ID: 1169743069

View in Genome Browser
Species Human (GRCh38)
Location 20:8916110-8916132
Sequence CAGAATAAGCTTTCTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 227}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169743064_1169743069 3 Left 1169743064 20:8916084-8916106 CCAAACAATCCGTCCCACAGTGC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1169743069 20:8916110-8916132 CAGAATAAGCTTTCTGAGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 227
1169743065_1169743069 -6 Left 1169743065 20:8916093-8916115 CCGTCCCACAGTGCTTGCAGAAT 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1169743069 20:8916110-8916132 CAGAATAAGCTTTCTGAGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 227
1169743059_1169743069 15 Left 1169743059 20:8916072-8916094 CCTCACCCTGCCCCAAACAATCC 0: 1
1: 0
2: 5
3: 76
4: 660
Right 1169743069 20:8916110-8916132 CAGAATAAGCTTTCTGAGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 227
1169743066_1169743069 -10 Left 1169743066 20:8916097-8916119 CCCACAGTGCTTGCAGAATAAGC 0: 1
1: 0
2: 1
3: 16
4: 159
Right 1169743069 20:8916110-8916132 CAGAATAAGCTTTCTGAGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 227
1169743060_1169743069 10 Left 1169743060 20:8916077-8916099 CCCTGCCCCAAACAATCCGTCCC 0: 1
1: 0
2: 0
3: 9
4: 270
Right 1169743069 20:8916110-8916132 CAGAATAAGCTTTCTGAGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 227
1169743058_1169743069 21 Left 1169743058 20:8916066-8916088 CCTCAGCCTCACCCTGCCCCAAA 0: 1
1: 0
2: 12
3: 92
4: 758
Right 1169743069 20:8916110-8916132 CAGAATAAGCTTTCTGAGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 227
1169743062_1169743069 5 Left 1169743062 20:8916082-8916104 CCCCAAACAATCCGTCCCACAGT 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1169743069 20:8916110-8916132 CAGAATAAGCTTTCTGAGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 227
1169743061_1169743069 9 Left 1169743061 20:8916078-8916100 CCTGCCCCAAACAATCCGTCCCA No data
Right 1169743069 20:8916110-8916132 CAGAATAAGCTTTCTGAGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 227
1169743063_1169743069 4 Left 1169743063 20:8916083-8916105 CCCAAACAATCCGTCCCACAGTG 0: 1
1: 0
2: 0
3: 8
4: 60
Right 1169743069 20:8916110-8916132 CAGAATAAGCTTTCTGAGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169743069 Original CRISPR CAGAATAAGCTTTCTGAGGC TGG Intronic
903101909 1:21037125-21037147 CAGAATAAGGTCTCTAAGGGTGG + Intronic
903911456 1:26729468-26729490 CAAAATTAGGGTTCTGAGGCGGG + Intronic
904885939 1:33738463-33738485 CAGATAAAGCTTCTTGAGGCAGG - Intronic
905490343 1:38338476-38338498 AAGAAGAAGCTTGCTGAGCCAGG - Intergenic
906518643 1:46454265-46454287 CAGAGTGATCTTCCTGAGGCAGG + Intergenic
907279284 1:53334988-53335010 TAGAATATGGTTTCTGGGGCTGG - Intergenic
909475834 1:76079872-76079894 CAGAGGAAGCCTGCTGAGGCAGG - Intronic
911237085 1:95423147-95423169 CATAAGAAACTCTCTGAGGCTGG + Intergenic
913576984 1:120185411-120185433 CAGATTAAGCTATCTGAACCTGG - Intergenic
914558893 1:148796846-148796868 CAGATTAAGCTATCTGAACCTGG - Intergenic
914613940 1:149333384-149333406 CAGATTAAGCTATCTGAACCTGG + Intergenic
914982433 1:152426380-152426402 CAGAAGCAGCTCTCTGATGCAGG + Intergenic
915238676 1:154503289-154503311 CTTTAAAAGCTTTCTGAGGCCGG + Intronic
917389096 1:174513359-174513381 GAGAATAAAATTGCTGAGGCAGG + Intronic
917637960 1:176955420-176955442 AAGCATAGGCTTCCTGAGGCAGG - Intronic
917787689 1:178476584-178476606 CAGAATTAGCTTTCTCTGACTGG + Intronic
918122886 1:181555479-181555501 CTGGATTAGCCTTCTGAGGCTGG - Intronic
919645074 1:200087268-200087290 GAGAATAAGCTTTAAGAGGAAGG - Intronic
919846465 1:201645697-201645719 GAAAATAAGCTTTCTCAGCCAGG + Intronic
920715694 1:208338119-208338141 CAGACTAATCTTCCTGAGCCAGG - Intergenic
922605030 1:226884948-226884970 CACTATAAGCTTTCTGAGGATGG - Intronic
923083537 1:230683436-230683458 GAGAATAGGCATTCCGAGGCTGG + Intronic
1062862432 10:821398-821420 CAGAATGTGGTTCCTGAGGCTGG - Intronic
1065741130 10:28798102-28798124 CAGAATTTCCTTTTTGAGGCTGG + Intergenic
1066217207 10:33299435-33299457 CAGATCAAGATGTCTGAGGCAGG + Intronic
1066367792 10:34793478-34793500 CAGAGTAAACTTTCTAAGGATGG - Intronic
1067468715 10:46520980-46521002 CAGATCAGGCTTCCTGAGGCAGG - Intergenic
1068663925 10:59652468-59652490 CAGAGAAAGCCTTCTGAGGCTGG + Exonic
1069704104 10:70446777-70446799 AAGCATAAGCTTTGTGAGGGTGG + Intronic
1070245580 10:74728528-74728550 GAGTAAAATCTTTCTGAGGCTGG + Intergenic
1073478815 10:103772651-103772673 CCGAATCAGCTTTCTCTGGCTGG - Intronic
1073665652 10:105530704-105530726 CAAAATAAGCTTTCTGATTATGG + Intergenic
1073700584 10:105922300-105922322 GAGAATAAGCTCCATGAGGCTGG - Intergenic
1073954972 10:108860049-108860071 GACACTAAGCTTCCTGAGGCTGG + Intergenic
1074597700 10:114882527-114882549 CAGAAAATGCCTTGTGAGGCTGG + Intronic
1074982353 10:118629994-118630016 CAGAATATGCTCTCAGAGGAAGG + Intergenic
1075391185 10:122093428-122093450 AAGAATAAGCTTTTAGAGGATGG + Intronic
1075790110 10:125077982-125078004 CATAAGAACCTTTCTCAGGCCGG + Intronic
1076383368 10:130039950-130039972 CAGAATTAGCTTCCCCAGGCTGG - Intergenic
1076708955 10:132320594-132320616 CAGCTTAAGTTTTCTCAGGCAGG + Intronic
1076740504 10:132480768-132480790 AAGAAGAAGCTTTCAGGGGCTGG + Intergenic
1077195135 11:1276056-1276078 CTGTAAAAGCTTTCTGAGGCGGG - Exonic
1077581942 11:3422654-3422676 CAGGATGAGCGTTATGAGGCGGG + Intergenic
1078827839 11:14948175-14948197 CAGAAAAAGCTGCCTGAGGAGGG - Intronic
1080810728 11:35701765-35701787 CAAAAAAAGAATTCTGAGGCTGG - Intronic
1081933841 11:46890888-46890910 CTTAAAAAGCATTCTGAGGCTGG - Intronic
1083791298 11:64988085-64988107 CAGGACAAGCACTCTGAGGCGGG - Exonic
1083909106 11:65695270-65695292 CAAAAAAAGCTATCTGGGGCTGG - Intergenic
1084223087 11:67696877-67696899 CAGAATAAGCTGTGTGGGGAGGG - Intergenic
1084238857 11:67805471-67805493 CAGGATGAGCGTTATGAGGCGGG + Intergenic
1085480310 11:76816734-76816756 CAGAAAAAGAATTCTGAGGCTGG - Intergenic
1085781629 11:79414541-79414563 CAGAAGAAGCTTTCGGCAGCAGG - Intronic
1089191232 11:116654768-116654790 CAGCATAAGCAGTATGAGGCTGG - Intergenic
1089344708 11:117783781-117783803 CAGAATATGGTTTTTCAGGCTGG + Intronic
1089623907 11:119739430-119739452 CAGGACCAGCTGTCTGAGGCTGG - Intergenic
1089712229 11:120324010-120324032 CATAATAAGCTCTCTCAGCCTGG + Intergenic
1090211779 11:124925822-124925844 CAGAAAAAGCTTTTTCATGCTGG + Intronic
1091915036 12:4265829-4265851 CAGAATACGCCTTCTGTGTCTGG - Intergenic
1092456817 12:8651233-8651255 AAGAATCAGATTTCTTAGGCAGG + Intronic
1093504638 12:19850920-19850942 CAGCTTCAGATTTCTGAGGCGGG + Intergenic
1094035976 12:26072364-26072386 CAGAATAAGCTTTCGATGCCAGG + Exonic
1096444785 12:51679596-51679618 CAGAAAAAGCTTGCTGGTGCCGG + Intronic
1097391847 12:59024841-59024863 GAGTATAAGCTCCCTGAGGCAGG + Intergenic
1098212619 12:68182355-68182377 CATCAAAAGCTTCCTGAGGCTGG - Intergenic
1100445553 12:94656603-94656625 TAGGATAAGGCTTCTGAGGCTGG - Intergenic
1100977434 12:100137105-100137127 TAGGAAAAGCTATCTGAGGCTGG - Intronic
1103180976 12:118911253-118911275 CAGAAAAATCTATCTGAGACTGG + Intergenic
1103192158 12:119010347-119010369 CAGAAAATATTTTCTGAGGCTGG - Intronic
1103459086 12:121089626-121089648 CAGACTGACCTTTCTGGGGCTGG - Intergenic
1104591400 12:130086997-130087019 CAGAAGCAGCTTCCTGAGGATGG - Intergenic
1105274986 13:18912914-18912936 CAGAATAATTTTTCTGAGATTGG - Intergenic
1106124056 13:26885658-26885680 CATGATAAGCTTTCTAAGGAGGG - Intergenic
1106425025 13:29619801-29619823 CAGAAAAAACTTTCTAAGGATGG - Intergenic
1107088048 13:36447031-36447053 AAGATGAAGTTTTCTGAGGCAGG + Intergenic
1107955875 13:45510843-45510865 CATCTTAAGCTTTCTTAGGCAGG + Intronic
1108520298 13:51241054-51241076 CAGAAAAGGCTTTCTGAGCCAGG - Intronic
1109181362 13:59217817-59217839 CAGAAAAAAACTTCTGAGGCAGG + Intergenic
1110564964 13:76948892-76948914 TAAGATAAGCTTTTTGAGGCAGG + Intronic
1111510292 13:89252752-89252774 CAGAATAAACTTTCTGAAAATGG - Intergenic
1113161330 13:107384827-107384849 CAGACTTTGCTTTCTCAGGCAGG + Intronic
1114424129 14:22608352-22608374 CAGAGCCAGCTTTCTGGGGCTGG - Intronic
1114730555 14:24988460-24988482 CAGTTTAATCTTTCAGAGGCTGG + Intronic
1116946682 14:50841964-50841986 AAAAATTAGCTTTCTAAGGCCGG + Intergenic
1120430663 14:84410344-84410366 AAGATTAAGCTTACTGAGGAAGG + Intergenic
1120686501 14:87543951-87543973 CACAACAACCCTTCTGAGGCAGG + Intergenic
1121503561 14:94459142-94459164 CTGAAATAGCTTTCTGAGGGTGG + Intergenic
1123198313 14:106638273-106638295 GAGAATTAGCCTCCTGAGGCTGG - Intergenic
1128305454 15:66595278-66595300 CAGAAAAACCTTTCTGGTGCCGG + Intronic
1128536437 15:68494182-68494204 CAGAGGAAGCATTCTGAGGAAGG - Intergenic
1129224766 15:74162615-74162637 AAAAATAAGCTTTCTGGGTCAGG - Intergenic
1129251241 15:74310240-74310262 CAGAATTTGAATTCTGAGGCCGG + Intronic
1129852882 15:78804687-78804709 CAGAGAAAGCTCTTTGAGGCTGG - Intronic
1130250081 15:82294358-82294380 CAGAGAAAGCTCTTTGAGGCCGG + Intergenic
1131732431 15:95296348-95296370 CAGAATGAGAGTCCTGAGGCTGG + Intergenic
1133580182 16:7137239-7137261 CAGAATAGGTTTTCTAAAGCTGG - Intronic
1134173259 16:11985758-11985780 CAGCAGAGGCTTCCTGAGGCAGG + Intronic
1134204691 16:12227601-12227623 CAAAATGAGGTCTCTGAGGCCGG + Intronic
1135238383 16:20780059-20780081 CAGAAAATGTTTGCTGAGGCTGG - Intronic
1136112128 16:28070289-28070311 CAGAAAATGCTCTCAGAGGCAGG + Intergenic
1137415491 16:48274305-48274327 AAGTACAAGCTTTCTCAGGCAGG + Intronic
1137546674 16:49409418-49409440 CAGCAGAACCTTTCTGTGGCAGG + Intergenic
1137950845 16:52782004-52782026 GAGAAAAAGCCTGCTGAGGCAGG - Intergenic
1141098399 16:81179259-81179281 CAAAATAACCATTCTGAGGCAGG + Intergenic
1141716573 16:85730405-85730427 CAAAGTAGGCTTTCTGAGCCGGG - Intronic
1142901669 17:3015977-3015999 CTGCATCAGCTTTCTGAAGCTGG + Intronic
1143982144 17:10879334-10879356 CAAAACAGGCTTTGTGAGGCTGG - Intergenic
1149200436 17:54179438-54179460 CAGAATATGCTTTCTTTGGTGGG + Intergenic
1149456320 17:56791494-56791516 AACAGTAAGCTTTCTGATGCTGG + Intergenic
1150332517 17:64305713-64305735 CAGAATAATTTTTTTGAGACAGG - Intergenic
1151934310 17:77252774-77252796 CAGAAGGAGCTTTCCCAGGCTGG + Intergenic
1156393037 18:36670864-36670886 CATAATTAGCTTTGTTAGGCAGG + Intronic
1157766421 18:50300464-50300486 TAGAATAAGCGTTCTGAAGTTGG - Intergenic
1158709190 18:59822123-59822145 GAGAACAAGCTTTCTGAGGAAGG + Intergenic
1161005244 19:1932484-1932506 AAGAAGGAGCTTTCTCAGGCTGG + Intergenic
1164870095 19:31635908-31635930 CAGATTCAGCTTTCAGAGGAAGG - Intergenic
1167865260 19:52320497-52320519 CAGAAAAAACTTGCTGAGGCTGG + Intronic
925735818 2:6962746-6962768 CAGCATAAACTTCCAGAGGCAGG + Intronic
926074881 2:9934525-9934547 AAAAATTAGTTTTCTGAGGCCGG + Intergenic
926380652 2:12285475-12285497 CAGAATAATCTTTCTGCTGATGG - Intergenic
926721007 2:15960055-15960077 GAGAACAAGCTTTCTGCAGCAGG - Intergenic
928056631 2:28062609-28062631 CAGAAGAAGTTTTATGAAGCAGG - Intronic
928817354 2:35314769-35314791 CAGACTTAACTTTCTGTGGCTGG + Intergenic
931089942 2:58874998-58875020 AAGCATAGGCTTTCTGAGGTGGG + Intergenic
931807784 2:65824435-65824457 CAGAATAGGCCTTCTGAAGCAGG + Intergenic
933204396 2:79488796-79488818 CAGGAGAGGCTTTCTGAGGAGGG - Intronic
933720290 2:85393330-85393352 CAGATTAAGATTTTTGTGGCTGG - Intergenic
935137878 2:100322755-100322777 GAGAAGAAGCTCGCTGAGGCGGG - Intergenic
935639207 2:105274841-105274863 CAAAATGAGCTTTCTGATGCAGG - Intronic
937698465 2:124836386-124836408 GAGGATAAGCTGTCTGTGGCAGG - Intronic
938924497 2:136026309-136026331 CAGAAAAAGCTTGCTGACTCGGG - Intergenic
939787320 2:146533056-146533078 TAGATTAAGCTGTCTCAGGCTGG - Intergenic
942110306 2:172675300-172675322 CTGATTAAGCTTGCTGAGGAGGG + Intergenic
942480386 2:176381537-176381559 AAGATTAAGTTTTCTGAAGCAGG + Intergenic
945815015 2:214594036-214594058 CAGCATGAACTTTCTCAGGCAGG + Intergenic
947652907 2:231802412-231802434 GAGAAAGAGCTTTCTGGGGCAGG - Intronic
948889528 2:240900238-240900260 CAGACTCATTTTTCTGAGGCAGG + Intergenic
1168930114 20:1615068-1615090 CAGAAAAAACTTACTGATGCTGG - Intronic
1169743069 20:8916110-8916132 CAGAATAAGCTTTCTGAGGCTGG + Intronic
1172342121 20:34166709-34166731 CAGATTAAGCTGGATGAGGCTGG - Intergenic
1172837091 20:37880125-37880147 CAGAAAAAGGCTTCTGTGGCAGG - Intergenic
1173026982 20:39316861-39316883 ATGAATCAGCTTTCTGAGGATGG - Intergenic
1173987993 20:47277591-47277613 GAGAATAAGCTTTCCAAGGAAGG + Intronic
1174224461 20:48985654-48985676 TAGAATTAGCGTTCTGAGGCAGG - Intronic
1174656328 20:52175546-52175568 CAGAATTCACTGTCTGAGGCCGG + Intronic
1176807905 21:13508412-13508434 CAGAATAATTTTTCTGAGATTGG + Intergenic
1180593994 22:16961947-16961969 CAGATCAAGCCTTCTTAGGCAGG + Exonic
1180855036 22:19040323-19040345 CAGAATGGGCATTGTGAGGCTGG - Intronic
1180881773 22:19209362-19209384 CAGGTTAAGCTTTCTGGGCCGGG + Intronic
1181790957 22:25266059-25266081 CAGAATATGGTTTCACAGGCTGG + Intergenic
1181992904 22:26851125-26851147 GACAATAAGCATTCTGAGACAGG - Intergenic
1182028927 22:27142156-27142178 CAGAATTAGCTATGTGTGGCCGG - Intergenic
949126425 3:450325-450347 CAGAAATGGCTTCCTGAGGCAGG - Intergenic
952260616 3:31736553-31736575 CAGTTTGAGGTTTCTGAGGCGGG - Intronic
952867702 3:37865609-37865631 CATAATAAGCTGTCTGAGGTAGG + Intronic
956521365 3:70107764-70107786 CAGAATCACCTTTCAGAGGTTGG - Intergenic
958532674 3:95353640-95353662 CTGAATTAACTTTCTGAAGCAGG + Intergenic
961300048 3:125916444-125916466 CAGGATGAGCGTTATGAGGCGGG - Intergenic
962433137 3:135338635-135338657 CAGAAAGAGCTTCCTGAGGTGGG - Intergenic
963835582 3:150055209-150055231 CAGGATATGCTCACTGAGGCTGG + Intergenic
963882077 3:150539333-150539355 CAGAATAATCTTTAAGAAGCAGG - Intergenic
968504150 4:964276-964298 CAGAATGAGTTGTCTGTGGCTGG - Intronic
969370725 4:6729418-6729440 TAGAATGAACTTTCTGAGGAAGG + Intergenic
970068874 4:12131334-12131356 AATAATAAGCTTTCTGAATCTGG + Intergenic
970707113 4:18817253-18817275 CATAAAAAGATATCTGAGGCAGG - Intergenic
970712275 4:18877121-18877143 CAGAAGAAACTGTCAGAGGCAGG - Intergenic
975606109 4:76156059-76156081 CAGAATAAGTTAGCTGTGGCTGG + Intergenic
976425603 4:84899710-84899732 CAGAAAAAGTTTTCTGACCCTGG + Intronic
976832740 4:89333395-89333417 CAGAATAAGCTGCCTCAGGCTGG - Intergenic
978192156 4:105926370-105926392 CAGAACAAGGTTTCCGAGTCTGG + Intronic
979233470 4:118372310-118372332 CAGAAGAAGAATTTTGAGGCTGG - Intergenic
979371621 4:119895133-119895155 AAGAATCAGTTTTCTGAGTCAGG + Intergenic
980962709 4:139492231-139492253 CACAATAACCTTTATGAGACAGG + Intergenic
982152971 4:152483405-152483427 AAAAAAAAGCTTTTTGAGGCTGG + Intronic
982226185 4:153169313-153169335 GAGTCTAAGTTTTCTGAGGCAGG - Intronic
982696886 4:158612145-158612167 CAGAATAACCTTCCTGAAGCCGG + Exonic
984766437 4:183403987-183404009 CAGTCTAAGCCTTCTCAGGCTGG - Intergenic
985770003 5:1803657-1803679 CAGAAAAGGGTTTCTGAGGATGG - Intronic
988487721 5:31680544-31680566 AAGACTTAGCTTCCTGAGGCTGG - Intronic
988711059 5:33775308-33775330 GAGAATAGGATTTCTGAGGTGGG + Intronic
989372539 5:40724264-40724286 CAGAATTTGCTTTCTGTGACTGG - Intronic
989566097 5:42902993-42903015 CAGAATTAGCTTTCTGATCTTGG + Intergenic
989567127 5:42911771-42911793 CAGAATTAGCTTTCTGATCTTGG - Intergenic
989768714 5:45117171-45117193 CAGAATAAGCTTCCAGAGGAAGG - Intergenic
990739269 5:58895568-58895590 CAGAACAACCTTTATGAGGTAGG - Intergenic
990775218 5:59299090-59299112 AATAATAAGCTTTGAGAGGCGGG - Intronic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993070124 5:83151317-83151339 CAGAATGAGTTTTATTAGGCAGG + Intronic
993932712 5:93960696-93960718 CAGTATATGCTTTCTGAACCAGG - Intronic
996878344 5:128264380-128264402 CAGACTGTGCTTTCTGAGGCAGG + Intronic
996883575 5:128328701-128328723 CAGGATCTGCTGTCTGAGGCTGG + Exonic
997042970 5:130278973-130278995 CAGAATAAGCTCCTTGAGGTGGG - Intergenic
997893577 5:137696165-137696187 GAGAAGGTGCTTTCTGAGGCAGG - Intronic
998545681 5:143025458-143025480 CATCATCAGCTTTCTGAGGGTGG - Intronic
1003547613 6:7073735-7073757 TAGAAAAAGCTTGCTGATGCTGG - Intergenic
1003648798 6:7939024-7939046 CAGAAGAAGCTTCCTGATGTTGG - Intronic
1004207346 6:13604404-13604426 CAGGATAAACTTTGTGAAGCAGG + Intronic
1008510834 6:52274188-52274210 CAGAATAAGGTTTGGGAAGCAGG - Intronic
1008978796 6:57459130-57459152 CAGTTTAAGTTCTCTGAGGCTGG + Intronic
1009166933 6:60352116-60352138 CAGTTTAAGTTCTCTGAGGCTGG + Intergenic
1009790005 6:68390242-68390264 AAGAACAAGCTTTCTGAGAGTGG - Intergenic
1012472544 6:99588473-99588495 GAAATTAAGCTTCCTGAGGCTGG + Intergenic
1015445410 6:133298254-133298276 CAGAATAAGATGTCCCAGGCTGG + Intronic
1020950350 7:14668197-14668219 TAGAATAAAATTTGTGAGGCTGG + Intronic
1028025967 7:85840376-85840398 AAGATTAAGCTTTCTGAAACAGG - Intergenic
1031532192 7:122888084-122888106 AAGTAATAGCTTTCTGAGGCAGG + Intergenic
1032899783 7:136294189-136294211 ATGACTCAGCTTTCTGAGGCAGG - Intergenic
1033741573 7:144279912-144279934 CAGCAAAAGCTTTTTGAGTCGGG + Intergenic
1033752329 7:144369702-144369724 CAGCAAAAGCTTTTTGAGTCGGG - Intronic
1035116141 7:156525855-156525877 CAGAAAAAGAATTATGAGGCTGG + Intergenic
1035412315 7:158654751-158654773 TAGGAGAAGCTTTGTGAGGCTGG - Intronic
1035965631 8:4188443-4188465 CAAAATAAAGTTTCTCAGGCTGG - Intronic
1038944403 8:32341486-32341508 CAGACTCAGATTTCTGAGTCAGG + Intronic
1039286031 8:36041816-36041838 CTGCATAAACTTTCTAAGGCAGG + Intergenic
1042160424 8:65888545-65888567 CAGAACAAGATTTCAGAGGGAGG + Intergenic
1043445014 8:80310878-80310900 CAAAATAAACTTTCAGTGGCTGG - Intergenic
1043927050 8:86049254-86049276 CAGAGTAAGCTTTCAAAGGGAGG - Intronic
1047038785 8:120969827-120969849 AAGAACAAGCTTCCTGAGCCTGG + Intergenic
1047499159 8:125429324-125429346 CAGAAAGAGCTTCCTGAGCCAGG - Intergenic
1050009812 9:1173757-1173779 CAGAATAGGCCTTGTGCGGCTGG + Intergenic
1050096522 9:2073102-2073124 CAGAATAAGGTTTCACATGCTGG + Intronic
1050153567 9:2642072-2642094 CAGAGTTAGCTTTCAGAGACAGG - Intronic
1050723866 9:8623469-8623491 CAGAATTATCTTGCTAAGGCTGG - Intronic
1051065541 9:13098024-13098046 CAGCATGAGCTTTCAGAGCCAGG + Intergenic
1053109482 9:35445359-35445381 CAGGATAAGCTTTCTGCAGATGG - Intergenic
1053306047 9:36985639-36985661 CAAGAAGAGCTTTCTGAGGCCGG + Intronic
1053472863 9:38359268-38359290 CAGGATAACCTTTCTGATGCGGG + Intergenic
1056709204 9:88977050-88977072 AAGAATGAGCTTTCTGAAGGTGG + Intergenic
1056761351 9:89417714-89417736 GAGAGTAAGCTTTCTGGTGCAGG + Intronic
1060298894 9:122362332-122362354 CAGAGGTAGCTTTCTGAGGGTGG + Intergenic
1060393313 9:123297439-123297461 AAGAATAAGCAATCTAAGGCCGG + Intergenic
1061778604 9:132982893-132982915 GAGAATCACCTTCCTGAGGCTGG + Intronic
1061870068 9:133515754-133515776 CAGCAGAAGCCATCTGAGGCTGG - Intronic
1191287846 X:58757035-58757057 CAGAAAAGGCTTTGTGAGGATGG + Intergenic
1191392195 X:60150958-60150980 CAGAAAAGGCTTTGTGAGGATGG + Intergenic
1191518834 X:61846541-61846563 CAGAATATTCTTTCTGATGATGG + Intergenic
1191530380 X:62001016-62001038 CAGAATATTCTTTCTGATGATGG + Intergenic
1191659661 X:63636469-63636491 CTGAATAACGTGTCTGAGGCAGG - Exonic
1193363814 X:80606975-80606997 CAAAAAAAGAATTCTGAGGCTGG + Intergenic
1194142699 X:90224104-90224126 CAGTATTTGCTTTCTGTGGCTGG - Intergenic
1195568238 X:106370163-106370185 GAGTAAAAGCTTTCTGAGGCCGG - Intergenic
1196183066 X:112716171-112716193 CAGACTTAGGTCTCTGAGGCTGG - Intergenic
1199343177 X:146706765-146706787 CAGTATAAGCTTTTCAAGGCAGG - Intergenic
1199479404 X:148281674-148281696 GAAAATAAGCTTCATGAGGCAGG - Intergenic
1200138112 X:153884807-153884829 CAGCATCATCTTTCTGGGGCGGG - Intronic
1200325240 X:155231053-155231075 TAGAATAAAGGTTCTGAGGCAGG - Intronic
1200488456 Y:3793207-3793229 CAGTATTTGCTTTCTGTGGCTGG - Intergenic