ID: 1169730779

View in Genome Browser
Species Human (GRCh38)
Location 20:8783686-8783708
Sequence ACTAATATGCAGAGAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169730779_1169730782 30 Left 1169730779 20:8783686-8783708 CCTGCTTTTCTCTGCATATTAGT 0: 1
1: 0
2: 0
3: 15
4: 290
Right 1169730782 20:8783739-8783761 TTCCCCTTGATAGAAAATACAGG 0: 1
1: 0
2: 0
3: 14
4: 185
1169730779_1169730780 6 Left 1169730779 20:8783686-8783708 CCTGCTTTTCTCTGCATATTAGT 0: 1
1: 0
2: 0
3: 15
4: 290
Right 1169730780 20:8783715-8783737 CTTTTCCAAAGTAGCAAGACAGG 0: 1
1: 0
2: 7
3: 192
4: 1668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169730779 Original CRISPR ACTAATATGCAGAGAAAAGC AGG (reversed) Intronic
901337057 1:8459024-8459046 AATTATATGCACAGAAAAGTTGG - Intronic
902548570 1:17205814-17205836 ATTAATATGAAGAGAGAACCTGG + Intronic
908155076 1:61344942-61344964 ACTAATGTGTACAGAAGAGCAGG + Intronic
908521026 1:64942266-64942288 AGTACTATGCAGAGACAATCTGG + Intronic
909661283 1:78085497-78085519 TCAAATATACAAAGAAAAGCTGG - Intronic
909697371 1:78483066-78483088 AGTAACATGCAGAGAAGAGATGG + Intronic
911286152 1:95995678-95995700 AATAATATGCAGAAAAACACAGG - Intergenic
911568430 1:99492866-99492888 ACTCATTTCCAGAGAAAACCGGG + Intergenic
911986057 1:104624171-104624193 ACAAAGATGTAGAGAAAGGCAGG + Intergenic
912774276 1:112495138-112495160 ACTAATATGCTAAGAAAGGAGGG + Intronic
913669553 1:121083219-121083241 ACTATTAGGCAGTTAAAAGCTGG + Intergenic
914021310 1:143870618-143870640 ACTATTAGGCAGTTAAAAGCTGG + Intergenic
914659801 1:149778536-149778558 ACTATTAGGCAGTTAAAAGCTGG + Intergenic
914956812 1:152170106-152170128 AGTAATAGGAAGAGAAAAGGTGG - Intergenic
915494526 1:156272269-156272291 AATAATATGCACACAAAAGCAGG + Intronic
915528324 1:156489544-156489566 ACAAAGATTCAGAGAGAAGCAGG + Intronic
915918118 1:159953406-159953428 GCTGATATGCAGGGAATAGCTGG + Exonic
917265790 1:173219355-173219377 ACTAATTTCCAGGGAAAACCAGG - Intergenic
918417214 1:184322912-184322934 ACAAATATACAGAGAAAATAAGG - Intergenic
918885007 1:190181473-190181495 AATTTTATGCATAGAAAAGCAGG - Intronic
919202618 1:194376513-194376535 ACTAAAATGCTGAGAAAGGTAGG + Intergenic
920650447 1:207833502-207833524 ACTGAGATGCTGAGATAAGCTGG + Intergenic
920924381 1:210328431-210328453 TCTAATTTACAAAGAAAAGCAGG + Intronic
924294841 1:242576339-242576361 AATGATATCCAGAGAAAAACTGG - Intergenic
1062786175 10:266808-266830 AATAAAATGCAGAGATAACCTGG + Intergenic
1064221576 10:13445404-13445426 AGAAACATGCAGAGAAAAGCTGG + Intronic
1064928901 10:20602068-20602090 ACTGAGAGGCAGAGAAAAACTGG + Intergenic
1065619899 10:27570216-27570238 GATAATATACACAGAAAAGCAGG - Intergenic
1066976180 10:42369761-42369783 CCTAATATGCAAGGAAAGGCAGG - Intergenic
1072072805 10:91936332-91936354 CCTGATGTGCAGAGTAAAGCAGG + Intronic
1072818799 10:98536032-98536054 TCTTATATGCAGACAAAAGATGG + Intronic
1072989287 10:100175505-100175527 AGCAAAATGCAGAGGAAAGCAGG - Intronic
1073615556 10:104991401-104991423 ATGAAGATGCAGAGAGAAGCTGG - Intronic
1074333018 10:112538750-112538772 ACAAATATGCAAAGTAAAGTGGG - Intronic
1076239727 10:128895295-128895317 ACTACTATGGAGAGGAAAGAAGG + Intergenic
1077994115 11:7438558-7438580 GCAAGTATGCAGAGAAAACCTGG - Intronic
1078852990 11:15180724-15180746 ACTAATATGCAGATGAATGGAGG - Intronic
1078896610 11:15602486-15602508 ACTCACTTGCAAAGAAAAGCTGG + Intergenic
1079553178 11:21726579-21726601 ACTAATCATCAGAGAAATGCAGG - Intergenic
1079563126 11:21847869-21847891 ACTAACCTGCACAGATAAGCAGG + Intergenic
1079568320 11:21910790-21910812 ACTAATTTTCAGAGAAAACTAGG + Intergenic
1080218293 11:29870626-29870648 AATAAAATGCTGAGCAAAGCAGG + Intergenic
1080735663 11:35011478-35011500 ACTAAAGTCCAGAGAAAAGACGG + Intronic
1081840523 11:46197867-46197889 ACTAATATTCAGAGCAGAGATGG + Intergenic
1084402011 11:68949958-68949980 ACATATATGCATAGAAAAGATGG + Intergenic
1084899465 11:72298869-72298891 TATAATGTGCAGAGAAAAGAGGG - Intronic
1086855751 11:91863336-91863358 ACAAAGATGCAGAGAGAAACAGG - Intergenic
1090532284 11:127603366-127603388 ACCAATATGCAGAACAATGCAGG - Intergenic
1091446134 12:545174-545196 ACTTATATGGAGAGATGAGCTGG - Intronic
1091977745 12:4839056-4839078 CATAATATGCACAAAAAAGCAGG + Intronic
1092390556 12:8073836-8073858 ACTAAAATGCAGGCAAAAGAAGG + Intergenic
1092670739 12:10858189-10858211 AGTAATATGAAGTTAAAAGCAGG - Intronic
1092715710 12:11388147-11388169 ACTAATATGCAGAGTATACAAGG + Intronic
1093455076 12:19357134-19357156 ACTCAAATGAGGAGAAAAGCAGG - Intronic
1093592969 12:20928424-20928446 ACAGATATACAGAGAAGAGCTGG - Intergenic
1094690345 12:32762297-32762319 GCTAATGTGATGAGAAAAGCAGG + Intergenic
1095613185 12:44156573-44156595 TCTAAAATGCAGAAAAATGCAGG + Intronic
1096574428 12:52543978-52544000 ACCCAGAAGCAGAGAAAAGCAGG - Exonic
1096646627 12:53041602-53041624 ACAAAAATGCATATAAAAGCAGG - Exonic
1098078798 12:66761381-66761403 GCAAATATGCAGAAATAAGCTGG - Intronic
1100085763 12:90908431-90908453 GCTGACGTGCAGAGAAAAGCAGG - Intronic
1101213505 12:102558517-102558539 ATAAGAATGCAGAGAAAAGCAGG - Intergenic
1105678686 13:22703862-22703884 ATTAATATGGAGGGAAAGGCAGG - Intergenic
1105986407 13:25571484-25571506 ACTATTATGCAGATAACACCAGG + Intronic
1107793609 13:44027897-44027919 ACTAAGAGGAAGAGAAAAGAAGG + Intergenic
1108801419 13:54100803-54100825 ATTAATATACAGATAAAACCAGG + Intergenic
1109191652 13:59331343-59331365 ACTAATATGGAAAGCATAGCCGG - Intergenic
1110270796 13:73587742-73587764 ACCAATATGCAAAGAAGAGGAGG + Intergenic
1110396987 13:75041806-75041828 ACAAAAAAGCAGAGGAAAGCTGG + Intergenic
1111111067 13:83710172-83710194 GGTAATCTGCAGACAAAAGCTGG - Intergenic
1111151799 13:84263185-84263207 AGTGTTATCCAGAGAAAAGCTGG + Intergenic
1114189743 14:20431326-20431348 AGGGTTATGCAGAGAAAAGCTGG - Intronic
1114566157 14:23634452-23634474 ACAAAAATACAGAGAAATGCAGG - Intronic
1115332133 14:32209438-32209460 TCTATTTTGCAGAGAAAAGTGGG - Intergenic
1115438637 14:33406344-33406366 ACTAAGAAGCAGAGAGATGCAGG + Intronic
1115924435 14:38414790-38414812 AATGATAAGCAGAAAAAAGCAGG + Intergenic
1116021772 14:39469768-39469790 AGTAATATGAAGTGAAAACCAGG + Intergenic
1116081332 14:40176961-40176983 ATTAAAATGCAGAGAAAAGAAGG - Intergenic
1117131122 14:52687801-52687823 TCTAATAAGCAGAGATAAGAAGG + Intronic
1118652426 14:67911370-67911392 AGTCATATGCACACAAAAGCTGG + Intronic
1118956508 14:70488077-70488099 AGTAATATGAAGATAAAACCAGG - Intergenic
1119145493 14:72310068-72310090 ACCAACATGCCGAGAAGAGCTGG - Intronic
1119996467 14:79258827-79258849 ACAGATAGGCAGAGAAAAGAAGG + Intronic
1121031156 14:90659733-90659755 ACCAATAAGCAAAGAAAAGATGG + Intronic
1202886989 14_KI270722v1_random:116999-117021 ACAAATATTCAGAAAACAGCAGG + Intergenic
1124211383 15:27767767-27767789 ACAAATAAGCAAATAAAAGCTGG + Intronic
1126081013 15:44962141-44962163 ACTAATAAGAAGAGAATAACAGG + Intronic
1132365491 15:101253542-101253564 ACTAGTGTCCAGTGAAAAGCTGG + Intergenic
1132416606 15:101624784-101624806 ACTGAGAGGCAGAGAAAAGAAGG + Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134049017 16:11123925-11123947 ATGAAGATGCAGAGAATAGCTGG + Exonic
1134355700 16:13480192-13480214 TCTAACATGCAGAGAAAACAAGG + Intergenic
1135821567 16:25691217-25691239 CCTAATAAGCGGAGACAAGCTGG - Intergenic
1137402257 16:48163250-48163272 ACTGATGTGCAGAGCAAAGGAGG - Intergenic
1137908605 16:52352270-52352292 ATTAATAGGCAGGGAAAACCGGG - Intergenic
1145764454 17:27448743-27448765 ATGATGATGCAGAGAAAAGCAGG + Intergenic
1145873504 17:28296845-28296867 ACTAATGTAAAAAGAAAAGCTGG + Intergenic
1146328536 17:31907822-31907844 GCTAATATGCCCAGAAAAACAGG + Intergenic
1146668924 17:34723464-34723486 ACTGAGGTGCAGAGAAGAGCAGG + Intergenic
1147468810 17:40637387-40637409 CTGAATATGCACAGAAAAGCTGG + Intronic
1150457764 17:65321297-65321319 ACTAATTTGCACAGATGAGCAGG + Intergenic
1203157964 17_GL000205v2_random:22405-22427 ACAAATATTCAGACAACAGCAGG + Intergenic
1203159098 17_GL000205v2_random:32748-32770 ACAAATATTCAGACAAGAGCAGG + Intergenic
1152976739 18:228344-228366 ACTAACAGGCAGAGAATAGACGG - Intronic
1156358193 18:36360884-36360906 TCTAAAATGCAGAGGAAACCTGG - Intronic
1156587953 18:38453287-38453309 ACTAATATTTAGAGAAAATGAGG - Intergenic
1157212543 18:45756170-45756192 ACTGAAACGCAGAGAAAAGTTGG + Intergenic
1159333811 18:67036975-67036997 ATTAATATGCACAGAAAAATAGG - Intergenic
1159509585 18:69378979-69379001 ACTAATATACAGAAATTAGCTGG - Intergenic
1159634786 18:70791235-70791257 ATTCATAAGCAGACAAAAGCAGG - Intergenic
1159726933 18:71972420-71972442 ATTAATATGGAGAGGAAAACAGG - Intergenic
1161599296 19:5171092-5171114 GCTAACATGCACAGAGAAGCCGG - Intronic
1163574864 19:18104721-18104743 ACTTAGGTGCAGAGGAAAGCCGG - Intronic
1163997929 19:21069534-21069556 AGTAATATGCAGAAGAAAACTGG + Intergenic
1166224905 19:41388879-41388901 GCTGATGTGCAGAGAAAGGCAGG + Intronic
1167165595 19:47797870-47797892 TCACATATGCAGAGAAAATCAGG + Intergenic
1202662409 1_KI270708v1_random:83944-83966 ACAAATATTCAGAAAACAGCAGG + Intergenic
925551033 2:5074699-5074721 ACTAAAATGCACAGGAAAGGGGG - Intergenic
926278255 2:11422748-11422770 ACAAATATGAAGAGAAATGGAGG + Intergenic
926947199 2:18201291-18201313 ACTAATTTGGAGAGAAAGGCAGG - Intronic
929749282 2:44693128-44693150 ACTAATATCCAGATGAGAGCTGG - Intronic
930783982 2:55252300-55252322 ACTAATAGGAAGAGTATAGCAGG - Intronic
931016366 2:57985288-57985310 TCTAATATTTAGAGAAAAGGAGG + Intronic
931923307 2:67044227-67044249 AGTACTATGCTGAGAGAAGCAGG - Intergenic
932210534 2:69925175-69925197 GCTAAAATGCAGAGAAACACAGG - Intronic
932264596 2:70356653-70356675 ACCAATCTACAGAGAGAAGCAGG + Intergenic
933034414 2:77375011-77375033 ACTAAGATTCAGAAAAAAGTAGG - Intronic
933477141 2:82805180-82805202 AATAAAAAGCAGAAAAAAGCAGG + Intergenic
933560025 2:83876946-83876968 ACTATTTTGGAGATAAAAGCAGG + Intergenic
933947016 2:87295629-87295651 ATTCATATGCAGAGAAGGGCAGG - Intergenic
934487044 2:94725297-94725319 ACTGATAGGCTGAGAAAAGGGGG + Intergenic
935547222 2:104413575-104413597 ACAAAAATGTAGAGAAAAGTAGG - Intergenic
936242492 2:110800048-110800070 ACAAATAAGCAAAGAAAAGCTGG + Intronic
936333174 2:111565940-111565962 ATTCATATGCAGAGAAGGGCAGG + Intergenic
938473559 2:131588102-131588124 ACTAATGTGCAGAGTATAGAAGG + Intergenic
938606767 2:132902023-132902045 ACCAATATGCACAGAAATTCAGG - Intronic
939361480 2:141178065-141178087 ACTAATTTGCAAACAAAACCAGG + Intronic
939684331 2:145179442-145179464 AAAAATATGCACATAAAAGCAGG + Intergenic
940477774 2:154188048-154188070 GCTAATATGAACAGAAAAACAGG - Intronic
941059066 2:160825452-160825474 AGTAATATCAAGAGAAAAGATGG - Intergenic
941335222 2:164234701-164234723 ACTAATATACAGTGTACAGCAGG - Intergenic
941360539 2:164546363-164546385 ACTAAAATAAACAGAAAAGCAGG + Intronic
941552220 2:166931079-166931101 ACTAAAATTCAGAAAATAGCTGG + Intronic
942124134 2:172806097-172806119 AAAAATCTGCAGAGAAAAACAGG - Intronic
942428359 2:175883264-175883286 ACTAATATGAAAAGAAAACCAGG + Intergenic
942704363 2:178752553-178752575 AATGTTATGCAAAGAAAAGCAGG + Intronic
943674147 2:190700142-190700164 AAAAATATGTAGTGAAAAGCAGG + Intergenic
945200784 2:207278758-207278780 ACAAATAAGTAGAGAAAAGTTGG - Intergenic
945990937 2:216394753-216394775 ACTCAGAAGCAGAGAAAAGGAGG + Intergenic
946717807 2:222571704-222571726 CCTAATATGCAGGGAAAGGATGG + Exonic
1168981256 20:2005887-2005909 ACTAATAGTCAGTGAAAAGCTGG + Intergenic
1169584777 20:7068985-7069007 AATAATATGGAGAAAAAAACAGG - Intergenic
1169730779 20:8783686-8783708 ACTAATATGCAGAGAAAAGCAGG - Intronic
1170591477 20:17775208-17775230 CCTAATAGGGCGAGAAAAGCAGG - Intergenic
1170801284 20:19592590-19592612 AGAAATGTGAAGAGAAAAGCAGG + Intronic
1170852250 20:20015808-20015830 AATAAAAAGCAGAGAAAACCTGG - Intergenic
1171312405 20:24155248-24155270 CCTAAGATGAAAAGAAAAGCAGG - Intergenic
1172305250 20:33876057-33876079 ACTAATACACAGAGGAAAGAAGG + Intergenic
1173588660 20:44206348-44206370 ACTAACATTCAGAGAGCAGCTGG + Intronic
1178328773 21:31667571-31667593 GCTAAGATGCAGTAAAAAGCAGG + Intronic
1179050415 21:37884394-37884416 GCTGAGATGCAGAGAGAAGCTGG - Intronic
1180329224 22:11461487-11461509 ACAAATATTCAGAAAACAGCAGG + Intergenic
1182845353 22:33426455-33426477 ATTAAGATGCAGAGAAATGAAGG + Intronic
1182948241 22:34345298-34345320 TCTCATATTCAGAGGAAAGCAGG + Intergenic
1182953103 22:34396207-34396229 ATTAAGATACAGACAAAAGCAGG + Intergenic
949167296 3:958160-958182 ACAAAAATGCACATAAAAGCAGG + Intergenic
949369631 3:3320102-3320124 ACTAACATGCAGAAAGAAGGTGG - Intergenic
949831743 3:8222151-8222173 ATTAATGTTCAGAGAAAAGAAGG + Intergenic
950312267 3:11968953-11968975 CCTAATAAGAAGAGAAAATCTGG + Intergenic
951429619 3:22590993-22591015 ACTAAGGTGAAGTGAAAAGCTGG + Intergenic
952077775 3:29718969-29718991 AGTAAAATGAAGACAAAAGCTGG - Intronic
952573600 3:34747234-34747256 AATAATATGCAGAGAAACACTGG + Intergenic
953622329 3:44543794-44543816 ACAAATAAGGAGATAAAAGCTGG - Intergenic
953712347 3:45284933-45284955 TCTACTAAGCAGAGAAAAACTGG - Intergenic
954509514 3:51110238-51110260 ACAGATATACAAAGAAAAGCTGG + Intronic
956247856 3:67204385-67204407 ATTAATATTGAGGGAAAAGCAGG + Intergenic
956257572 3:67300144-67300166 TTTAATGTGCAGAGAACAGCAGG + Intergenic
957117541 3:76045960-76045982 ACTTTAATGCAAAGAAAAGCAGG - Intronic
958121838 3:89300489-89300511 ACTAATAAGCAGAGAGAAAATGG + Intronic
959141404 3:102490858-102490880 AGTAATATGCAGAGGAATTCAGG - Intergenic
959831509 3:110868678-110868700 AGCATTATGGAGAGAAAAGCAGG + Intergenic
959874777 3:111369975-111369997 TCAAATATTCAGAGAGAAGCAGG - Intronic
960764374 3:121110032-121110054 AATAAAAAGCAGAAAAAAGCAGG - Intronic
960912558 3:122663852-122663874 ACAAAAATGCACATAAAAGCAGG - Intergenic
961468406 3:127096012-127096034 AGTGAAATGCAGAGGAAAGCAGG - Intergenic
963472046 3:145752765-145752787 ACTCAGATGCCTAGAAAAGCTGG + Intergenic
963672267 3:148266892-148266914 ACTAAAATGCAAAGAAAAAAAGG - Intergenic
966112645 3:176421192-176421214 AGTAATATCTAGAGAAAAACTGG + Intergenic
967873359 3:194250120-194250142 ACCTACATGCAGAGAAAGGCGGG - Intergenic
969004952 4:4011619-4011641 AAGAAGATGCAGAGAAAAGGAGG - Intergenic
969251096 4:5969425-5969447 ACAAATACCCAGAGGAAAGCAGG + Intronic
973023436 4:45234210-45234232 TCTAAAATGAAGAGAAAAGTTGG + Intergenic
974286154 4:59870120-59870142 AGAAAAATGCAGAGAAAATCTGG - Intergenic
974665094 4:64951557-64951579 ACAAATATCCAAAGAAGAGCAGG + Intergenic
975791173 4:77953257-77953279 ACTATTAAGCAGAGAAATTCAGG - Intergenic
975890448 4:79021030-79021052 TTTAATATGAAGAGGAAAGCAGG + Intergenic
977307069 4:95337823-95337845 AATGATATGCAAAGAAAAACTGG - Intronic
977428351 4:96899006-96899028 ACAAATAGGCAGAGCATAGCGGG + Intergenic
977870108 4:102081080-102081102 ACTAATATACAAAAAATAGCCGG - Intergenic
978489621 4:109298747-109298769 TCTAATATGCAGAATCAAGCAGG - Intronic
979081034 4:116341989-116342011 AATAAAATGCAGAGATAACCTGG + Intergenic
979956363 4:126958008-126958030 ACCAATATGCACAGCAAATCTGG - Intergenic
980745200 4:137003233-137003255 AATAATATGCTGAGAAAAAAGGG - Intergenic
981116850 4:141001268-141001290 AACAATATCCAGAGAAAAGAGGG - Intronic
981860251 4:149346875-149346897 AGTAATATGCAGAGGAAAAGTGG + Intergenic
982837301 4:160136169-160136191 ACTAATCATCAGAGAAATGCAGG + Intergenic
983115116 4:163805913-163805935 TCTAATATGCTGACAAAAGAAGG - Intronic
983188449 4:164728092-164728114 ACAAAAATCCAGAGGAAAGCAGG - Intergenic
984153080 4:176158783-176158805 GCTAAGAGGCAGAGAAAATCAGG - Intronic
985917998 5:2941669-2941691 ACAAATAAGCAGAAAAAAGCTGG - Intergenic
988372044 5:30383096-30383118 AGTGATATGCACAGAAAAGGTGG + Intergenic
990828139 5:59924783-59924805 GTAAATATGCAGAGAAACGCAGG + Intronic
991491854 5:67191646-67191668 ATAAATATGCAAAGAACAGCTGG - Intronic
991592371 5:68266378-68266400 ATTAATAACCAGAGAAAGGCAGG - Intronic
992901223 5:81298883-81298905 CCTAATATTCAGAGAGAATCTGG + Intergenic
993714484 5:91261959-91261981 ACTAATATGAAGAAGAAAGCAGG + Intergenic
994305488 5:98198930-98198952 ACTAAACAGCAGAGAAAGGCTGG - Intergenic
996583965 5:125063937-125063959 ACAAATATGGATAAAAAAGCTGG - Intergenic
999389531 5:151180192-151180214 TCAAGTCTGCAGAGAAAAGCTGG - Intergenic
999451784 5:151683938-151683960 ATAAATATGCAGAGATAAACAGG - Intronic
999712463 5:154330757-154330779 ACTAATAAGCAGTGAAGAGAGGG + Intronic
1006248982 6:32764718-32764740 ACTAATATACAGGGAAGAGTGGG - Intergenic
1006621891 6:35371071-35371093 TCTAAGATGCAAAGAAAAGAAGG - Intronic
1007018571 6:38495617-38495639 ACGATTATGTATAGAAAAGCTGG - Intronic
1007541493 6:42649902-42649924 TCTATTAAGCAGAAAAAAGCAGG - Intronic
1008448821 6:51625369-51625391 AATAATTTCCAAAGAAAAGCAGG + Intronic
1008463786 6:51806852-51806874 ATTAAGATGCAGAGAACATCAGG + Intronic
1009618309 6:66039008-66039030 AGTAATATGCAGTTAAAATCAGG - Intergenic
1009949412 6:70378661-70378683 AGTAATGTGCACAGAAAAGCGGG - Intergenic
1010138023 6:72577910-72577932 ACTAGTCTACAGAGAAAATCAGG - Intergenic
1010526746 6:76909390-76909412 AGTAATATGCAGAAGAAAGCTGG + Intergenic
1011958388 6:93053736-93053758 ACTAATCATCAGAGAAATGCAGG - Intergenic
1012254611 6:97017247-97017269 ATTAATAAGCAGAGCCAAGCTGG + Intronic
1012481146 6:99668552-99668574 GCTAATATGCAGACAAGAGAGGG - Intergenic
1013673562 6:112432153-112432175 AATCCTATGGAGAGAAAAGCGGG - Intergenic
1013731544 6:113173922-113173944 ACAAAAATGCACATAAAAGCAGG + Intergenic
1013740774 6:113281551-113281573 ACTAAGTTGCTGAGAAATGCCGG + Intergenic
1015479327 6:133690610-133690632 ACAATGATTCAGAGAAAAGCTGG - Intergenic
1021416804 7:20395817-20395839 ACTAATAAGCAGAAGAAAGTGGG + Intronic
1022596304 7:31716372-31716394 ACAAATATGCAGAGAGAGGGAGG + Intergenic
1023336076 7:39172154-39172176 ACAAATGTGCAAAGAAAAACTGG - Intronic
1023668725 7:42554049-42554071 AATACAATGCAGAGAAAAGAGGG - Intergenic
1024385196 7:48743081-48743103 ACTAAAATGCAGAAATAAGAGGG + Intergenic
1025157971 7:56626950-56626972 ACAAATATGCAGAGAAATACAGG - Intergenic
1025806373 7:64837732-64837754 ACTATTTTGGAGATAAAAGCAGG + Intergenic
1027360986 7:77409443-77409465 ACCAATATACAGTGAAAAGGTGG + Intronic
1028384999 7:90244840-90244862 ACTAAAGTACAGATAAAAGCTGG + Intergenic
1028609511 7:92694144-92694166 ACTAATATCCAGAGTATATCTGG - Intronic
1030550978 7:110959263-110959285 AGTAATATCCAGAGGAAAGATGG + Intronic
1031319623 7:120307848-120307870 ATAAATATGTAGAGAAATGCAGG - Intronic
1031452495 7:121938900-121938922 ACTACTATTGAGATAAAAGCAGG - Intronic
1033966208 7:146977650-146977672 AATAATATGCATTGAAAAACTGG + Intronic
1034721817 7:153300418-153300440 ACAAATATGCTTGGAAAAGCAGG + Intergenic
1034733901 7:153411724-153411746 ACTATTTTGGAGATAAAAGCAGG + Intergenic
1034744639 7:153513077-153513099 CCTAATATGCAATGAAAAGCTGG + Intergenic
1035576442 8:709995-710017 AGTAAAATTCAGAGAAAAACAGG + Intronic
1037909581 8:22735985-22736007 ACCAAAATGCAAAGAAAAGAAGG - Intronic
1039276580 8:35939133-35939155 ACAAATAAGCAAATAAAAGCTGG + Intergenic
1040409074 8:47136504-47136526 ACTAATATGCAGAGTATACAAGG - Intergenic
1041146938 8:54886462-54886484 ACTAATTATCAGAGAAATGCAGG + Intergenic
1043107160 8:76128581-76128603 ATTAAAATTCAGAGAAAAACTGG - Intergenic
1045920094 8:107519362-107519384 ACTAAAATGCAAAGACTAGCTGG + Intergenic
1046712429 8:117524764-117524786 CTTAATATGCAGAGAATATCTGG - Intronic
1047909020 8:129506379-129506401 ACTAATATCCAGAATAAAACAGG + Intergenic
1049173601 8:141177447-141177469 ACTAATCCTCAGAGAAATGCCGG + Intronic
1050027512 9:1351134-1351156 TCAAATATACAGAGAAATGCTGG + Intergenic
1050452629 9:5799378-5799400 ATTCATGTGCAGAGAAAAGTGGG + Intronic
1050872651 9:10592863-10592885 ACTAATAAGGAAATAAAAGCTGG + Intronic
1051554301 9:18365565-18365587 AGTAATAAGCAAATAAAAGCAGG + Intergenic
1051858189 9:21593779-21593801 ACAGTTATTCAGAGAAAAGCAGG + Intergenic
1051950152 9:22621412-22621434 ACTAAAATGCAGGGAGAAGACGG - Intergenic
1052259800 9:26501155-26501177 ACAAATATTCTTAGAAAAGCTGG + Intergenic
1055030333 9:71767700-71767722 CCAACTCTGCAGAGAAAAGCTGG + Intronic
1055048207 9:71952853-71952875 TTTAATAGGTAGAGAAAAGCAGG - Intronic
1055609714 9:78009151-78009173 ATTAATATTCACAGAAAAGAAGG + Intronic
1056800445 9:89687118-89687140 ATGAATATGCAGAGAGAGGCTGG - Intergenic
1059921621 9:119166958-119166980 ATTAATATTCAAAGAAAAGGAGG - Exonic
1060039099 9:120284396-120284418 ACTAAAATGCAGAGACCAGAGGG + Intergenic
1060407205 9:123378732-123378754 CCTAACATGCAGATGAAAGCTGG + Exonic
1203495062 Un_GL000224v1:143374-143396 ACAAATATTCAGAAAACAGCAGG - Intergenic
1203496416 Un_GL000224v1:155764-155786 ACAAATATTCAGACAACAGCAGG + Intergenic
1203507688 Un_KI270741v1:85297-85319 ACAAATATTCAGAAAACAGCAGG - Intergenic
1203509038 Un_KI270741v1:97686-97708 ACAAATATTCAGACAACAGCAGG + Intergenic
1185855735 X:3533324-3533346 ACTAATATGAACAGAAAATGAGG + Intergenic
1187642541 X:21310846-21310868 GCTAACATGCAGAGAAATCCTGG + Intergenic
1188234718 X:27713852-27713874 ACTGATATTAAGAGAAAAGAGGG + Intronic
1190255269 X:48757773-48757795 AGTTATCTGCAGAGAATAGCAGG - Intergenic
1192059598 X:67810497-67810519 AATAAAATACAGAGAAAACCAGG + Intergenic
1192358000 X:70421772-70421794 ATTAAAATGCAAAGAGAAGCAGG - Intergenic
1192724618 X:73735608-73735630 ACTAATATCCAGAACAAAACTGG - Intergenic
1194065749 X:89259891-89259913 GCTAAGATGCAGGGAATAGCAGG - Intergenic
1194318713 X:92415023-92415045 GCTAATTTGGAGAGAAAAGAAGG + Intronic
1195155041 X:102114412-102114434 AGCAATATGAAGAGAAAACCAGG + Intergenic
1195879577 X:109578346-109578368 ATTATGATGCAGAGACAAGCAGG - Intergenic
1196661527 X:118275919-118275941 ACCAATGTGTAAAGAAAAGCTGG + Intergenic
1197113371 X:122802310-122802332 ACTCATAAGCAGAGAATAGAAGG + Intergenic
1197412409 X:126135323-126135345 GCAAATATACAGAGAAAAGCTGG - Intergenic
1199557217 X:149122557-149122579 ACTACTACACAGAGACAAGCTGG - Intergenic
1199658890 X:150026498-150026520 ACAAATATTCAGAGGAAAGTGGG + Intergenic
1199938699 X:152602656-152602678 AGGATTAGGCAGAGAAAAGCTGG + Intergenic
1200626850 Y:5528179-5528201 GCTAATTTGGAGAGAAAAGAAGG + Intronic
1200690067 Y:6298347-6298369 ACTAATGTGCAGAGCAAAAATGG + Intergenic
1200719917 Y:6594017-6594039 GCTAAGATGCAGGGAATAGCAGG - Intergenic
1201045206 Y:9876373-9876395 ACTAATGTGCAGAGCAAAAATGG - Intergenic
1201770308 Y:17612126-17612148 ACTATTTTGGAGATAAAAGCAGG - Intergenic
1201831246 Y:18293861-18293883 ACTATTTTGGAGATAAAAGCAGG + Intergenic