenic
1046539736 8:115564241-115564263 CTTGACTCAATTGTACACATTGG + Intronic
1046695540 8:117335307-117335329 CTTTTGTCATTTGTACAATTGGG + Intergenic
1046829768 8:118731551-118731573 ATTTCCTCATCTGTAAAATTGGG - Intergenic
1046830226 8:118737635-118737657 TTTCACTCATTTGTAAAATTCGG + Intergenic
1046953155 8:120037265-120037287 ATTTACTCATCTGTAAAATGGGG - Intronic
1047255067 8:123208038-123208060 GTTTACCCATTTGTAAAACTTGG - Exonic
1047310693 8:123689200-123689222 ATTTCCTCATCTGTAAAATTTGG + Intronic
1047351974 8:124082900-124082922 CTTCCTTCATTTGTAAAATGCGG - Intronic
1047456935 8:125023498-125023520 CTGGCATCATCTGTAAAATTAGG - Intergenic
1047530055 8:125666176-125666198 TTTTCCTCATTTGTAAAATAGGG + Intergenic
1047963798 8:130030635-130030657 GTTGACTCATCAGTAAAATGAGG + Intergenic
1048027789 8:130602442-130602464 GTTTCCTCATTTGTAAAATGAGG + Intergenic
1048111944 8:131477284-131477306 ATTTTCTCATTTGTAAAATAAGG - Intergenic
1048112606 8:131485112-131485134 CTTGGGTGATTTGTAAAACTTGG - Intergenic
1048141457 8:131798706-131798728 GTTGTCTCATTTGTAATATAGGG - Intergenic
1048398341 8:134036991-134037013 CTTTTCTCATTTATAAAATAGGG - Intergenic
1048481075 8:134793812-134793834 CTGGATTCATTTGTAAAATGGGG - Intergenic
1048789841 8:138090798-138090820 CTTGAGTCATTTGTCAGTTTGGG - Intergenic
1050292373 9:4168294-4168316 CTTGTCTTATATGTATAATTAGG - Intronic
1050331630 9:4551743-4551765 CTTGCCTCATTTGCAACATCTGG + Intronic
1050494393 9:6225501-6225523 CTTTCCTCATCTGTAAAATAAGG + Intronic
1050641621 9:7674201-7674223 TTTTCCTCATTTGTAAAATGAGG - Intergenic
1050684545 9:8152983-8153005 ATTGGCTCATTTTTAAAAATGGG - Intergenic
1051222969 9:14869594-14869616 CTTTCCTCATTTGTTAAATGAGG + Intronic
1051758788 9:20436973-20436995 GTTTGCTCATTTGTAAAATGAGG - Intronic
1051869462 9:21720142-21720164 CTTGCCTCATTTGTGAAATGAGG + Intergenic
1051934549 9:22430416-22430438 GTTTTCTTATTTGTAAAATTAGG + Intergenic
1051938203 9:22470375-22470397 GTTTACTCATTTATAAAATTGGG - Intergenic
1052126799 9:24786016-24786038 GTTTACTCATTTGAAAAATAGGG + Intergenic
1052288997 9:26821406-26821428 CTTGACTTATTGGTTAAATGAGG - Intergenic
1052320670 9:27164191-27164213 ATTTCCTCATCTGTAAAATTAGG + Intronic
1052393746 9:27912349-27912371 TTTGGCTCATTTTTTAAATTGGG + Intergenic
1052554422 9:29995910-29995932 CTTTCCTCATTTATAAAATAAGG + Intergenic
1052875773 9:33561361-33561383 CTTTGCCCATTTGTTAAATTGGG + Intronic
1053292312 9:36889268-36889290 ATTTCCTCATTTGTAAAATGGGG - Intronic
1053330594 9:37203189-37203211 ATTTCCTCATTTGTAAAATAGGG + Intronic
1053500238 9:38582982-38583004 CTTTGCCCATTTGTTAAATTGGG - Intergenic
1053536559 9:38932184-38932206 CTTCACCCATTTTTAAAAATTGG + Intergenic
1053574072 9:39340067-39340089 CTTGAATTACGTGTAAAATTAGG - Intergenic
1053625109 9:39862156-39862178 CTTGAATTACGTGTAAAATTAGG - Intergenic
1053838633 9:42168313-42168335 CTTGAATTACGTGTAAAATTAGG - Intergenic
1053879760 9:42581072-42581094 CTTGAATTACGTGTAAAATTAGG + Intergenic
1053892905 9:42713252-42713274 CTTGAATTACGTGTAAAATTAGG - Intergenic
1054095638 9:60898760-60898782 CTTGAATTACGTGTAAAATTAGG - Intergenic
1054117099 9:61174698-61174720 CTTGAATTACGTGTAAAATTAGG - Intergenic
1054218786 9:62388542-62388564 CTTGAATTACGTGTAAAATTAGG + Intergenic
1054231931 9:62520627-62520649 CTTGAATTACGTGTAAAATTAGG - Intergenic
1054590655 9:67007870-67007892 CTTGAATTACGTGTAAAATTAGG + Intergenic
1054629576 9:67431755-67431777 CTTCACCCATTTTTAAAAATTGG - Intergenic
1054988990 9:71299412-71299434 ATTCCCTCATTTGTAAGATTGGG - Intronic
1055080177 9:72261082-72261104 GTTGACCCAATTGTAAAACTGGG - Intergenic
1055211556 9:73801037-73801059 CTTTGCCCATTTTTAAAATTAGG - Intergenic
1055258430 9:74401927-74401949 ATTGACTCAATTGAAATATTTGG - Intergenic
1056075807 9:83039153-83039175 CTTGACTGATTTGTAGCATTTGG - Intronic
1056300699 9:85237595-85237617 TTTGACTCATTTCTAAACTTTGG - Intergenic
1056559717 9:87719393-87719415 CTGTACTCATCTGTAAAATGGGG + Intergenic
1056566401 9:87776681-87776703 CTGTACTCATCTGTAAAATGGGG - Intergenic
1057523749 9:95781826-95781848 CTGTTCTCATTTGTAAAATTGGG + Intergenic
1057574364 9:96229965-96229987 CTTGATTCATTTTTAAAATGAGG - Intergenic
1057710163 9:97433676-97433698 CTTTGCTCGTTTTTAAAATTAGG - Intronic
1058009279 9:99958525-99958547 TTTTTCTCATTTGTAAAATAAGG - Intronic
1058076834 9:100660017-100660039 GTTTTCTCATTTGTAAAATGGGG - Intergenic
1058100034 9:100908927-100908949 GTTTCCTCATTTGTAAAATGAGG + Intergenic
1058256980 9:102778710-102778732 ATTCACTCATATGTAACATTAGG + Intergenic
1058356821 9:104093453-104093475 TTTAACTCATTTGTAAAACGAGG + Intergenic
1058437967 9:104981410-104981432 TTTGGCTAATTTATAAAATTAGG - Intergenic
1058513752 9:105748486-105748508 ACTGTCTCATTTGTAAAATGAGG + Intronic
1058590624 9:106561072-106561094 CTAGCCTCATCTGTAAAATAGGG - Intergenic
1058647530 9:107144548-107144570 CTTTTCTCAGTTGTAAAATAAGG - Intergenic
1058706632 9:107642852-107642874 ATGTACTCATTTGTAAAATGGGG + Intergenic
1058712409 9:107691740-107691762 GTTTCCTCATTTATAAAATTGGG + Intergenic
1058713938 9:107706494-107706516 ATTTCCTCATCTGTAAAATTGGG - Intergenic
1058785183 9:108380058-108380080 GTTTCCTCATTTGTAAAAATGGG - Intergenic
1058788255 9:108413590-108413612 GTTTACTCATTTGTAAAACAAGG - Intergenic
1059052965 9:110948088-110948110 ATTGTCTCATTTGTAAATTAAGG + Intronic
1059241675 9:112811356-112811378 AGTGACTCAATTGTAAATTTTGG + Intronic
1059291914 9:113233172-113233194 CTTGCCTCAGCTCTAAAATTGGG - Intronic
1059343083 9:113610523-113610545 GTTTACTCATTGGTAAAATGTGG + Intergenic
1059374192 9:113869572-113869594 TTTTTCTCATCTGTAAAATTGGG - Intergenic
1059529347 9:115021481-115021503 CTTGACTCAGGTGAAAAACTGGG - Intronic
1059672504 9:116504956-116504978 ATATACTCATTTGTAAATTTGGG - Intronic
1059758320 9:117314434-117314456 CTTGGCTCATATTTTAAATTGGG - Intronic
1059758856 9:117319368-117319390 CTTGACTCAACTGTAAAATGGGG + Intronic
1059770474 9:117419051-117419073 CTTTTCTCATTTGTGAAATGGGG + Intergenic
1060346966 9:122825704-122825726 CTTTGCTCATTTAAAAAATTAGG - Intronic
1060570919 9:124639430-124639452 TTGGCCTCATTTGTAAAATCGGG - Intronic
1060636987 9:125207119-125207141 GTTTACTCATTTGTGAAATGAGG - Intronic
1060796550 9:126515967-126515989 CTTTTCTCATCTGTAAAATGGGG + Intergenic
1060882205 9:127125102-127125124 CTTTCCTCATCTGTAAAATGGGG + Intronic
1061259784 9:129473713-129473735 GTTGCCTCATCTGTAAAATGGGG - Intergenic
1061342789 9:129996556-129996578 CATGACTGATTTGTGAAATTAGG - Intronic
1061414314 9:130438136-130438158 CTTCTCTCATTTGTGAAATGGGG - Intergenic
1061520574 9:131115123-131115145 CTTTCCTCATCTGTAAAATGGGG - Intronic
1185846721 X:3444146-3444168 CTTTAATCATATGTAAAATTTGG + Intergenic
1186764573 X:12757812-12757834 CTTTCCTCATCTGTAATATTGGG - Intergenic
1187370826 X:18704548-18704570 CTTTTCTCATTTTTGAAATTGGG - Intronic
1187590796 X:20714989-20715011 GTTTACTTATTTGTAAAATAGGG + Intergenic
1188117674 X:26264703-26264725 CTTTGCTCATTTGTAAAATGAGG + Intergenic
1188446864 X:30262981-30263003 CTTTTCTCATCTGTAAATTTGGG + Intergenic
1188505683 X:30881727-30881749 GTTTCTTCATTTGTAAAATTAGG - Intronic
1188593536 X:31868655-31868677 CCTTACTCAGTTGTAAGATTGGG - Intronic
1188614978 X:32146824-32146846 GTTGTCTCATCTGTAAAATGGGG - Intronic
1188815799 X:34712553-34712575 CATGAATCATTTTCAAAATTGGG + Intergenic
1189300052 X:39945926-39945948 CTTTCCTCATTTGTAAAATGGGG + Intergenic
1189440801 X:41034253-41034275 CTTTATGCATTTGAAAAATTTGG + Intergenic
1189563560 X:42215863-42215885 CTTGACCCATTTGGAATCTTAGG + Intergenic
1189624384 X:42880209-42880231 GTTTTCTCATTTGTAAAATACGG - Intergenic
1189727170 X:43978922-43978944 TTTTGCTCATTTTTAAAATTAGG - Intergenic
1189825544 X:44912981-44913003 CTTTCCTCATCTGTAAAATAAGG + Intronic
1190443244 X:50496724-50496746 GTTTCCTCATTTGTAAAATGAGG + Intergenic
1190755723 X:53400154-53400176 TTTTCCTCATTTGTAAAATTAGG - Intronic
1190817485 X:53940921-53940943 ATTTTCTCATATGTAAAATTAGG - Intronic
1191754997 X:64583195-64583217 GTTTTCTCATTTGTAAAATAAGG + Intergenic
1191771556 X:64765795-64765817 GTTCCCTCATTTGTAAAATAGGG + Intergenic
1191859292 X:65652795-65652817 GTTTTCTCACTTGTAAAATTGGG + Intronic
1191901188 X:66042131-66042153 TTAGACACATTTGTAAAATGGGG - Intergenic
1191915602 X:66198340-66198362 GTTTCCTCATTTGTAAAAATGGG + Intronic
1191967735 X:66778579-66778601 CTTCACTCATTTGTAAAGTAGGG + Intergenic
1191976275 X:66875171-66875193 GTTTACTCATCTGTAAAATGGGG - Intergenic
1191999271 X:67130825-67130847 GTTTGCTCATTTGTAAAATGGGG + Intergenic
1192048118 X:67698014-67698036 GTTAACTAATTTGTAAAATGGGG - Intronic
1192048568 X:67702124-67702146 GTTTATTCATTTGTAAAATAGGG + Intronic
1192180740 X:68914178-68914200 CTTTTCTCATCTGTAAAATAGGG - Intergenic
1192236907 X:69301876-69301898 CTTGAACCATTTGTGAAATGAGG + Intergenic
1192364476 X:70459753-70459775 CTTTCCTCATTTGTAAAATGGGG - Intronic
1192437102 X:71149653-71149675 GTTTCCTCATCTGTAAAATTGGG - Intronic
1192814468 X:74576560-74576582 TTTGTCTCATTTGTGATATTGGG + Intergenic
1193188950 X:78546460-78546482 CTAGTCTCATTTATAAAATTAGG - Intergenic
1193268628 X:79503919-79503941 CTTTACTCCTTTTTAAAATATGG - Intergenic
1193853596 X:86570768-86570790 TTTTACTCATTTTAAAAATTGGG + Intronic
1193931490 X:87558281-87558303 TTTCTCTCATTTGTAAAATGAGG + Intronic
1194392104 X:93331800-93331822 CATGACTCGTTTGTGAAATTTGG - Intergenic
1194761919 X:97804942-97804964 GTTTCCTCATTTGTAAAACTGGG - Intergenic
1194775711 X:97961543-97961565 GTTTTCTCATTTGTAAATTTGGG + Intergenic
1194965536 X:100284671-100284693 TTTTCCTCATCTGTAAAATTAGG + Intergenic
1195550718 X:106166767-106166789 TTTTACTCATTTTTAAAATCAGG - Intergenic
1195590868 X:106624502-106624524 GTTTACTCATCTGTAAAATATGG + Intronic
1195608585 X:106837360-106837382 CTTTAACCATTTTTAAAATTGGG - Intronic
1195752634 X:108173723-108173745 CTTTCCTCATCTGTAAAAATTGG - Intronic
1195830431 X:109052177-109052199 CTTGACTCAACTGTAACATCAGG + Intergenic
1196179437 X:112673658-112673680 ATTTGCTCATTTGTAAATTTAGG - Intronic
1196729305 X:118925117-118925139 TTTGACTTATTTTTAAATTTTGG + Intergenic
1196931123 X:120683149-120683171 CTTGGCTCCATTGTAACATTTGG - Intergenic
1196997296 X:121397954-121397976 GTTTCCTCATTTGTAAAATGGGG + Intergenic
1197071366 X:122301973-122301995 TTTGGCCCATTTTTAAAATTAGG + Intergenic
1197149363 X:123203387-123203409 CTTTTCCCATTTGTAAAATAAGG + Intronic
1197253184 X:124235800-124235822 TTTGTCTAATATGTAAAATTGGG - Intronic
1197498073 X:127210199-127210221 GTTTTCTCATTTGTAAAATGGGG + Intergenic
1197688198 X:129466908-129466930 TTTGGCTCATCTATAAAATTTGG - Intronic
1197839732 X:130733190-130733212 CTTAACTTGTTTTTAAAATTAGG - Intronic
1198020740 X:132655460-132655482 GTTTTCTCATTTGTAAAATGGGG - Intronic
1198122206 X:133605306-133605328 CTTGCCTCACCTGTAAAATGGGG + Intronic
1198122393 X:133607144-133607166 ATTTCCTCATTTGTAAAATGAGG - Intronic
1198144161 X:133838335-133838357 CTTGACTTATTTGTAAGACATGG - Intronic
1198162190 X:134018837-134018859 GTTCACTCATATGTAAAATGAGG + Intergenic
1198411872 X:136378552-136378574 CTTGTCTTATTTTTAATATTAGG + Intronic
1198451252 X:136768554-136768576 GTTGAGTCATCTGTAAAATGAGG - Intronic
1198674723 X:139119838-139119860 CTTGCCTCATCTGTAAAATGGGG - Intronic
1198708362 X:139474366-139474388 GTTTACTCATCTGTAAAATAAGG - Intergenic
1198710315 X:139494764-139494786 CCTCACTTATTTTTAAAATTTGG - Intergenic
1198914141 X:141648368-141648390 GTTTCCTCATTTGAAAAATTGGG + Intronic
1199230508 X:145432167-145432189 CTTTGCTCATATGTAAAATAAGG - Intergenic
1199306503 X:146272980-146273002 ATTTTGTCATTTGTAAAATTGGG - Intergenic
1199555144 X:149099624-149099646 GATGACTCATTTGCAAATTTTGG - Intergenic
1199715061 X:150501978-150502000 TTGGCCTCATTTGTAAAATAAGG + Intronic
1201293215 Y:12441950-12441972 CTTGACTGATTTGTAAGAGATGG - Intergenic