ID: 1169744297

View in Genome Browser
Species Human (GRCh38)
Location 20:8927988-8928010
Sequence AATAAGGAGGTGGGTACAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169744297 Original CRISPR AATAAGGAGGTGGGTACAGT AGG Intronic
900941275 1:5800105-5800127 AAGAAGGGGGTGGGCCCAGTGGG + Intergenic
902620588 1:17648521-17648543 AGGAAGGAGGTGGGTAGAGCTGG - Intronic
902772068 1:18650929-18650951 AAGCAGGAGTTGGGGACAGTAGG - Intronic
904867302 1:33590661-33590683 AATAACATGGTGGATACAGTGGG - Intronic
905458791 1:38107144-38107166 AAAAAGGAGGTGGTTCCAGGGGG + Intergenic
905749626 1:40450840-40450862 ATTAAGGAGATCGGTACAATTGG + Exonic
906727451 1:48054508-48054530 CAAAAGGAGGTGGGTGGAGTGGG + Intergenic
907162954 1:52384830-52384852 AATGTGGAGGTGGGGGCAGTAGG + Intronic
912121055 1:106472874-106472896 AATAAGAAGCTGATTACAGTGGG + Intergenic
912262474 1:108122933-108122955 AATAACAAGGTGGGCAGAGTGGG - Intergenic
914453878 1:147817297-147817319 AATAAGGAGATGATTACAGATGG - Intergenic
916549583 1:165837219-165837241 AATAAGTAAGTGGCAACAGTGGG - Intronic
917131764 1:171750675-171750697 AATCAGGGGGTGGGGCCAGTTGG - Intergenic
918880337 1:190111253-190111275 AATAAGGAGGTGATTACCATCGG - Intronic
919365989 1:196661632-196661654 TATTAGGAGGTGGGGACACTGGG - Intronic
920193794 1:204212867-204212889 AACAAGGAGGTGGGTATACCTGG - Intronic
921376028 1:214474732-214474754 AATAAGGGGGTGGCTTCAGCAGG + Intronic
924528871 1:244876554-244876576 AATAAAGAGGTGGGTAGTGAGGG + Intergenic
1064097675 10:12435970-12435992 AATGGGGTGGTGGGGACAGTCGG + Intronic
1065119587 10:22515587-22515609 AACAAGGTGGTGGGCACAGAGGG + Intergenic
1066586928 10:36945748-36945770 AACATGGAGGTGGGTAGAGATGG - Intergenic
1067018532 10:42775460-42775482 AATTAGGAGGTGGGGCCTGTGGG + Intergenic
1069753402 10:70759335-70759357 AAGAGGGAGGTGGGAAGAGTGGG - Intronic
1070789807 10:79182322-79182344 AAGAAGGAGGTGGGTGCATCAGG - Intronic
1073576393 10:104629616-104629638 ATTAAGGAGATGGGGACAGGTGG + Intergenic
1074737479 10:116451488-116451510 AATTTGGAGGTGGGAATAGTGGG + Intronic
1075247959 10:120840830-120840852 AATAAGGATTTGGGTAAAGATGG - Intergenic
1077985609 11:7348245-7348267 ACTGAGGAGGGGGGTAGAGTTGG - Intronic
1078438059 11:11341782-11341804 AAGAAGGAGTTGGGGGCAGTGGG - Intronic
1082263185 11:50093255-50093277 AATAAGGGGCTGGGCACAGGTGG + Intergenic
1085046519 11:73356783-73356805 AGTGAGGAGGTGGGGACAGCCGG - Intronic
1085901338 11:80703371-80703393 AACATGGAGGTGGGTAGAGATGG + Intergenic
1086960686 11:92977637-92977659 AACAAGGTGGTGGGAACAGTGGG - Intronic
1087463802 11:98478596-98478618 AATAAAAAGGAGGGTGCAGTAGG - Intergenic
1090388167 11:126368616-126368638 AATTAGGAAGTGGGTACAGCTGG + Intronic
1090390907 11:126386595-126386617 AATTAGGAAGTGGGTACAGCTGG + Intronic
1090618292 11:128537413-128537435 CATTGGGAGGTGGATACAGTAGG + Intronic
1090728057 11:129545209-129545231 AATGAAGGGGTGGGAACAGTTGG + Intergenic
1091694347 12:2617826-2617848 AATGAGGAGGTGGGTGCATGGGG + Intronic
1091985619 12:4908807-4908829 ATTAAGGAGGTGGGTGGTGTAGG + Intergenic
1093438647 12:19167061-19167083 AATAATGAGGTGGGGAAGGTGGG - Intronic
1096714283 12:53482006-53482028 CTGAAGGAGGTGGGTCCAGTGGG + Exonic
1097333017 12:58352847-58352869 AATAAGGAGGTTGGACCAGGTGG - Intergenic
1097756824 12:63416123-63416145 TATAAGGAGGGGGGGACAATAGG - Intergenic
1099269404 12:80488280-80488302 CAACAGGAGGTGGGTATAGTGGG + Intronic
1099819676 12:87693965-87693987 AATGGGAAGGTGGGTACAGAGGG + Intergenic
1100424660 12:94473046-94473068 AAGAGGGAGGTGGATTCAGTAGG + Intergenic
1100688641 12:97014306-97014328 AATAGCCAGGTGTGTACAGTGGG + Intergenic
1107572003 13:41671597-41671619 TATTAGGAGGTGGGTACTTTTGG + Intronic
1110423411 13:75338687-75338709 AGTAAGGAGGTTGATACATTTGG - Intronic
1111516996 13:89347042-89347064 AAGAAGAAGGTAGGTACTGTAGG + Intergenic
1111527408 13:89491047-89491069 CATTAGGAGGTGGGTGCTGTGGG - Intergenic
1112631442 13:101165366-101165388 AATAAGGAGGTGGTTAGTGAAGG - Intronic
1112992049 13:105525833-105525855 CATAAGGAAGGGGGTACAGGTGG - Intergenic
1117228373 14:53687593-53687615 AACAAGGACTTGGGTACAGATGG - Intergenic
1117949382 14:61066207-61066229 CATAAGGAGGTAGGAAAAGTAGG + Intronic
1118713943 14:68546053-68546075 AATACAGTGGTGGATACAGTAGG - Intronic
1120246914 14:82017847-82017869 AATTACGATGTGTGTACAGTAGG + Intergenic
1121537104 14:94698508-94698530 AAAGAGGAGGTGGGTCCAGAGGG - Intergenic
1122910911 14:104827181-104827203 AATGAGGAGGTGGCAACAGCAGG + Intergenic
1125546649 15:40511298-40511320 AATGGGGATGTGGGTATAGTGGG + Intergenic
1126376458 15:48001731-48001753 AAGAAGGAGGTGGGTAGAAAGGG + Intergenic
1127876236 15:63113999-63114021 GATACAGTGGTGGGTACAGTGGG + Intergenic
1129511717 15:76128723-76128745 AATAAGCAGGTGGCTTCAGCTGG - Intronic
1130906723 15:88245968-88245990 AATAAGGAAGTGGGGAAAGATGG + Intronic
1131879465 15:96847180-96847202 AAAAAGGGGGTGGGTACTGTGGG - Intergenic
1132095357 15:98980469-98980491 AATAAGTAAGTGGGTCCAGGAGG + Intronic
1132110474 15:99099070-99099092 GATAAGGAGGTGGGCTCAGAGGG + Intronic
1132424000 15:101698566-101698588 AAAAAGGAGTGGGGTAGAGTAGG - Intronic
1137594687 16:49715884-49715906 AAAAAGTAGCTGGGCACAGTGGG + Intronic
1138022883 16:53500803-53500825 GAAAAGGAGGTGGGTATAGAAGG - Intronic
1138458140 16:57132922-57132944 AATAAAGAGGGGGGAAGAGTGGG + Intronic
1138496633 16:57412913-57412935 AATAATGAGGTTGATAAAGTTGG - Intronic
1140298554 16:73732882-73732904 ATTAAGGCGGTGGGTTCAGCAGG + Intergenic
1143886875 17:10071461-10071483 CATGAGGAGGTGGGTGCAATCGG + Intronic
1147315769 17:39619325-39619347 CTTAAGGAGGTGGGGACTGTGGG + Intergenic
1153622416 18:6991173-6991195 CAAAAGGAGGTGCTTACAGTTGG - Intronic
1154000548 18:10478656-10478678 AATTAGGAGGTGGGGCCTGTGGG - Intronic
1155815817 18:30307971-30307993 AAGGAAGAGGTGGGTAGAGTGGG + Intergenic
1156191761 18:34728605-34728627 AACAAGGACTTGGGTACAGTTGG + Intronic
1156453301 18:37278878-37278900 AGAAAGGAGGTGGGCAGAGTGGG - Intronic
1156762440 18:40609530-40609552 AATAAGGCAATGGTTACAGTTGG - Intergenic
1156837908 18:41577273-41577295 AAACTTGAGGTGGGTACAGTTGG + Intergenic
1159566693 18:70059057-70059079 CAAAAGGAGGTGGGTATGGTTGG + Intronic
1162208059 19:9070720-9070742 AAAAATTAGGTGGGCACAGTGGG - Intergenic
1163198472 19:15743424-15743446 AAAAAGGAGGTTGGTAAAATAGG + Intergenic
1163279133 19:16304417-16304439 AAAAAGTAGGTGGGTATGGTGGG + Intergenic
1164879561 19:31720630-31720652 CATCAGGAGGTGAGTTCAGTGGG - Intergenic
1165258693 19:34595803-34595825 AATCAGCAGGTGGGGACAGCTGG + Exonic
1166009709 19:39933493-39933515 AAAAACCAGCTGGGTACAGTTGG - Intronic
1166011338 19:39944906-39944928 AAAAAGGAAGAGGGTACAGTGGG + Intergenic
1166591957 19:44007578-44007600 ACTCAGGAGGTGGGTGAAGTGGG - Intronic
1167332548 19:48865489-48865511 CATAAGCAGGTGGGGTCAGTAGG - Exonic
926630756 2:15134155-15134177 AATAAGGAGGTGGGGCCTTTGGG + Intergenic
927631321 2:24776597-24776619 AATCAGAATGTGGGGACAGTGGG - Intergenic
928678321 2:33672400-33672422 AATAAGGAATGGGTTACAGTAGG - Intergenic
928703068 2:33918681-33918703 AATAATGAGGGGGGTGCAGAAGG + Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932666208 2:73700938-73700960 GAGAAGGTGGTGGGCACAGTAGG - Intergenic
934493786 2:94780575-94780597 ATTAAGGGGGTGGGGAGAGTTGG - Intergenic
935626417 2:105175647-105175669 AAGAAGGAGGAAGGCACAGTTGG + Intergenic
938540324 2:132279782-132279804 AGTAAGTAGGTAGGGACAGTGGG + Intergenic
938560527 2:132468706-132468728 AAGCAGGAGGTGGTTACAGATGG + Intronic
941018338 2:160382186-160382208 TATAAGGAGGTGGGTGAAGTTGG + Intronic
942594153 2:177576358-177576380 AAGAAGGATTGGGGTACAGTTGG - Intergenic
946616182 2:221513131-221513153 AACACTGAGGTGGGTACTGTGGG + Intronic
947727069 2:232407499-232407521 AATAAGGAGCTGGAGGCAGTTGG + Intronic
1169458671 20:5775736-5775758 AATAAGGAGACAGGTACAGAGGG - Intronic
1169744297 20:8927988-8928010 AATAAGGAGGTGGGTACAGTAGG + Intronic
1169992823 20:11522644-11522666 GAAAAGGAGGTGGGGACAGCAGG - Intergenic
1170456914 20:16542007-16542029 AAAGGGGAGGTTGGTACAGTAGG - Intronic
1171869250 20:30512785-30512807 AGTAAGTAGGTAGGGACAGTGGG + Intergenic
1172536502 20:35677780-35677802 AATAATAAGCTGGGTGCAGTGGG + Intronic
1172683151 20:36732737-36732759 AATAAGCAGGAGGGTACACTTGG + Intronic
1173017091 20:39235534-39235556 GACAAGGAGGCGGGTACAGATGG - Intergenic
1173358434 20:42317502-42317524 ATTAATGAGGTGGTTGCAGTAGG + Intronic
1176407734 21:6430576-6430598 AATGAGGAAGGGGGAACAGTCGG + Intergenic
1178027794 21:28488021-28488043 AATAAGGAGATGAGTAAACTTGG + Intergenic
1178371931 21:32033537-32033559 AGTAAAGAGGTGGGTACAGCTGG - Intronic
1178705872 21:34872313-34872335 CATGAGGGGGTGGCTACAGTGGG + Intronic
1179357847 21:40677846-40677868 ATCAAGGAGGTGGGTAGATTTGG - Intronic
1179683225 21:43038907-43038929 AATGAGGAAGGGGGAACAGTCGG + Intergenic
1180938671 22:19642421-19642443 CAAAAGGAGGTGGGCACAGCTGG - Intergenic
1180985442 22:19901374-19901396 TAGGAGGAGGTGGGTGCAGTGGG + Intronic
1182568350 22:31216519-31216541 AATCTGGAGGTGGGTATAGTGGG + Intronic
1183816354 22:40304553-40304575 AATAAGTAGATGGGAACAGAAGG - Intronic
951066750 3:18275953-18275975 AATTAGGAGGTGGGGACCTTTGG + Intronic
951219155 3:20051297-20051319 GATAAGGAGGTGGGTGCATGTGG + Intronic
954023402 3:47762277-47762299 AATAAGAAGGGGCTTACAGTTGG - Intronic
954700659 3:52449150-52449172 TTTAAGGAGATGAGTACAGTGGG - Intergenic
957695357 3:83630885-83630907 AATAAGGAGAAGTATACAGTAGG - Intergenic
960171835 3:114471503-114471525 AACAAGGTGGTGGGTCCAGCAGG + Intronic
963727933 3:148942581-148942603 ACTAAGGAGGTGGGTACCAGAGG - Intergenic
965398374 3:168188131-168188153 AATATGGAAGTGGGTAACGTAGG - Intergenic
966880829 3:184349810-184349832 AGTAAGGATTTGGGTTCAGTTGG + Intronic
970390689 4:15608499-15608521 AATAAGGAGATGCTGACAGTAGG - Intronic
971905797 4:32723850-32723872 TATAAGGAGGTGGGCATAGATGG - Intergenic
975118862 4:70706654-70706676 AATAAGGAGGTGTGAACACTGGG - Intronic
975502175 4:75099521-75099543 AATCAGGAAGTGGTTACAGCAGG - Intergenic
975854093 4:78604437-78604459 AGTAAGGAGATGGGTAGAGAAGG - Intronic
976073715 4:81272807-81272829 GATAAGGATATGGGTGCAGTAGG - Intergenic
978318394 4:107465540-107465562 TATTAGGAGGTGGGTGCAATGGG + Intergenic
979307466 4:119163619-119163641 AAAAAGGGGATGGGTACATTGGG + Intronic
979861243 4:125696342-125696364 AAATAGTAGGTGGGTTCAGTGGG - Intergenic
982403543 4:154995549-154995571 ATCAAGGAGGTGAGTACAGCTGG - Intergenic
983954605 4:173682448-173682470 GAGAAGCAGGAGGGTACAGTGGG - Intergenic
988711937 5:33787716-33787738 ATTGAGGAGGTGGGGGCAGTGGG - Intronic
990368676 5:55095015-55095037 AGGAATGAGGTGGGTACAGGAGG + Intergenic
991015827 5:61931342-61931364 AAAAAGGAGGGGGACACAGTAGG - Intergenic
992166156 5:74054049-74054071 AGCAAGGAGCTGGGAACAGTGGG - Intergenic
994099387 5:95877355-95877377 TGACAGGAGGTGGGTACAGTGGG + Intergenic
995360851 5:111295236-111295258 AAGAAGGAGATGGTTACAGTAGG + Intronic
996166324 5:120228518-120228540 TAACAGGAGGTGGTTACAGTGGG - Intergenic
999994919 5:157083218-157083240 AATATGGGGCTGGGCACAGTGGG + Intergenic
1004898726 6:20174019-20174041 AAAAAGGATGTGGTAACAGTTGG + Intronic
1005749314 6:28868350-28868372 AATAAGCAGGTGAGTTTAGTAGG + Intergenic
1006513129 6:34532324-34532346 AATCAGGAGGTGGGTATTGGAGG + Intronic
1007622050 6:43221321-43221343 AGTAAGAAGGGGGGTACTGTGGG + Exonic
1007998956 6:46338615-46338637 AATAAGAAGGTGGGATCAGCAGG - Intronic
1008281071 6:49596992-49597014 GCTAAGGATGTGGGTACAGCTGG + Intergenic
1010454201 6:76036058-76036080 AATAAGTAGATGGGAACAGATGG - Intronic
1010731942 6:79400360-79400382 GATAAACAGGTGGGTGCAGTTGG - Intergenic
1010879184 6:81147320-81147342 AAAAAGGAGGTGGAGCCAGTGGG - Intergenic
1013219587 6:108066361-108066383 AATAAGGAAGTTGGAACATTTGG - Intronic
1015503379 6:133955503-133955525 AATAAAGAGGAGGGTACAGAAGG - Intronic
1017000383 6:149992410-149992432 AAGGAGGAGGTGGGTGCAGAAGG + Intergenic
1020023974 7:4885504-4885526 AAGAAGGATGTGGGGACTGTGGG - Intergenic
1021327583 7:19293459-19293481 AAAAAGGAGTTGGGTAAAGATGG + Intergenic
1021852801 7:24824991-24825013 AATGAGGAGGTGGGGTAAGTAGG + Intronic
1022204409 7:28149572-28149594 AATAGGGAGGTGCATCCAGTTGG + Intronic
1022385460 7:29894725-29894747 AACAAGCAGGTGGGGACAGAGGG - Intronic
1023271479 7:38467906-38467928 AAATAGAAGGTGGGTACAGATGG + Intronic
1024912794 7:54465248-54465270 GATAAGGAGGTGGGAACATGAGG - Intergenic
1027598438 7:80207078-80207100 AATAAGTAGTTGGGTAAACTTGG + Intronic
1027598907 7:80213634-80213656 TATAAGGTGGTGGGTGCAGGGGG - Intronic
1028441476 7:90867614-90867636 AATAAGGAGGAGGGGAAAATAGG + Intronic
1028854493 7:95575596-95575618 AATAAGGATGTGGTGACAATTGG - Intergenic
1033091037 7:138386204-138386226 AATAAGTAATTGGGAACAGTAGG - Intergenic
1033108675 7:138555766-138555788 AATTAGGGGCTGGGCACAGTGGG - Intronic
1034674639 7:152883779-152883801 CATGAGGAGCTGGGTTCAGTAGG - Intergenic
1035687554 8:1536770-1536792 AATAAAGAGGTGGGAAAACTTGG - Intronic
1041606980 8:59793129-59793151 AGGAAGGAGGTGGGAAGAGTGGG + Intergenic
1042120614 8:65484052-65484074 AGGAAGGAGGTGGGTTCAGTTGG + Intergenic
1043531614 8:81157320-81157342 AATAAGGGCTTGGGTACAGGTGG - Intergenic
1046913272 8:119652276-119652298 TATAAGGAGGTGGGGACTTTGGG - Intronic
1052200559 9:25773776-25773798 CATAAGGAGGTGGGAAGAGGTGG + Intergenic
1052647321 9:31253735-31253757 TATAAGGAGGTGGGAACCTTTGG + Intergenic
1053271226 9:36750789-36750811 AATAAGCACGTTGGGACAGTGGG + Intergenic
1055498806 9:76882878-76882900 AATGAGTAGTTTGGTACAGTGGG + Intronic
1058968087 9:110055573-110055595 AATGAGGAGGTGGGTCCTCTGGG - Intronic
1059760637 9:117334156-117334178 AATCAGTAGGGGGCTACAGTTGG + Intronic
1060656612 9:125376540-125376562 AATCAGGAGGTGGAGACTGTCGG - Intergenic
1186576678 X:10774168-10774190 AAGAAGGAGGTGGACAGAGTTGG + Intronic
1186749858 X:12610214-12610236 AAGGAGGAAGTGGTTACAGTAGG + Intronic
1188764823 X:34079119-34079141 AAAAATGATGTGGGGACAGTTGG - Intergenic
1190430905 X:50377008-50377030 AATGGGTATGTGGGTACAGTGGG + Intronic
1194790686 X:98145761-98145783 AATAATGAGGAGGGGAAAGTGGG - Intergenic
1195063977 X:101222496-101222518 AAGCAGCAGTTGGGTACAGTGGG - Intronic
1196364243 X:114905791-114905813 AATGAGGAGGTGGGAGCAGAAGG - Intronic
1198697137 X:139354427-139354449 AATAAGGTAGTGGTTACAGTGGG - Intergenic
1199247771 X:145626152-145626174 AGAAAGGAAGTGGTTACAGTAGG + Intergenic
1201068471 Y:10122329-10122351 AATATGCAAGTTGGTACAGTTGG - Intergenic
1201427350 Y:13867036-13867058 AACAAGGAGGGGAGTAAAGTTGG + Intergenic