ID: 1169726689

View in Genome Browser
Species Human (GRCh38)
Location 20:8741390-8741412
Sequence ATGAGTAAGTAGATGAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 1, 1: 1, 2: 6, 3: 81, 4: 546}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169726689 Original CRISPR ATGAGTAAGTAGATGAATGA TGG Intronic
900433581 1:2615059-2615081 TTGAGTAAATAAATAAATGAGGG + Intronic
900535872 1:3177032-3177054 ATGAGTTAACAGATGGATGAGGG - Intronic
900869361 1:5290910-5290932 ATGAGTGGATGGATGAATGAAGG + Intergenic
901215581 1:7553211-7553233 ATAAGTGAGTGAATGAATGAGGG + Intronic
901699960 1:11039973-11039995 ATGGGTGGGTGGATGAATGAGGG + Intronic
901700219 1:11041321-11041343 ATGGGTAGGTAGAAGGATGATGG + Intronic
901750989 1:11408367-11408389 ATGAATAAGTGAATGAATGAAGG - Intergenic
902398004 1:16142926-16142948 ATGAGTAGATGGATGGATGAGGG + Intronic
902938190 1:19779933-19779955 ATGAGTGAATAACTGAATGAGGG + Intronic
903046761 1:20570115-20570137 ACAAATAAATAGATGAATGAGGG - Intergenic
903187205 1:21635383-21635405 ATGACTGAGCAGAGGAATGAAGG - Intronic
903277392 1:22230905-22230927 ATGAGTGGGTGGATGGATGATGG - Intergenic
903277442 1:22231099-22231121 ATGAGTGGGTGGATGGATGATGG - Intergenic
903285106 1:22271905-22271927 ATGAGTGAATGAATGAATGATGG - Intergenic
903474263 1:23608541-23608563 ATGAATGAATGGATGAATGAAGG + Intronic
903579157 1:24358108-24358130 ATGAATGTGTAAATGAATGAAGG + Exonic
903611867 1:24620737-24620759 CTAAGTAAGTAGATAGATGAGGG - Intergenic
903830311 1:26170487-26170509 AGGAGTAAGGAGAGGATTGATGG + Intronic
905194251 1:36262347-36262369 ATGATTAAGTTAATGAATGATGG + Intronic
905323833 1:37136496-37136518 ATGAGGGAGCATATGAATGAGGG + Intergenic
905477406 1:38238807-38238829 ATGATTAAGTAAATGAATGACGG + Intergenic
906527841 1:46506800-46506822 ATGAATGAGTGGGTGAATGAAGG + Intergenic
906706387 1:47898092-47898114 ATGAATGAGCAGATGAAGGAAGG + Intronic
906875928 1:49539252-49539274 ATATGTAAGTGGATGAATTAAGG + Intronic
907245173 1:53103796-53103818 AGAAGTAAGAAGAGGAATGAAGG - Intronic
907912969 1:58842834-58842856 ATGAATGAGTGAATGAATGAAGG - Intergenic
908034239 1:60034694-60034716 ATGAATAAGTATATAAATCAGGG - Intronic
908462104 1:64355983-64356005 ATGAATTAGTGAATGAATGATGG - Intergenic
908696383 1:66847043-66847065 ATGACTAAGTAATTGAATGCAGG + Intronic
908857948 1:68450309-68450331 ATAAGTGAGTTAATGAATGAGGG - Intergenic
909319386 1:74264064-74264086 ATGAGAAAATAGAAGAAGGAGGG + Intronic
909869101 1:80716899-80716921 ATGAAAAAGTATATGACTGAAGG - Intergenic
910214598 1:84830381-84830403 AGGAGGAAGAATATGAATGAGGG - Intronic
911461043 1:98191525-98191547 ATGAGTGAATAAATCAATGAAGG - Intergenic
911817935 1:102377858-102377880 ATGAATAATTAGACAAATGATGG + Intergenic
912227791 1:107755121-107755143 ATGAGTATGTAGGGGGATGAGGG + Intronic
913116374 1:115701448-115701470 ATGAGTGGGTAAATGCATGAGGG + Intronic
913527497 1:119708128-119708150 CTGATTGAGTGGATGAATGAAGG + Intronic
914352114 1:146849434-146849456 ATGAGTGAGTGAGTGAATGATGG - Intergenic
916244262 1:162671261-162671283 AGGAGTAAGTAGAGGACTGTAGG - Intronic
916290838 1:163164642-163164664 ATTAATAAGTAAATGAATGATGG + Intronic
916544859 1:165794373-165794395 TTGAGTCAGTAAATGAAGGAAGG + Intronic
917100095 1:171436508-171436530 AAGAATGAGTAGCTGAATGAAGG - Intergenic
917154152 1:171978054-171978076 ATGAATGAGTAGATGACTGAAGG - Intronic
917282299 1:173389907-173389929 ATGAATAAATATATTAATGAAGG - Intergenic
917471648 1:175330877-175330899 AGGAAGAAGCAGATGAATGAGGG - Intronic
918264053 1:182823419-182823441 AGGAGGAAGTAGATTTATGATGG - Intronic
918295643 1:183153706-183153728 ATATGTAAGTAAATGAATAAGGG - Intergenic
918881471 1:190128487-190128509 ATGAGTTGGTTGATGAATAAAGG + Intronic
918892439 1:190293329-190293351 ATCAGTAACAAGAGGAATGATGG - Intronic
920624387 1:207582337-207582359 ATGACTAAATGGATGATTGAGGG - Intronic
921891481 1:220358369-220358391 ATCAGTCAGTGGATGAATGTAGG + Intergenic
922792944 1:228320398-228320420 ATGAGTATGTAGATGGCAGATGG - Intronic
923980529 1:239317327-239317349 ATGAGAAATTACATGAAGGAAGG - Intergenic
924600657 1:245485864-245485886 ATGAATAAATAAATGAAGGAAGG + Intronic
1063114245 10:3063082-3063104 GTGAGTGAGTGGATGAGTGAAGG - Intergenic
1063222091 10:3978657-3978679 ATATGTTAGTAAATGAATGAAGG + Intergenic
1063388394 10:5631809-5631831 ATGAATAGATAGATGACTGATGG + Intergenic
1063538651 10:6910222-6910244 TGGAGTAAGTAGATGAGTGGAGG + Intergenic
1065585178 10:27210764-27210786 ATAAGTAAGTAAATCAATAAAGG + Intronic
1065710316 10:28510344-28510366 ATGAGGAAGAAGAAGAATGTGGG - Intergenic
1065863859 10:29896194-29896216 ATGAGTAAGTGCTTGAAGGAAGG + Intergenic
1066573410 10:36798928-36798950 ATGAATAAATGAATGAATGAGGG + Intergenic
1067209812 10:44250667-44250689 ATGAATATATAGATAAATGATGG - Intergenic
1068081690 10:52326308-52326330 AGGAGAAAGTTGTTGAATGAAGG - Intergenic
1068170186 10:53382746-53382768 ATGAGTGAGTAGAAAAATAACGG - Intergenic
1068487969 10:57683712-57683734 ATGAATAAATAAATGTATGAGGG + Intergenic
1069515350 10:69072818-69072840 ATAAATAAATAAATGAATGAAGG + Intergenic
1071421744 10:85507144-85507166 ATGAATAAATAAATGAATTATGG - Intergenic
1071870728 10:89791054-89791076 ATTAGCAAGAAGATGATTGATGG + Intergenic
1071951625 10:90709800-90709822 ATGAGCAAGAGGATGAATGTGGG - Intergenic
1072692620 10:97581804-97581826 ATAAATAAATAAATGAATGAGGG - Intronic
1073168069 10:101475710-101475732 ATGAGTAAATAAATAAATGAGGG + Intronic
1073666203 10:105536483-105536505 ATGAGTTAGGTGTTGAATGATGG + Intergenic
1074099940 10:110346925-110346947 ATGAATAAGGGAATGAATGAAGG + Intergenic
1074148881 10:110740710-110740732 CTGAGTAAGGGGATGAATAAAGG - Intronic
1074417606 10:113280938-113280960 ATGAGTAAGTGAAGGAATAAAGG - Intergenic
1074960091 10:118436619-118436641 ATGAAAAAGTGAATGAATGAAGG - Intergenic
1076276964 10:129208388-129208410 ATGAATTAGTAAATAAATGAGGG + Intergenic
1077172442 11:1173653-1173675 ATGAGTAAAGGAATGAATGAGGG - Intronic
1078579402 11:12526923-12526945 ACCAGTAAATAGATGGATGAAGG + Intronic
1079554102 11:21738411-21738433 ATGAATGAATAAATGAATGATGG + Intergenic
1079641143 11:22806981-22807003 ATGGGTAAGTACATGAATCATGG + Intronic
1079704971 11:23604036-23604058 ATGAATAGATAAATGAATGAAGG - Intergenic
1080349343 11:31365206-31365228 TTGAGTCAATAGGTGAATGAAGG + Intronic
1080488342 11:32734642-32734664 ATGAGTTAGGAGATGCTTGAAGG - Intronic
1080805915 11:35653302-35653324 ATGAATAAGTTAATGACTGAAGG + Intergenic
1080955229 11:37085873-37085895 TTGAATAAATAAATGAATGAGGG - Intergenic
1081689427 11:45067243-45067265 ATGAGTAAGTTCATGCATGTGGG - Intergenic
1082739616 11:56896067-56896089 ATGACTGAATAAATGAATGAAGG + Intergenic
1082791484 11:57349091-57349113 ATGAGTAAGTCAATGAAGGGGGG - Intronic
1084456752 11:69272258-69272280 GTGGATGAGTAGATGAATGATGG - Intergenic
1084461884 11:69300800-69300822 ATGAGTGGGTGGATGGATGAAGG + Intronic
1084501230 11:69536613-69536635 CTGAGTCAGTGAATGAATGAAGG + Intergenic
1084596401 11:70119350-70119372 ATGGGTGGGTGGATGAATGATGG + Intronic
1084596508 11:70119891-70119913 ATGGGTGGGTAGATGGATGATGG + Intronic
1084781802 11:71414776-71414798 ATGGGTGGGTAGATGGATGATGG + Intergenic
1084785637 11:71440319-71440341 ATGGGTAAATGGATGGATGACGG + Intronic
1086000134 11:81973751-81973773 ATGATTAAGTAAATAAATGGAGG + Intergenic
1086237629 11:84651098-84651120 ATGAATAGATTGATGAATGAAGG - Intronic
1086338443 11:85823092-85823114 TTGAGTAAGTGAATAAATGAAGG - Intergenic
1087195110 11:95297309-95297331 CTAAGTGAGTAAATGAATGAAGG + Intergenic
1087357841 11:97117418-97117440 ATGAATAAGTAGGTGAAGTATGG + Intergenic
1087390441 11:97524095-97524117 ATTACTAAGTAGGTGAAAGAGGG + Intergenic
1087879841 11:103403142-103403164 ATGACTAATTAGATGATTGGAGG + Intronic
1087909623 11:103738108-103738130 ATGAGTAAGTGAATGAATGGTGG + Intergenic
1088633450 11:111796559-111796581 ATGATTAAGCAGCTGAATAATGG + Intronic
1089040392 11:115443154-115443176 ATTACTAATTAGGTGAATGAAGG + Intronic
1089580074 11:119476197-119476219 ATGAATAGATGGATGAATGATGG + Intergenic
1089859702 11:121577929-121577951 ATGAATGAGTGGATGAATGGTGG + Intronic
1090268016 11:125366407-125366429 ATCAATGAATAGATGAATGATGG - Intronic
1090929870 11:131287602-131287624 ATGAATAAGTAAATGAATGTTGG + Intergenic
1091187354 11:133658452-133658474 ATGGGTAGATGGATGAATGATGG + Intergenic
1091695724 12:2626907-2626929 ATGAGTAAATAAATGGACGAAGG + Intronic
1091791045 12:3272373-3272395 ATGAATAAATGAATGAATGATGG - Intronic
1091825939 12:3512789-3512811 ATGAATAAGTAAATGAACTATGG + Intronic
1091979198 12:4851895-4851917 ATGAGTGAGGAAATAAATGAAGG + Intronic
1093689074 12:22089094-22089116 ATGATCCAGGAGATGAATGAAGG + Intronic
1093789113 12:23226473-23226495 ATGTGTGAGTAAATGAATAAAGG - Intergenic
1094195758 12:27748310-27748332 ATGAATAAGTAAATGAATAATGG + Intronic
1094348876 12:29500710-29500732 ATGAGTAAATGAAAGAATGAAGG + Intergenic
1094349793 12:29511436-29511458 ATGAATGAATAAATGAATGATGG + Intronic
1094682814 12:32680961-32680983 ATGAGGAAGTAAAAGAATTAGGG + Intronic
1095503072 12:42861806-42861828 TTGAATCAATAGATGAATGAAGG - Intergenic
1095982353 12:47980673-47980695 AGGAGGAAGCAGGTGAATGAGGG + Intronic
1096416870 12:51422088-51422110 TTGAATTAATAGATGAATGATGG + Intronic
1098750607 12:74289338-74289360 ATAAATGAGTAGATGAATAAAGG - Intergenic
1099217355 12:79869198-79869220 GTGAATAGGTAGATGAATGATGG - Intronic
1099451960 12:82818715-82818737 ATGAGAAAGTAAATAAGTGATGG - Intronic
1099480715 12:83162589-83162611 TTGAGCAAGTAGGTAAATGATGG - Intergenic
1099971904 12:89509174-89509196 ATGAGTAAACAGATAAATGGAGG - Intronic
1100043208 12:90345516-90345538 ATGAGCAGGTAGAAGAATGAGGG + Intergenic
1100214050 12:92429202-92429224 ATGAGCAAGGAGATGGATGCTGG - Exonic
1100359709 12:93864985-93865007 ATGAATAAACAAATGAATGAGGG + Intronic
1100664829 12:96739634-96739656 ATGAGTGAATAGAAGAATAAAGG - Intronic
1100705530 12:97196469-97196491 ATGAGTAAATGGATGAACTAAGG - Intergenic
1100866024 12:98857655-98857677 ATGAATGAATAAATGAATGAAGG + Intronic
1101377089 12:104180631-104180653 ATGCATAAGTAAATGAAAGAAGG - Intergenic
1101560902 12:105857161-105857183 GTGAATTGGTAGATGAATGATGG + Intergenic
1102043045 12:109812954-109812976 ATGAATGAGTAGATGATAGATGG + Intronic
1102856132 12:116295631-116295653 ATGAATGGGTAGATGAATGATGG + Intergenic
1102894442 12:116587478-116587500 ATGGGTAGCTAGATGGATGAAGG - Intergenic
1103178918 12:118890497-118890519 ATGAATAGATAGATGTATGAGGG + Intergenic
1103278319 12:119732838-119732860 ATGAGCAAGTTGATGAAAAATGG + Intronic
1104001295 12:124862470-124862492 ATGAATGAGTGAATGAATGAAGG - Intronic
1104813973 12:131635343-131635365 ATGAGAAGGTAGATGGATGATGG - Intergenic
1105524527 13:21164314-21164336 AGGAGAAAGTAGATAAATTATGG - Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106007625 13:25785834-25785856 ATGAGGAAGAAGATAAAGGAAGG + Intronic
1106558671 13:30831003-30831025 TTTGCTAAGTAGATGAATGAAGG - Intergenic
1106708434 13:32306279-32306301 ATGAGTAATTGGAAGAAAGAAGG + Intronic
1106900610 13:34351423-34351445 ATGAATGAGTAGAGGGATGATGG + Intergenic
1108545394 13:51488407-51488429 ATGAGTAATTGGATGGATTATGG - Intergenic
1108752345 13:53461090-53461112 ATTAGTAAGTAGAGGAGTAATGG - Intergenic
1108916454 13:55618966-55618988 ATAAATAAGTAAATCAATGACGG + Intergenic
1109137260 13:58668905-58668927 AAAACTAAGTAGATGAATGCAGG - Intergenic
1109912160 13:68928135-68928157 GTGATTAAGTAATTGAATGAAGG + Intergenic
1111012540 13:82330198-82330220 AAAAATAAGTAAATGAATGAGGG + Intergenic
1111167829 13:84485348-84485370 CTGAGAAATTAGATAAATGATGG + Intergenic
1111395711 13:87666661-87666683 ATGAGTATTCTGATGAATGAAGG + Intergenic
1111954223 13:94739581-94739603 ATAAGTAAGAAGAAGAGTGATGG + Intergenic
1112102341 13:96203026-96203048 ATGAATGAGTAAATGAGTGAGGG - Intronic
1113243205 13:108363478-108363500 ATGAGTAAATAAATAAATGGTGG - Intergenic
1113322193 13:109244895-109244917 GTGAGTAAGGAGAAGAATGTTGG + Intergenic
1114902370 14:27079377-27079399 AGGTGTATATAGATGAATGATGG + Intergenic
1115689932 14:35832173-35832195 AAGAGGAAGTAGACTAATGAAGG - Intronic
1116283691 14:42945108-42945130 ATGATTAAGTAGATGATCCAAGG - Intergenic
1118194274 14:63610306-63610328 ATCAGTAAATAAATAAATGAGGG + Intronic
1118772545 14:68951820-68951842 ATGAATGAGTGAATGAATGATGG - Intronic
1120092041 14:80343119-80343141 ATGAGTAACTTGATGAATTTTGG + Intronic
1120774447 14:88418135-88418157 ATGATGAAGAAGAAGAATGAAGG - Intronic
1121528964 14:94639323-94639345 ATGAATGAGTGAATGAATGAAGG + Intergenic
1121816038 14:96929211-96929233 ATAGATAGGTAGATGAATGAAGG - Intronic
1121890283 14:97583792-97583814 ATGGGTGAGTGAATGAATGATGG + Intergenic
1122867600 14:104614518-104614540 ATGAGTGAGTGGGTGGATGAAGG + Intergenic
1123083186 14:105705678-105705700 ATGGATGAGTGGATGAATGAAGG - Intergenic
1123779415 15:23611172-23611194 ATGAGTAAGAAGATGAAAGCTGG + Intronic
1125105157 15:35962224-35962246 TTTGCTAAGTAGATGAATGAAGG - Intergenic
1125568990 15:40700171-40700193 ATGAGTTAGTAGGTGAATGTGGG - Intronic
1126925283 15:53578485-53578507 ATAAATAAATAAATGAATGATGG + Intronic
1127604517 15:60573005-60573027 CTGAGTAAGTACATGAGTGTGGG + Intronic
1128237435 15:66077840-66077862 ATGGGTCAGTGGATGAAAGAGGG + Intronic
1128314248 15:66650374-66650396 ATGAATGAGTAAATTAATGAGGG + Intronic
1128518954 15:68362821-68362843 ATGAATTAGTGGATGGATGATGG + Intronic
1128773824 15:70303552-70303574 ATGAGTGGGTAGATGAGTGGAGG + Intergenic
1129170714 15:73805879-73805901 ATGGGTGGGTAGATGAGTGAAGG - Intergenic
1129182778 15:73887460-73887482 ATGAGTGAGTGAGTGAATGAAGG + Intronic
1129187910 15:73921748-73921770 GTGAGTGAGTGGATGAATGAAGG + Intergenic
1130095429 15:80852002-80852024 ATGAGGAAGTAGAAGACTGTGGG + Intronic
1130545439 15:84854585-84854607 ATGAGATAGAAAATGAATGAAGG - Intronic
1132319062 15:100911491-100911513 ATGAATGAGCAAATGAATGATGG - Intronic
1132358493 15:101191874-101191896 GTGAGTAGATAGATGGATGAAGG - Intronic
1132645095 16:995402-995424 ATGAGTGAATGAATGAATGAAGG + Intergenic
1132918888 16:2371951-2371973 ATGACTATGTAGATGGATTAAGG + Intergenic
1133302425 16:4790810-4790832 ATAAGTAAGTAAATAAATAAAGG + Intronic
1133728997 16:8562800-8562822 ATGAGTGAGTAAATGAGTGAGGG + Intergenic
1133729003 16:8562860-8562882 ATGAGTGAGTAAATGAGTGAGGG + Intergenic
1133729021 16:8563261-8563283 ATGAGTCAGTGAATGAGTGAGGG + Intergenic
1133729048 16:8563781-8563803 CTGAGTGAGTAAATGAGTGAGGG + Intergenic
1133729079 16:8564365-8564387 ATGAGTCAGTGAATGAGTGAGGG + Intergenic
1133729087 16:8564449-8564471 GTGAGTGAGTAAATGAGTGAGGG + Intergenic
1133729121 16:8564849-8564871 ATGAGTGAGTGAATGAATGAGGG + Intergenic
1133758660 16:8781096-8781118 ATGATGGAGGAGATGAATGAGGG + Intronic
1133910022 16:10057113-10057135 ATGTGTGAATGGATGAATGATGG - Intronic
1134224741 16:12381437-12381459 ATGGGTGGGTAGATGAATGATGG - Intronic
1134224857 16:12381822-12381844 ATGGGTGAGTGGATGGATGATGG - Intronic
1134766934 16:16767316-16767338 AAGAGTAGGTATATGAATGGTGG - Intergenic
1135086494 16:19478794-19478816 ATGGGTAAATGGATGGATGATGG - Intronic
1135538601 16:23313141-23313163 ATGAATAAATGAATGAATGATGG + Intronic
1135684300 16:24485940-24485962 ATGAGCTAGAAGATGACTGAAGG - Intergenic
1135818025 16:25653701-25653723 AAGAGTAAGGGGATGAAGGAAGG - Intergenic
1135840292 16:25870059-25870081 ATGCATAAGTGGATGAATGATGG - Intronic
1135840301 16:25870114-25870136 ATGAATGGGTGGATGAATGAAGG - Intronic
1135933145 16:26756711-26756733 ATGTGTGGGTGGATGAATGATGG + Intergenic
1135971242 16:27073577-27073599 ATGAGTGAGCACATGAGTGAAGG + Intergenic
1136291317 16:29273354-29273376 ATGAGTGAGTGAATGAGTGAAGG + Intergenic
1137071078 16:35905305-35905327 ATGGGTAATTATATGCATGACGG + Intergenic
1137403750 16:48174314-48174336 ATGAGTGGGAGGATGAATGAAGG + Intronic
1137412275 16:48239007-48239029 TTGAGTAAGTAAATAAATGGGGG + Intronic
1137580075 16:49628194-49628216 ATGGGTGGGTAGATGAAGGATGG - Intronic
1137661918 16:50214661-50214683 ATAAGTAAGTAAATAAATAAAGG + Intronic
1137748823 16:50842978-50843000 ATGAATAAATGAATGAATGAAGG + Intergenic
1138318345 16:56089681-56089703 AAGAATAAGTAAAGGAATGAAGG + Intergenic
1138375879 16:56563711-56563733 ATGAGTAATCAAATGACTGAAGG - Intergenic
1139026693 16:62826627-62826649 ATAAGTAAGTAAATAAATAAAGG - Intergenic
1139981916 16:70866098-70866120 ATGAGTGAGTGAGTGAATGATGG + Intronic
1140056392 16:71529641-71529663 GTGAGTAAATAGATGAGTGTGGG - Intronic
1140067640 16:71625224-71625246 ATGGGTGAGTGGATGAATGGTGG + Intergenic
1140848721 16:78914396-78914418 ATGAGGGAGTGAATGAATGAGGG + Intronic
1141110201 16:81265693-81265715 ATGGGTAGGTAGATGGATGGTGG - Intronic
1141266915 16:82505985-82506007 ATGGGTAAGTGAATGAATGGAGG + Intergenic
1141475845 16:84272780-84272802 ATGAGTGGATGGATGAATGATGG - Intergenic
1141619882 16:85231565-85231587 ATGAATGAGTAGATGATAGATGG + Intergenic
1141751205 16:85959546-85959568 CTGAGTGAGTGAATGAATGAGGG - Intergenic
1141854832 16:86673856-86673878 ATGAATGAGTAGATGGATGAAGG - Intergenic
1141854894 16:86674102-86674124 ATGAATGGGTAGATGGATGAAGG - Intergenic
1143693444 17:8590702-8590724 CTGTGTAAGTAAATGAATAAAGG - Intronic
1144317951 17:14081856-14081878 ATGAAAAACTAGATGAATGGTGG + Intronic
1144354544 17:14432383-14432405 ATGAATGAGCACATGAATGAAGG + Intergenic
1145353241 17:22109270-22109292 ATGAGTAAATAGAAGAATCAAGG - Intergenic
1145824930 17:27869752-27869774 ATGTGTAAATAGGTGAAGGATGG - Intronic
1146120123 17:30185655-30185677 TTGAGAAAGAAGATGATTGATGG + Exonic
1146375086 17:32288421-32288443 ATGAGTGAGTAGATGAAGGAAGG + Intronic
1146637301 17:34515968-34515990 ATTAGTAAATAAATGAATAAAGG - Intergenic
1146805545 17:35862332-35862354 CTGAATAAATGGATGAATGATGG + Intronic
1147485060 17:40804962-40804984 AAGTTTAAGTAGATGAGTGATGG + Intergenic
1147664192 17:42135613-42135635 ATGTGTAAGTCCATGAATGTGGG + Intronic
1148250429 17:46074358-46074380 ATGAATGAGTAAATAAATGAGGG + Intronic
1149414229 17:56442194-56442216 ATGTGTATGCAGCTGAATGAAGG + Intronic
1150320426 17:64209013-64209035 ATGGATGGGTAGATGAATGAAGG - Intronic
1150924788 17:69521671-69521693 ATGAATAAATGGATGAATGGGGG - Intronic
1151017450 17:70573051-70573073 CTGAATCAGTAAATGAATGAAGG - Intergenic
1151061165 17:71096225-71096247 AGAAGTAAGCAGATGAATGTAGG + Intergenic
1151449655 17:74190603-74190625 ATGAGTAGGTAGAGGAGTGAAGG - Intergenic
1151511821 17:74565464-74565486 ATGGGTGGGTAGATGAAAGATGG - Intergenic
1152128338 17:78460862-78460884 ATGAGTATGTACATGAATGAAGG - Intronic
1152189318 17:78878889-78878911 ATGAGAAATTACATGAAAGAAGG + Intronic
1152259915 17:79261305-79261327 ATGTGTGAGTAAATGAAGGAGGG + Intronic
1152305247 17:79516583-79516605 AGGAGTAATTAGAGGAATGAGGG - Intergenic
1153117065 18:1671333-1671355 ATGTGGAAATAGATGAATGAAGG + Intergenic
1153937535 18:9943096-9943118 ATAAGTAAGGAAATGATTGAAGG + Intronic
1154304716 18:13222189-13222211 ATGAGTAAATAAATGGATGGGGG - Intronic
1155550673 18:26961865-26961887 TTGAACAAGTGGATGAATGAAGG - Intronic
1156169792 18:34468872-34468894 ATAAGTAAGTAGATAAATTAGGG - Intergenic
1156822364 18:41388432-41388454 ATGAGTAAGTAGATCCAGGGAGG + Intergenic
1156997704 18:43487089-43487111 AGGAGTTGGTGGATGAATGATGG - Intergenic
1157133605 18:45032513-45032535 ATGAGTGAAGAGATGAATGAAGG - Intronic
1157600513 18:48890336-48890358 ATGAATAAGTAAACCAATGAAGG + Intergenic
1159060171 18:63506314-63506336 ATGAGGAGGAAGATGAAAGAGGG + Intergenic
1159192441 18:65063540-65063562 AAGAATAAATACATGAATGAAGG + Intergenic
1159318908 18:66819914-66819936 ATAAGTAAATAGATGATGGATGG - Intergenic
1160049173 18:75415692-75415714 ATGAATAAGCAGATGATTGATGG - Intronic
1161105282 19:2440782-2440804 ATGAGTAGATGGATGGATGATGG - Intronic
1161287552 19:3476822-3476844 ATGAGTGAATAGATGGGTGATGG + Intronic
1161347723 19:3776504-3776526 ATGGGTATGTGGATGGATGATGG + Intergenic
1161424806 19:4197486-4197508 ATGAGTGAGTTAATGAATGCAGG + Intronic
1161433846 19:4250276-4250298 ATGAATAAATGAATGAATGAGGG - Intronic
1161449133 19:4334870-4334892 ATGAGTAGGTGGATGGATGGAGG - Intronic
1161449153 19:4334951-4334973 ATGAGTGGGTGGATGGATGATGG - Intronic
1161449198 19:4335151-4335173 ATGAGTAGGTGGATGGATGATGG - Intronic
1161449213 19:4335220-4335242 ATGAGTAGGTGGATGGATGATGG - Intronic
1161679798 19:5674068-5674090 GTGAGTGCGTAGATGGATGATGG - Intergenic
1161814201 19:6489368-6489390 AGGAGTAAGGAGAGGCATGAGGG - Intergenic
1161853576 19:6751402-6751424 ATGAGTATGTACATCAATGGTGG - Exonic
1161916067 19:7229154-7229176 ATGGGTGAGTGGATGGATGATGG + Intronic
1162059989 19:8088779-8088801 ATGAGCAAGGAGACAAATGAAGG + Intronic
1162085825 19:8248597-8248619 ATGGGTAGGTGGATGGATGATGG + Intronic
1162085902 19:8248974-8248996 ATGAATTAACAGATGAATGATGG + Intronic
1162104562 19:8362530-8362552 ATGAGTGAATGAATGAATGAGGG + Intronic
1162156594 19:8682426-8682448 ATGAGTGAGTGAATGAATGAAGG - Intergenic
1162320312 19:9967801-9967823 ATGAATAAATAAATAAATGAAGG + Intronic
1162891522 19:13736610-13736632 ATGAATCAATAAATGAATGAGGG - Intronic
1163462143 19:17445426-17445448 GTGGGCAAGTAGATGGATGATGG - Intronic
1164678878 19:30120987-30121009 ATGGGTAGGTGGATGGATGATGG - Intergenic
1164811692 19:31162472-31162494 ATGAATGAGTAAATGGATGACGG + Intergenic
1165297571 19:34939766-34939788 ATAGGAAAGTGGATGAATGATGG - Intronic
1166162056 19:40961449-40961471 ATTAATAAGTTGTTGAATGATGG - Intergenic
1166377625 19:42336463-42336485 ATAAGTAAATACATGAAGGAAGG - Intronic
1167008956 19:46793907-46793929 GTGAGGAATTAGATGAATGAAGG + Intergenic
1167520235 19:49950367-49950389 ATGAATGAGTGAATGAATGAGGG - Intronic
1167556107 19:50196787-50196809 ATAAATAAATGGATGAATGAGGG - Intronic
1168485982 19:56762341-56762363 TTGAGTAAGAAGATAAATGGTGG - Intergenic
925547032 2:5027824-5027846 ATGAGTTAATTTATGAATGAGGG - Intergenic
925738571 2:6985469-6985491 ATGAGTAAGTGGAAGGATTAGGG + Intronic
926378465 2:12259868-12259890 ATGAATGAATAAATGAATGAGGG + Intergenic
926421050 2:12699758-12699780 ATGAATAAGTAAATGGATGGAGG + Intergenic
926518625 2:13882141-13882163 ATTAATAAGTAAATGACTGATGG - Intergenic
926580147 2:14625937-14625959 ATGAGAAAGAATATGCATGAGGG + Intergenic
926591335 2:14743278-14743300 AAGAGAAAATAGATGACTGATGG + Intergenic
926738465 2:16091935-16091957 ATGATTAAATAAAGGAATGATGG + Intergenic
927448052 2:23183186-23183208 ATGATTAAGTAGAGGCAGGAAGG - Intergenic
928047139 2:27946881-27946903 AGGAGGAAATAGATGAATAACGG - Intronic
928377199 2:30785121-30785143 ATGAGTGAATGGATGAATGAAGG - Intronic
928535577 2:32237394-32237416 ATCAGTAAGTAGAGAAATAAAGG + Intronic
928612901 2:33008581-33008603 AGGAGTAAATGCATGAATGAGGG - Intronic
928859384 2:35838324-35838346 ATGAATAAGTAGAAGAATAAAGG - Intergenic
929264552 2:39903519-39903541 ATGAGAAGATAGATGGATGAGGG + Intergenic
931002018 2:57795210-57795232 ATAATTAAGTGGAGGAATGATGG - Intergenic
931688161 2:64812362-64812384 CTGAGTAAGTAGCTGCCTGAAGG + Intergenic
931856049 2:66302727-66302749 ATGAGTAAACAGATGAATAAAGG - Intergenic
931914154 2:66934858-66934880 ATAAGGAAGTGGGTGAATGAGGG + Intergenic
932281495 2:70496718-70496740 TTGAGTGAGTAAATGAATGAAGG - Intronic
933304066 2:80575743-80575765 ATGAATTAGTAAGTGAATGATGG - Intronic
935264079 2:101380065-101380087 ATGAATAGATAGATGAATGATGG - Intronic
935568438 2:104634287-104634309 ATGAATGAGTAAATAAATGAGGG - Intergenic
935895757 2:107735759-107735781 ATGAATAAGTAAATAAATAAAGG + Intergenic
938660796 2:133485056-133485078 ATGGCCAAGTAAATGAATGATGG - Intronic
939310776 2:140472228-140472250 ATGAATGAATAAATGAATGATGG + Intronic
939585184 2:143995946-143995968 CTGAGTAAGTGGATAAATGAAGG - Intronic
939625124 2:144467621-144467643 ATGCAGAAGTGGATGAATGAAGG - Intronic
939803483 2:146743094-146743116 ATGAATGAGAAAATGAATGAAGG - Intergenic
940577828 2:155535740-155535762 ATGACTAAGTAGGGGATTGAGGG - Intergenic
940633356 2:156266080-156266102 TTGAGTGAGTAAATGAATGAAGG + Intergenic
940764891 2:157779881-157779903 ATGAGGAAGGAGATAAAAGAAGG - Intronic
941638541 2:167962270-167962292 ATAACCAAGTTGATGAATGAAGG + Intronic
941801254 2:169662403-169662425 ATGAGGAAGAAGAGGAAAGAAGG - Exonic
942122034 2:172787548-172787570 ATGAATGAATAGATAAATGAAGG + Intronic
942225884 2:173815639-173815661 ATGAGTGAGTAGAACAATGAAGG - Intergenic
943168550 2:184365510-184365532 ATTAGTAATTAAAGGAATGAAGG - Intergenic
943454889 2:188093389-188093411 ATTATTAAGTAGATAAAGGAGGG + Intergenic
943851660 2:192730812-192730834 ATTAATAAGTAGAAGCATGAAGG + Intergenic
944524180 2:200601468-200601490 ATGAATAAATAAATAAATGATGG + Intronic
944649177 2:201811622-201811644 ATGAATAAAATGATGAATGAGGG + Intronic
944888030 2:204085081-204085103 ATGAGCAAGGACATGAATGCGGG + Intergenic
945159532 2:206874981-206875003 ATGAATAGATGGATGAATGATGG - Intergenic
945164178 2:206924624-206924646 ATGAGTGAGTTGAGGTATGAAGG + Intergenic
945310415 2:208305803-208305825 ATGAGTAAATAAATAAATGTGGG + Intronic
945831135 2:214786739-214786761 AGGAGTATGTATATGAATAAGGG + Intronic
946015276 2:216599282-216599304 ATGAGAAAGTAAGTAAATGAGGG - Intergenic
946094195 2:217258384-217258406 ATCAGCAAGTTGAGGAATGATGG + Intergenic
947069349 2:226269463-226269485 ATGTGTTAATAGATGAAGGATGG - Intergenic
947541302 2:230981632-230981654 ATAAATAAGCAAATGAATGAAGG - Intergenic
947585723 2:231355434-231355456 AGGATGAAGCAGATGAATGAAGG - Intronic
948361135 2:237421525-237421547 TTGAGTAAGTGAAGGAATGAAGG - Exonic
948375472 2:237517813-237517835 ATGGATGGGTAGATGAATGAAGG + Intronic
948375531 2:237518097-237518119 ATGAGTGGGTGGATGAAGGAGGG + Intronic
1168865712 20:1084717-1084739 ATGAATGAATAAATGAATGATGG + Intergenic
1169033491 20:2431185-2431207 ATGAATGATTGGATGAATGAAGG - Intronic
1169567740 20:6874052-6874074 ATGAATAAATAAATGATTGAGGG + Intergenic
1169696991 20:8400755-8400777 ATGACTAAGTACATAAATTATGG - Intronic
1169726689 20:8741390-8741412 ATGAGTAAGTAGATGAATGATGG + Intronic
1170407902 20:16058848-16058870 ATGAGTTTGTAGAGGTATGAGGG - Intergenic
1171230465 20:23480199-23480221 ATGAATCAGTGCATGAATGAAGG - Intergenic
1171538010 20:25915010-25915032 ATGAGGAAGTAAATGAAGAAAGG + Intergenic
1171563487 20:26153466-26153488 ATGAGTAAATAGAAGAATCGAGG - Intergenic
1172203989 20:33148968-33148990 ATGAGTAGGTAGATGGATGGAGG + Intergenic
1172334010 20:34098999-34099021 AAGAATAAAGAGATGAATGAGGG - Intronic
1172582573 20:36059993-36060015 ATGATTAAATAAATAAATGAGGG + Intergenic
1172832865 20:37851061-37851083 ATGAGTAAGTGGCTGGAAGAGGG + Intronic
1173673510 20:44814138-44814160 ATGCTTAAGAAAATGAATGAGGG + Intergenic
1173714056 20:45186626-45186648 TTGAGTAAGTAAATAAATGAGGG - Intergenic
1174029836 20:47614171-47614193 ATTAGTAAGGGTATGAATGACGG + Intronic
1174142472 20:48425545-48425567 ATGGGTGAGTAAATGAGTGAAGG + Intergenic
1174191910 20:48746893-48746915 ATGAGTGAATAAATGAATGCAGG + Intronic
1174289243 20:49496013-49496035 CTGAGTATATAGATGGATGAGGG - Intergenic
1174767329 20:53266248-53266270 AGGAGTAAAGAGATGAAGGAGGG + Intronic
1175090826 20:56502613-56502635 ATGAGTAAATAGATAATGGATGG + Intronic
1175467472 20:59199614-59199636 ATTAGGAAGCATATGAATGAAGG - Intronic
1175779253 20:61671908-61671930 ATGAGTAGGTGGATGCAGGATGG + Intronic
1175817214 20:61889480-61889502 ATGAGTGAGTGGATGATGGATGG + Intronic
1176057901 20:63158445-63158467 ATGAGTAGGTGGGTGAATGGTGG + Intergenic
1176140749 20:63543746-63543768 ATGAGTCAGTGAATGAATGAAGG + Intronic
1176272588 20:64243995-64244017 AGGAGTGAGGAGATGAAAGAGGG - Intergenic
1177783291 21:25642307-25642329 ATGATTAAATAAATAAATGAAGG - Intronic
1178368630 21:32008817-32008839 ATGAATGAGTAGATGATGGATGG + Intronic
1178469724 21:32881573-32881595 CGGAGTAAGAAGATGAATGTTGG + Intergenic
1180024907 21:45155583-45155605 ATGGGTGAGTGGATGGATGATGG - Intronic
1181058777 22:20272177-20272199 ATGAGGAAGCAGATTAATTATGG - Intronic
1181537129 22:23552219-23552241 ATGAATAAGAGGATGGATGACGG - Intergenic
1182060690 22:27395040-27395062 GTGAGTGAGCAGATGGATGAGGG + Intergenic
1183080141 22:35450972-35450994 ATGAGCAAGGGAATGAATGATGG + Intergenic
1183094981 22:35546598-35546620 GTGAGTGAGTGGATGAAGGAAGG + Intronic
1183846221 22:40542709-40542731 AGGAGAAAGTAAATAAATGATGG + Intronic
1184100657 22:42340325-42340347 ATGAGTGAGTGAATAAATGATGG + Intronic
1184306463 22:43606161-43606183 ATGAGGAAGTGGAAGAGTGATGG - Intronic
1185103701 22:48855388-48855410 ATGGATGGGTAGATGAATGATGG - Intergenic
1185193378 22:49452809-49452831 ATGAGTGAGTCGATGGATGGTGG + Intronic
949096904 3:97043-97065 ATGAATAAGCAAATGAATGCAGG - Intergenic
949621423 3:5816689-5816711 ATGCGTAAGTAGCTGAACAAGGG + Intergenic
949866129 3:8548988-8549010 ATGAATAAATGCATGAATGAGGG - Intronic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
950678264 3:14567712-14567734 ATGAGCAAGTGAATGAATGACGG - Intergenic
951205081 3:19917683-19917705 ATGAGTTATTTGTTGAATGATGG + Intronic
951558067 3:23941242-23941264 ATGAGGACCTAGATGAAGGAGGG - Intronic
952200582 3:31123038-31123060 ATGAGTAAATACATGAATAAAGG - Intergenic
953051271 3:39346242-39346264 ATGAGGTAGTAGCTGAATCAGGG + Intergenic
954118228 3:48478883-48478905 TTGAGTCAGCAGATGACTGATGG - Intronic
954578325 3:51689123-51689145 ATAAATAAATAGATAAATGAAGG + Intronic
954795681 3:53160505-53160527 ATGAGTGAATGAATGAATGAAGG + Intronic
955121473 3:56063974-56063996 AGGAGTAACTAAATAAATGATGG - Intronic
955607941 3:60726262-60726284 ATTAGTGACTAGATGATTGATGG + Intronic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
955964675 3:64376630-64376652 ATGAGTAAGTATATGAAAAAAGG + Intronic
956063908 3:65376790-65376812 ATGAGAAAGGAGATGATTAAAGG - Intronic
956898513 3:73688482-73688504 TTAAGTAAGGGGATGAATGAGGG - Intergenic
957859533 3:85927232-85927254 TTGAGTAAATAAATGAATAATGG - Intronic
959492142 3:107002837-107002859 ATGGTAAAGTAGATGAATGGTGG - Intergenic
959962357 3:112312942-112312964 ATAAGTAAGAAAATGTATGAAGG - Intergenic
960431685 3:117576905-117576927 ATCAGGAAGGAGAAGAATGAGGG - Intergenic
961554303 3:127687720-127687742 ATAAGTGAGTGAATGAATGAGGG - Intergenic
962039248 3:131687847-131687869 ATGAGTGAATGAATGAATGAAGG + Intronic
963671955 3:148261981-148262003 ATAAGTAAGTACATGAATTTGGG + Intergenic
964726926 3:159823104-159823126 GTGAATAAGGAGGTGAATGAGGG + Intronic
964949044 3:162264275-162264297 ATAAGTAAATGCATGAATGATGG - Intergenic
965337403 3:167443817-167443839 AGTAGTAAGTAGATTGATGATGG - Intronic
967767839 3:193301472-193301494 ATGAGTAAGGTAATGATTGAAGG - Intronic
968244569 3:197130553-197130575 ACAAGTATGTATATGAATGATGG - Exonic
969139537 4:5056458-5056480 ATGAATGAGTGAATGAATGAAGG + Intronic
969206531 4:5651409-5651431 ATGAGTAAATGGATGATGGATGG + Intronic
969523098 4:7690211-7690233 ATGAGTGGGTGGATGGATGATGG + Intronic
969523145 4:7690466-7690488 ATGAGTGGGTGGATGGATGATGG + Intronic
969624393 4:8294959-8294981 ATGGGTAAATGGATGGATGATGG - Intronic
969921242 4:10541821-10541843 ATGATTAAATAGATGAATGAAGG + Intronic
969979455 4:11139610-11139632 ATGAGTGGGTAGATAGATGATGG + Intergenic
969986237 4:11213918-11213940 ATGAATAATTAAATGAATGGAGG - Intergenic
970119907 4:12741965-12741987 CTGAGGAAGTAGAATAATGAAGG - Intergenic
971567016 4:28157802-28157824 AAGATTAAATAAATGAATGAAGG + Intergenic
971988003 4:33851509-33851531 ATGAATAAATAGAAGAATCAAGG + Intergenic
972175139 4:36394922-36394944 TTGAGTAAATAGATGACAGATGG - Intergenic
972793098 4:42391713-42391735 ATGAATAAGGGAATGAATGAAGG + Intergenic
972873171 4:43325758-43325780 ATGAGGAAGTGGCTTAATGATGG - Intergenic
975191712 4:71471396-71471418 ATCAGTAAGGATATCAATGAGGG + Intronic
976008251 4:80456548-80456570 ATGAGGAAGAAGATGACTCAAGG + Intronic
976098022 4:81529287-81529309 TTGTGTAAGTGGATGGATGATGG + Intronic
977303232 4:95292606-95292628 ATAAATAAGTAAATGTATGATGG + Intronic
978234049 4:106436382-106436404 ATGAATAAGTATATGAATTGAGG - Intergenic
978685475 4:111437572-111437594 ATGATCAAGAAGCTGAATGAAGG + Intergenic
979467847 4:121060963-121060985 ATGAGTGAGTAGATGTACCAGGG + Intronic
979733276 4:124051483-124051505 ATATGTAAGTACATGAAAGAAGG + Intergenic
980327259 4:131362982-131363004 ACAAATAAGTAAATGAATGAAGG + Intergenic
980570612 4:134612136-134612158 ATGATTAAGTACATGAATCCAGG - Intergenic
980836901 4:138205743-138205765 ATAAATAAGAATATGAATGAGGG + Intronic
980942895 4:139291646-139291668 ATGAGCAAGTTGCTGAATAAAGG + Intronic
981218379 4:142200096-142200118 CTGAATAAGTAAATGAATGGAGG - Intronic
981294859 4:143120212-143120234 ATAAGTAAAGAAATGAATGAAGG + Intergenic
981742272 4:148015232-148015254 AAGAGGAAGTACATGCATGAGGG + Intronic
982906317 4:161078876-161078898 ATCAGTAAGTAGATGAATTGAGG + Intergenic
983250584 4:165341501-165341523 ATGATAAAATATATGAATGATGG - Intronic
984136555 4:175947943-175947965 ATGAATAAAAAGATGAATGAAGG + Intronic
984583643 4:181538298-181538320 ATAAGTGAGTAAAAGAATGAAGG - Intergenic
985198380 4:187458447-187458469 TTGGGTAATTAGATGTATGATGG - Intergenic
985211333 4:187598760-187598782 ATGAATAGGTATATAAATGAAGG + Intergenic
986410017 5:7468290-7468312 AGGTGTAAATATATGAATGAAGG + Intronic
986847318 5:11770537-11770559 ATGAGTAGGTTCCTGAATGATGG - Intronic
988045370 5:25944573-25944595 ATTGGTAATTAGATTAATGAAGG + Intergenic
988243693 5:28649414-28649436 ATCCCTAATTAGATGAATGATGG - Intergenic
989681662 5:44036703-44036725 CTGATTAAGAAGATAAATGAAGG + Intergenic
990140277 5:52695249-52695271 CTGAGAAAGGAGATGAAGGAAGG - Intergenic
990887398 5:60610148-60610170 ATGAATGAATACATGAATGAAGG + Intronic
991646973 5:68810070-68810092 ATAACTAAGTAAATGAATGATGG - Intergenic
992059831 5:73031996-73032018 ATGATTAAATAGCAGAATGATGG + Intronic
992657454 5:78924307-78924329 ATTAGTAAGTGGTAGAATGAGGG + Intronic
993091845 5:83436014-83436036 ATGAATGAGTGAATGAATGAAGG - Intergenic
993238376 5:85345761-85345783 TTGAATAAGTAAATAAATGAGGG + Intergenic
993335477 5:86653023-86653045 CTGATTTAGTAAATGAATGATGG + Intergenic
994023955 5:95060407-95060429 ATGAATAATTTTATGAATGATGG - Intronic
994562802 5:101397717-101397739 ATGAGTAACTAGGGGACTGAAGG + Intergenic
994759841 5:103837946-103837968 GTGATTATGAAGATGAATGAAGG + Intergenic
996008053 5:118447330-118447352 ATGAGTAAATACAAGAATGAGGG + Intergenic
996150654 5:120030374-120030396 ATGAGTAAGCAATAGAATGATGG - Intergenic
996316820 5:122169441-122169463 TGGAGGAAGTAGATGAATGAAGG + Intronic
996876258 5:128243597-128243619 ATGAGTGGATAGATGGATGATGG + Intergenic
996876286 5:128243718-128243740 GTGAGTAAGTAGATGGATGATGG + Intergenic
997185939 5:131882024-131882046 TTGAGAAATTGGATGAATGATGG - Intronic
997249922 5:132380667-132380689 CTGAGTAACTGGGTGAATGAAGG + Intronic
997549062 5:134736695-134736717 GTGAATGATTAGATGAATGAAGG - Intergenic
998817801 5:146031525-146031547 ATAAGTATGTAAGTGAATGACGG + Intronic
999639278 5:153655356-153655378 ATGAGTTAATAGATGGATGGTGG - Intronic
1000624332 5:163521987-163522009 ATGAATAAATAGAATAATGAGGG - Intergenic
1000905259 5:166958544-166958566 ATGAATAAGTCAATAAATGATGG - Intergenic
1001552714 5:172616092-172616114 ATGTGTAATTAGAGGAGTGAAGG + Intergenic
1001633296 5:173192470-173192492 ATGAATGAGTGCATGAATGAAGG + Intergenic
1001855249 5:175005076-175005098 ATGAGTGAATGAATGAATGAGGG - Intergenic
1002575142 5:180170172-180170194 ATGAGTGAGTGAGTGAATGATGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004079108 6:12373437-12373459 ATGAATAAGTGAATGAATGAAGG - Intergenic
1004086198 6:12451949-12451971 ATCAGTAAGTGGGTGAATCATGG + Intergenic
1004088855 6:12478949-12478971 ATGAATATATAGATGGATGAAGG + Intergenic
1004526965 6:16418002-16418024 ATGAGTAAATCAACGAATGAAGG + Intronic
1005444657 6:25909502-25909524 ATGACTAAGTAGTCTAATGAAGG + Intergenic
1009775601 6:68201910-68201932 ATGAGTAAATAAATAAATAAAGG + Intergenic
1010036331 6:71329658-71329680 ATGAGCAAGTAGGTGAGTAATGG + Intergenic
1010461538 6:76119456-76119478 GTGAGTAAGTTGAGGAAAGATGG + Intergenic
1010510128 6:76708171-76708193 ATGAATAGATAGATGAATGAAGG - Intergenic
1011231608 6:85167959-85167981 ATGAGTGAGGAGATGAAGGGAGG - Intergenic
1011728582 6:90236155-90236177 ATGATTGAATAAATGAATGAAGG - Intronic
1012179684 6:96137358-96137380 ATGATTAAATACATAAATGAGGG + Intronic
1014390659 6:120858434-120858456 ATGAGCAAGCAGATCAATGAAGG + Intergenic
1014562812 6:122911817-122911839 ATGAGTAAGAAGATTAATTCAGG - Intergenic
1014708607 6:124779514-124779536 ATGAGTAAGTAAATAAATTGTGG + Intronic
1015760183 6:136650196-136650218 ATGAGTAAGTTGATGAATGATGG + Intronic
1016129200 6:140444806-140444828 ATGAGTGAATGAATGAATGAAGG - Intergenic
1017048158 6:150366301-150366323 ATGAGTGAATGAATGAATGAAGG + Intergenic
1017315572 6:153027543-153027565 TTGAGTAAGTAAGTGAAAGAAGG - Intronic
1017586884 6:155936320-155936342 ATGAGTAAGTGGCAGAAGGAAGG + Intergenic
1018847202 6:167563849-167563871 ATGAGTGAATGCATGAATGAGGG - Intergenic
1019003924 6:168780365-168780387 ATGAATAAATGGATGAGTGAAGG + Intergenic
1019103418 6:169650106-169650128 ATGAGTGAGTGGATGGATGGAGG - Intronic
1019106584 6:169672724-169672746 AAGAATAAGGAGAGGAATGAGGG + Intronic
1019202579 6:170330412-170330434 TTGGGTCAGTAGATGCATGAGGG - Intronic
1019345529 7:528229-528251 ATGAATAGATAGATGATTGATGG + Intergenic
1019515243 7:1436997-1437019 ATGAGTGAATAAGTGAATGAAGG + Intronic
1019777421 7:2920558-2920580 ATGGATACGTAGATGGATGATGG - Intronic
1021508250 7:21408615-21408637 ATGAGGAAGTAGAGGTATGAAGG + Intergenic
1021784629 7:24139611-24139633 ATGAGTGAATGAATGAATGAAGG - Intergenic
1022327073 7:29342180-29342202 ATGAATGGGTAGATGGATGAGGG + Intronic
1023368814 7:39491479-39491501 ATGAATAAGTAGAGGAATTAAGG + Intronic
1024386036 7:48753043-48753065 CTGAGTAAGTGGCTGAGTGAGGG + Intergenic
1025274230 7:57560829-57560851 ATGAGTAAATAGAAGAATCAAGG + Intergenic
1025921524 7:65917500-65917522 ATGAGTAAGTAGCTGAGCAAAGG - Intronic
1026032410 7:66805737-66805759 ATGAATGAGTGAATGAATGAGGG - Intronic
1026828600 7:73598342-73598364 ATGGGTTGGTGGATGAATGATGG - Intronic
1026904276 7:74053907-74053929 ATGAATGGGTAGATGGATGAGGG + Intronic
1027412935 7:77941726-77941748 ATGAGGTAGAAGATGATTGATGG - Intronic
1027508499 7:79049369-79049391 ATAAGTATGTAGATGAAAGCTGG + Intronic
1027620333 7:80477305-80477327 ATGAGTAAGAAGCTGAATTGTGG - Intronic
1028698122 7:93741363-93741385 CTGAATAAGTAAATGAATGGAGG - Intronic
1029852420 7:103477053-103477075 ATGAGTAAGTAATTGAAAGAAGG + Intronic
1030307071 7:108029757-108029779 AAGGTTAAGTAGATGAATAAAGG + Intronic
1030757790 7:113310228-113310250 GTGAGTGAGTGAATGAATGAAGG - Intergenic
1030888229 7:114964946-114964968 TTGAGTGACTATATGAATGAAGG + Intronic
1032078365 7:128846674-128846696 ATGAGGGAGTAGCTGAATGGGGG - Intronic
1032485569 7:132284729-132284751 ATGAGTGAGTTTATGAATGATGG + Intronic
1033445736 7:141420338-141420360 ATGAATAAATAAATGAATGTAGG + Intronic
1033568597 7:142604615-142604637 ATGTATTAGTAGATGAATGAGGG - Intergenic
1034536757 7:151730177-151730199 GAGAGTGGGTAGATGAATGAGGG - Intronic
1034623532 7:152474847-152474869 ATGAGGAAGTAGATGGAGGAGGG + Intergenic
1034883634 7:154780991-154781013 ATGAGTGAATGGATGGATGATGG + Intronic
1035053628 7:156019098-156019120 ATGTTTAAGTAAATGAAGGAAGG + Intergenic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1035288524 7:157821985-157822007 ATGAGTAGATGGATGGATGATGG - Intronic
1035288549 7:157822173-157822195 ATGAGTATTTGGATGGATGATGG - Intronic
1035288587 7:157822445-157822467 ATGAGTGGATAGATGGATGATGG - Intronic
1038595692 8:28883806-28883828 TTGAGTAAATACATGAATGATGG + Intronic
1038679426 8:29653070-29653092 ATGAGTAAATGGATGGATGATGG - Intergenic
1039172136 8:34759740-34759762 ATGAGTGAGGATATGAATGAGGG + Intergenic
1039553957 8:38463593-38463615 ATGAATGAGTAAGTGAATGAAGG + Intronic
1040452589 8:47562902-47562924 TTGAGAAAGTTGCTGAATGAAGG + Intronic
1040596943 8:48847656-48847678 ATGAGTAACTGAATGAAGGAAGG - Intergenic
1041497768 8:58505955-58505977 ATGAGGAAGTAGAGGCAAGAAGG + Intergenic
1043437640 8:80250076-80250098 ATGAATAAGTGGATGAATGAAGG - Intergenic
1043769163 8:84175884-84175906 ATGAATAAGTAACTAAATGATGG + Intergenic
1043909484 8:85844613-85844635 ATGAGTGGGTGGATGGATGATGG + Intergenic
1044027281 8:87188776-87188798 ATAAGTAAATAAATAAATGAAGG + Intronic
1044040342 8:87358979-87359001 TTGAATCAGTAGATGAATTAAGG - Intronic
1044112707 8:88296116-88296138 ATGAATAAATGGATGAATGATGG - Intronic
1044327745 8:90878681-90878703 ATGAATAAATGGATGAATGAAGG + Intronic
1044789973 8:95837302-95837324 ATGAATGAATAGATGAATCAAGG - Intergenic
1044953460 8:97455802-97455824 ATGGATAAATAGATGAATAAAGG - Intergenic
1045695188 8:104801245-104801267 ATGAGTAAATGAATGAAGGAAGG - Intronic
1045695189 8:104801249-104801271 ATGAATGAGTAAATGAATGAAGG - Intronic
1046324560 8:112623894-112623916 ATGAGTGAATAAATGAATGAAGG + Intronic
1046457589 8:114487148-114487170 ATGTGAAAGTAATTGAATGATGG + Intergenic
1047848540 8:128830388-128830410 TCAAGTAAGTAGATGAATTAGGG - Intergenic
1048265661 8:132983452-132983474 AGGAGAAAGAAGATGAATGAGGG - Intronic
1048605437 8:135963581-135963603 ATGAGTTAGTCAATGAATAAAGG + Intergenic
1049155352 8:141062863-141062885 AGGAGTAGGTGGATGGATGATGG + Intergenic
1049232021 8:141489399-141489421 ATGAATGAGTGAATGAATGAAGG + Intergenic
1050078161 9:1886936-1886958 TTGAATACGTAGATGAATGGAGG - Intergenic
1050600424 9:7244898-7244920 ATTAATAAGTAAATGAATGAGGG - Intergenic
1051117747 9:13716603-13716625 AGGAGCAAGTAGATGAACCACGG + Intergenic
1052689075 9:31792147-31792169 ATGATGAAGATGATGAATGATGG - Intergenic
1052983398 9:34466132-34466154 ATGAGTGAATAAATGAGTGATGG + Intronic
1053487468 9:38470766-38470788 ATGAATAAGTGGATGGATGAAGG - Intergenic
1054454966 9:65425126-65425148 ATGAGTGAGTGAATGAGTGAGGG - Intergenic
1055211309 9:73796556-73796578 ATTAGTGAGGAGAAGAATGATGG - Intergenic
1056513089 9:87324229-87324251 ATGAGTGAATGAATGAATGATGG - Intergenic
1056979944 9:91300401-91300423 TTGAGTAACTTGATGAATGGAGG - Intronic
1058114205 9:101066527-101066549 ATGATTAAGTAAATAAATGAGGG - Intronic
1058114573 9:101070244-101070266 ATGACTAAGTAAATAAATGAGGG - Intronic
1058944739 9:109845849-109845871 CTCAATAAGTAAATGAATGATGG - Intronic
1059748452 9:117225609-117225631 ATAAGTAAATCAATGAATGAGGG - Intronic
1059755071 9:117285373-117285395 ATGATTAAATCAATGAATGAAGG + Intronic
1060040925 9:120300282-120300304 ATGAGTCAGTGGATGGATGATGG + Intergenic
1060193469 9:121607794-121607816 ATAAATAAGCAGATGAATGAGGG + Intronic
1060362962 9:122978155-122978177 ATGACTAAATAGATGCACGAGGG - Intronic
1060864873 9:126987749-126987771 ATGAATGAGTAAATGAGTGAAGG - Intronic
1060893102 9:127200940-127200962 ATGAATAAGTGAGTGAATGAAGG - Intronic
1061221973 9:129257529-129257551 ATGAATGAGTGAATGAATGAAGG + Intergenic
1061846718 9:133392448-133392470 GTGGGTAAGTGGATGGATGATGG + Intronic
1062172235 9:135141309-135141331 ATGAGTGGATGGATGAATGATGG + Intergenic
1062201320 9:135304333-135304355 ATGAGTGGATAGATGGATGATGG + Intergenic
1062201331 9:135304386-135304408 ATGAGTGGATAGATGAATGATGG + Intergenic
1062201393 9:135304644-135304666 ATGAGTGGATAGATGGATGATGG + Intergenic
1062443109 9:136581328-136581350 ATGAGTGAGTGAATGAATGAGGG - Intergenic
1185613698 X:1407526-1407548 ATGGGTAGGTAGATGATGGATGG + Intronic
1186158276 X:6748952-6748974 AAGAGAAAGGAGATGAATGATGG + Intergenic
1186159559 X:6762538-6762560 ATGAGTGAGGAAATGAGTGAAGG + Intergenic
1186492682 X:9986381-9986403 AACAGAAAGTAGATGAATGGTGG + Intergenic
1187247554 X:17566565-17566587 ATGAGTAAATGAATGAATTATGG + Intronic
1188373841 X:29403166-29403188 TTGAATAAGTAGATAAATGTGGG - Intronic
1188563974 X:31504069-31504091 ATGAACAAATAAATGAATGAGGG + Intronic
1190445737 X:50522277-50522299 ATGAGCTAGTAAATGAAAGAAGG - Intergenic
1191139186 X:57097524-57097546 CTGGGTAAGTAAATAAATGAAGG + Intergenic
1191675741 X:63790619-63790641 ATGATTAAGTAGATGTGGGATGG - Intergenic
1192084187 X:68079181-68079203 GTAAGAAAGGAGATGAATGATGG - Intronic
1192329322 X:70161972-70161994 TTGAATAAGTAAATAAATGAGGG + Intronic
1192387655 X:70689087-70689109 AAAATTAAGTAAATGAATGATGG + Intronic
1193390296 X:80918908-80918930 ATGAATTAGTAAATAAATGATGG + Intergenic
1193686670 X:84584928-84584950 ATAAGAAAGAAGATTAATGATGG + Intergenic
1194115749 X:89895112-89895134 ATGAATAAGTAACTAAATGAGGG - Intergenic
1194865691 X:99063155-99063177 AGGAGTAAGTAGAGAAAGGAAGG + Intergenic
1195727694 X:107935129-107935151 ATGAGTGAATAAATGAATGGCGG - Intergenic
1196513241 X:116539069-116539091 CTGAGTGAGCAAATGAATGATGG - Intergenic
1196570169 X:117256816-117256838 TTGAGTAAAAAGATGAATGGTGG + Intergenic
1197524231 X:127542287-127542309 ATGAATAAGTAGAGGAATTTTGG - Intergenic
1197827918 X:130610606-130610628 TTGAGTGAGTAAATGAATGAAGG + Intergenic
1198579419 X:138047493-138047515 ATGAGTGAATAAATGAAGGAGGG + Intergenic
1199029893 X:142985245-142985267 AAGAGTAAGCATATGTATGAAGG + Intergenic
1199565662 X:149213126-149213148 ATGTGTCAGTGGATAAATGATGG - Intergenic
1199795285 X:151190045-151190067 ATGGATAAGTGAATGAATGACGG + Intergenic
1200468546 Y:3552239-3552261 ATGAATAAGTAACTAAATGAGGG - Intergenic
1200809348 Y:7466378-7466400 ATGAGTAGATAGATAAGTGATGG - Intergenic
1201551773 Y:15225128-15225150 AAGAGAAAGGGGATGAATGATGG + Intergenic
1201553268 Y:15241026-15241048 ATGAGTGAGGAAATGAGTGAAGG + Intergenic