ID: 1169744444

View in Genome Browser
Species Human (GRCh38)
Location 20:8929054-8929076
Sequence GGCTGGCAGTAGGGGAGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 277}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169744434_1169744444 12 Left 1169744434 20:8929019-8929041 CCACCATGCCAGGCCCTGCTAAT 0: 1
1: 1
2: 17
3: 246
4: 1523
Right 1169744444 20:8929054-8929076 GGCTGGCAGTAGGGGAGTAATGG 0: 1
1: 1
2: 0
3: 23
4: 277
1169744437_1169744444 -1 Left 1169744437 20:8929032-8929054 CCCTGCTAATTCTTTTTATATAG 0: 1
1: 0
2: 5
3: 151
4: 2301
Right 1169744444 20:8929054-8929076 GGCTGGCAGTAGGGGAGTAATGG 0: 1
1: 1
2: 0
3: 23
4: 277
1169744436_1169744444 4 Left 1169744436 20:8929027-8929049 CCAGGCCCTGCTAATTCTTTTTA 0: 1
1: 3
2: 109
3: 3603
4: 60097
Right 1169744444 20:8929054-8929076 GGCTGGCAGTAGGGGAGTAATGG 0: 1
1: 1
2: 0
3: 23
4: 277
1169744435_1169744444 9 Left 1169744435 20:8929022-8929044 CCATGCCAGGCCCTGCTAATTCT 0: 1
1: 0
2: 8
3: 87
4: 899
Right 1169744444 20:8929054-8929076 GGCTGGCAGTAGGGGAGTAATGG 0: 1
1: 1
2: 0
3: 23
4: 277
1169744438_1169744444 -2 Left 1169744438 20:8929033-8929055 CCTGCTAATTCTTTTTATATAGG 0: 1
1: 0
2: 4
3: 97
4: 1714
Right 1169744444 20:8929054-8929076 GGCTGGCAGTAGGGGAGTAATGG 0: 1
1: 1
2: 0
3: 23
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169744444 Original CRISPR GGCTGGCAGTAGGGGAGTAA TGG Intronic
901569015 1:10143979-10144001 TGCTGGCAGGAGGGGAGTCTAGG + Intronic
903572751 1:24318570-24318592 GGCAGGGGGTGGGGGAGTAAAGG - Intergenic
903683562 1:25114021-25114043 TGCTGGCAGCAGGGGACCAATGG + Intergenic
904695690 1:32329749-32329771 GGCTGGCAGGAGGGTAGCCAGGG + Intronic
905727953 1:40270665-40270687 AGGTGGCAGTTGGGGAGAAAAGG - Intronic
905892483 1:41526063-41526085 GGCTGGGAGGAGGTGAGCAAGGG + Intronic
906102820 1:43274025-43274047 GGCTTGGGGTAGGGGAGGAAGGG - Intergenic
907160125 1:52363598-52363620 GGCTGGAAGGAGGGGAGGAAGGG - Intronic
907388114 1:54138929-54138951 GGGTGGGAGGAGGGGAGCAATGG + Intronic
907950109 1:59174863-59174885 GGCTGGGAGGAGGGGAGGATGGG - Intergenic
907954143 1:59212511-59212533 GGCTGGCACATGGGGAGTGAGGG + Intergenic
910301073 1:85708182-85708204 GCCTGGCAGGGAGGGAGTAAGGG - Exonic
912991558 1:114492538-114492560 GGATGGGAGTGGGGGAGGAATGG - Intronic
914922616 1:151857807-151857829 GGCTGGCTGGAGGAGAGTGAAGG + Intergenic
916024243 1:160820299-160820321 GCATGGGAGTGGGGGAGTAAAGG - Intronic
916793049 1:168140918-168140940 GTCTGTCAGTAGGGGATTAGAGG + Intergenic
916926923 1:169531585-169531607 GCCTGTGAGCAGGGGAGTAAAGG + Intronic
916951318 1:169783243-169783265 GGCAGGCAATGGGGGACTAAAGG - Intronic
921169383 1:212533032-212533054 GCCTGGCTGTAGGGGCCTAAGGG - Intergenic
923101577 1:230821745-230821767 GGCGGACAGTAGGAGAGTCAGGG + Intergenic
923319843 1:232820334-232820356 GGCTGGCAGGAAGGGAGCCAGGG - Intergenic
923616917 1:235545765-235545787 GGCTGGAAGCTGGGGAGTAGAGG + Intergenic
924628012 1:245711681-245711703 GCCGGGGAGTAGGGGAGTGAGGG - Intergenic
1063142014 10:3263996-3264018 CGCTGGCAGGTGGGGAGTTAGGG - Intergenic
1064345942 10:14532992-14533014 GGCTGGCTGCAGGGGAGGGAGGG + Intronic
1067144230 10:43682141-43682163 GGCTGGTACTAGGGAAGTAATGG + Intergenic
1067522491 10:47018619-47018641 GGCTGGCGGTGGGGAAGAAATGG + Intergenic
1068756387 10:60658950-60658972 GGCAGGCAGGAGGAGAGGAAGGG + Intronic
1069060603 10:63890687-63890709 GGCTGGCATTTTGGGAGAAATGG - Intergenic
1069807761 10:71136623-71136645 TGCTGGGAGTAGGGGAGAGAGGG - Intergenic
1070528155 10:77312674-77312696 GGCTGGATTTAGGGGAGAAAAGG + Intronic
1070734441 10:78853703-78853725 AGCTGGCTGTAGGGGAATCAAGG - Intergenic
1070890636 10:79940387-79940409 GGCTGGCAGTAGCATAGTTAAGG - Intronic
1070946025 10:80392484-80392506 GGCTGGGAGGAGGGGATAAATGG - Intergenic
1072898368 10:99386967-99386989 GGCTGGCACTGGGGGAAGAAGGG - Intronic
1073311536 10:102546320-102546342 GGCTGGCAGAGTGGGGGTAAGGG - Intronic
1073581413 10:104669397-104669419 GGCTGGAAGTAGGGTAGAATGGG - Intronic
1074094460 10:110297744-110297766 GGCTGTAAGCAGGTGAGTAAAGG + Intronic
1074922897 10:118035485-118035507 GGCTGGAAGTAGGAGGCTAACGG + Intronic
1075559282 10:123456721-123456743 GGCTGGGAGAAGGGGTGAAAAGG + Intergenic
1077419123 11:2441392-2441414 GGCTGAGGGTGGGGGAGTAAGGG - Intergenic
1077724104 11:4656816-4656838 GGCTTGGACTAGGGGAGTAGTGG - Intergenic
1078148948 11:8742430-8742452 GGCTGTCAGTAGGGGCATAAAGG + Intronic
1078421496 11:11216508-11216530 GGCTGGCACTAGGGGAGCGGGGG + Intergenic
1078827811 11:14947966-14947988 GGATGGGAGTAGGGGACTTAGGG - Intronic
1078864312 11:15282350-15282372 GGGTGGCAGGAGGTGAGGAATGG + Intergenic
1079486709 11:20942463-20942485 GGTTGGGAGTAGGGGAGTAGGGG + Intronic
1084741064 11:71139938-71139960 GGGTGGCATTGGGGGAGAAAAGG + Intronic
1085042299 11:73333701-73333723 GGGTGGGAGTAGGGGAGGTAGGG + Intronic
1085451856 11:76638965-76638987 GGCAAGGAGTAGGGGAGGAAGGG - Intergenic
1085775109 11:79358605-79358627 GGCAGGCAGGAAGGGAGGAAGGG - Intronic
1086222691 11:84468548-84468570 TTCTGGCTGCAGGGGAGTAAGGG - Intronic
1086720833 11:90119043-90119065 GGTTGGGAGAAGGGGAGGAAGGG + Intergenic
1086864911 11:91969279-91969301 GCCTGGCAGTAATGGAGGAAGGG + Intergenic
1087589445 11:100167759-100167781 AGATGGCAGTAGTGGAGTGAAGG + Intronic
1088287146 11:108200894-108200916 TACTGGCAGTTGGGGTGTAATGG - Intronic
1088939213 11:114436662-114436684 GGATGGGGGTGGGGGAGTAATGG + Intronic
1089246578 11:117125205-117125227 AGCTGACAGCAGTGGAGTAATGG + Intergenic
1089620042 11:119717020-119717042 GGCTAGCAGTAATGGAGTGATGG + Intronic
1089921527 11:122213579-122213601 GGCTGGCACTATGGGAGTGGGGG - Intergenic
1090543060 11:127729962-127729984 GGCTGGGAGTAGAGGTGGAAAGG + Intergenic
1091767138 12:3128921-3128943 GGCTGGAAGTAGGGGGAGAATGG - Intronic
1092167496 12:6351703-6351725 GGCTGGCAGTGGTGGAGGAGGGG + Intronic
1092240227 12:6831565-6831587 GGCAGGCAGGAGTGAAGTAAAGG - Intronic
1095166067 12:38973608-38973630 AGATGGCAGTTGGGGAGTAGGGG - Intergenic
1096763288 12:53861643-53861665 GACTGGCAGTAAGGGAGTGAAGG - Intergenic
1096783064 12:54001774-54001796 GGCTGGCAGGAGGGGGGCACTGG + Intronic
1096913207 12:55004870-55004892 GGGTTGCAGGAGGTGAGTAAGGG + Intergenic
1099215003 12:79842949-79842971 GGCTGGAAGGAGGGGAGAAAAGG - Intronic
1101708656 12:107244451-107244473 AGCTGGAAGTAGGAGAGTGATGG + Intergenic
1103032717 12:117630330-117630352 GAATGCCAGTAGGGGAGGAAAGG + Intronic
1103446612 12:120999247-120999269 GGCTGGCCGCAGGGGAGAGAGGG - Exonic
1103988932 12:124785359-124785381 GGGTGGCTGGAGGGGAGTGAGGG - Intronic
1105455472 13:20536816-20536838 AGGTGGAAGTAGGGGAGGAAAGG - Intergenic
1105462939 13:20608567-20608589 GGCTGGCAGTGGGGGTGTCCAGG + Intronic
1105616740 13:22025613-22025635 GGCTGACAGAAGGGGAACAAGGG + Intergenic
1106163733 13:27223477-27223499 GGCTGGCAGGAGGGGAGTAATGG + Intergenic
1107738809 13:43427196-43427218 GGCTGGCAGATAAGGAGTAACGG - Intronic
1108105395 13:47003230-47003252 GGAAGGCAGTAGGGAAGTGAGGG - Intergenic
1109177722 13:59176699-59176721 GGGAGGGAGTAGGGGAGTAAGGG - Intergenic
1109248042 13:59982060-59982082 GGTGGGCAATAGGGGAGAAAAGG - Intronic
1110965447 13:81689338-81689360 GGCTGGCAGAACTGGAATAATGG - Intergenic
1113338523 13:109399849-109399871 GACTGGAGGTAGGGGAGTGAGGG + Intergenic
1115169036 14:30481903-30481925 GGTTGGCAGGAGGTGAGAAAGGG + Intergenic
1116354334 14:43909181-43909203 GTCAGGGAGTGGGGGAGTAAGGG - Intergenic
1116656006 14:47654693-47654715 GGCTGCCAGTAGGAGAGTTGGGG - Intronic
1117096996 14:52309280-52309302 AGCTATCAGTAGGGGAGTGATGG + Intergenic
1118045690 14:61968440-61968462 GGCTGACAGTATAGGAGTGAAGG + Intergenic
1118544069 14:66865111-66865133 GGATGGTAGTGGGGAAGTAAGGG + Intronic
1119646155 14:76350063-76350085 GGGTGGCAGCAAGGGAGTAGAGG - Intronic
1120964930 14:90158679-90158701 GGCAGGCAGGAAGGGAGGAAGGG - Intronic
1121149653 14:91620475-91620497 GGGAGGGAGTAGGGGAGAAAGGG - Intronic
1121249653 14:92490023-92490045 GGCTGGGAGGAGGAGTGTAAGGG + Intronic
1122113026 14:99514844-99514866 GGGTGGCAGCCGGGGAGTAGAGG + Exonic
1122454125 14:101836331-101836353 GGCTGGCAGGTCGGGAGTAGAGG - Intronic
1124848158 15:33311302-33311324 GGGTGGCGGTAGGGGAACAAGGG - Intronic
1124949142 15:34300456-34300478 GGCTAGGGGTAGGGGAGTAGGGG - Intronic
1125456687 15:39867475-39867497 GGCTGGCAGGAGGGGAGGTGAGG + Intronic
1128751996 15:70156422-70156444 GGCTGTCAGTAGGGAAGGAAAGG - Intergenic
1129962617 15:79701299-79701321 GGCTGGCAGTTGGGGAGATATGG + Intergenic
1130649776 15:85756010-85756032 GGCTTGCAGTAGGGGAGCAGTGG - Intergenic
1132847326 16:2006595-2006617 GGCTGGGAGTAGGGGACGTAGGG + Intronic
1132862697 16:2079442-2079464 GGCTGGCAGGCGCGGAGGAAAGG - Intronic
1133520291 16:6549549-6549571 GGATGGGAGGAGGGGAGGAAGGG + Intronic
1134240762 16:12504400-12504422 GGCTGGGGGTTGGGGAGAAATGG - Intronic
1136078031 16:27830305-27830327 GGCTGGCAGCAGGGGAGGCCTGG - Intronic
1136425360 16:30166514-30166536 GCCTGCCAGTAGAGGAGAAAAGG + Intergenic
1137624469 16:49899116-49899138 GGCTGGCAGTGGGCGTGTGATGG - Intergenic
1139592272 16:67939927-67939949 GGCTGGCAGTCGGGGATGCAGGG + Exonic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1141030648 16:80584969-80584991 GACTGGCAGTTAGGTAGTAATGG - Intergenic
1141092430 16:81139444-81139466 TGCTGGCAGTAGGGAAGGGATGG + Intergenic
1141340429 16:83199047-83199069 GGCTGGGAGGAGGGGTGTTATGG + Intronic
1141665404 16:85462990-85463012 GGCGAGCAGTAGGGGCGTCACGG - Intergenic
1142810889 17:2395072-2395094 GTCCGGCAGTAGGGGAGCAGGGG + Exonic
1143728358 17:8865645-8865667 AGCTGGCAGTGAGGGACTAAGGG + Intronic
1143998224 17:11027624-11027646 GGCAGGCAGTTGGGAAGGAAAGG + Intergenic
1146593117 17:34145936-34145958 GGCTGGTAGAAGGGTAGGAAAGG + Intronic
1146599916 17:34205351-34205373 GGCATGCAGTAGAGGAGAAAGGG - Intergenic
1146638134 17:34520999-34521021 TGCTGGCAGGAGGGGAGTGGTGG - Intergenic
1147326354 17:39671568-39671590 GGCTGGCAGCAGGGGAATGGAGG + Exonic
1147439085 17:40436514-40436536 GGCATGCAGCTGGGGAGTAAGGG + Intergenic
1147562830 17:41519563-41519585 GGATGGCAGGAGGGGAGTAGAGG - Exonic
1147986965 17:44312368-44312390 GGGTGGCAGATGGGGAGGAAGGG - Intronic
1148079206 17:44958367-44958389 GGATGGCAGTGGTGGAGTAAGGG + Intergenic
1148618478 17:49016923-49016945 GGATGGCAGTAGCTGAGAAAGGG - Intronic
1148864714 17:50622517-50622539 GGCTGGCAGTAGTGGAGCCTGGG + Intronic
1149058230 17:52390198-52390220 GGCTGGCCATAGGGGCCTAAAGG + Intergenic
1149278293 17:55070728-55070750 GACTTGCTATAGGGGAGTAATGG - Intronic
1150219250 17:63486882-63486904 GGCTGGCAGGTGGGGAGCCAGGG - Intronic
1150270682 17:63862536-63862558 GCCTGGCAGCAGGGCAGCAAAGG - Intergenic
1150274309 17:63886057-63886079 GCCTGGCAGCAGGGCAGCAAAGG - Intergenic
1150276452 17:63900885-63900907 GCCTGGCAGCAGGGCAGCAAAGG - Intergenic
1151110778 17:71675365-71675387 GGCTGGCACAAGGATAGTAAAGG - Intergenic
1151880182 17:76889994-76890016 GGCCAACAGTAGGGGAGTGAAGG - Intronic
1155215493 18:23639897-23639919 GGCTGGGGGAAGGGGAGTATGGG + Intronic
1156111805 18:33736492-33736514 GGCTGGTGGTGGGGGAATAAAGG - Intronic
1158143672 18:54285919-54285941 GGATGGCAGTAGTGCAGTTAGGG + Intronic
1158811498 18:61042607-61042629 GGCTGGGAGTAGGGGAAAATGGG - Intergenic
1158891484 18:61876048-61876070 GACTGGTAGTATGGGAGTATGGG - Intronic
1160046311 18:75390368-75390390 GGCTGGCAGTCATGGAGTACAGG + Intergenic
1160089290 18:75811109-75811131 GGCTGGGAGTAGGGAAGAAAAGG + Intergenic
1160233323 18:77065808-77065830 GGATTGCAGGAGGGGAGGAAGGG + Intronic
1161078906 19:2300727-2300749 GGCTGGAAGGAGGGGAGTTCGGG - Intronic
1161171316 19:2813730-2813752 GGCGGGGGGTGGGGGAGTAAAGG + Exonic
1161575539 19:5052531-5052553 GGCGGGCAGCAGAGGGGTAAGGG - Intronic
1162030205 19:7914055-7914077 GGCTGGATGCAGGGGAGGAAAGG - Exonic
1162262388 19:9543508-9543530 GGCTGGGATTAAGGGTGTAAAGG - Intergenic
1163709489 19:18837928-18837950 GTCTGGCAGGAGGAGAGTGAGGG - Intronic
1168713816 19:58515977-58515999 GGCTGGCAGCAAGGGAGGATGGG - Intronic
925508272 2:4594733-4594755 GGCTGGCAGGAGGTGAGCCAGGG + Intergenic
925904403 2:8530911-8530933 GGCTGGGAGTAGGCAAGGAAGGG + Intergenic
926683044 2:15678411-15678433 TGCTGGCAGAAAGGGAGTCAGGG - Intergenic
927153510 2:20209043-20209065 GACAGGGAGTAAGGGAGTAAGGG + Intronic
928096530 2:28408377-28408399 GGCTGGCAGGAGGGGACTCTTGG + Intronic
929870910 2:45758623-45758645 GTTAGGCAGTAGGGGAGGAAGGG - Intronic
930621031 2:53643807-53643829 GCCTGGTAGGAGGGGAGTAAGGG + Intronic
932591684 2:73071365-73071387 CGCGGGCAGTCGGGGAGTGACGG + Intronic
936503091 2:113081987-113082009 GGGTGGGAGTAGTGGAGAAAGGG + Intergenic
936881914 2:117263247-117263269 GGATGGCAGTAAGAGAGAAAAGG - Intergenic
937292597 2:120790574-120790596 GGCTGGAAGAGGGGGAGTCAGGG + Intronic
938157286 2:128952273-128952295 GGCTTGAAGGAGGGGAGGAATGG - Intergenic
938263255 2:129909934-129909956 GACTGGCAGGAGGGCAGTCAGGG - Intergenic
940112741 2:150171719-150171741 GGGTGGCAGTGGGGGAAGAAAGG - Intergenic
942536302 2:176968213-176968235 GGCTGGCAGAAAGTGAGCAAAGG + Intergenic
942883346 2:180891492-180891514 GGAAGGCAGGAGGGGAGTGAGGG - Intergenic
946248075 2:218398499-218398521 GGCTGGGAGTAGGGGCGGGAGGG - Intronic
946302548 2:218832666-218832688 GGCTGGAAGGAGGAGAGAAAGGG - Intergenic
946391758 2:219420424-219420446 GGCTGGGAATAGGGGTGTGAGGG + Intronic
947527404 2:230886954-230886976 GGCTGGCAGCAGTGAGGTAATGG + Intergenic
947668490 2:231922395-231922417 TGCTGGGAGAAGGGGAGGAAAGG - Intronic
948454248 2:238097389-238097411 TGCTGGCAGCAGGGGAGAAGTGG + Intronic
948916664 2:241037768-241037790 GGCTGGCTGTGGGGCAGGAAGGG + Intronic
949026978 2:241770865-241770887 GGCTGGCAGCAGGGCTGTCATGG - Intergenic
1169744444 20:8929054-8929076 GGCTGGCAGTAGGGGAGTAATGG + Intronic
1170338619 20:15298465-15298487 GGCTGGCATAAGAAGAGTAAGGG + Intronic
1171437339 20:25133669-25133691 GGTTTTCAGTAGGGGAATAAAGG - Intergenic
1172072931 20:32271990-32272012 GGGTGGCAGCAGGGGAGTGTGGG - Intergenic
1173641935 20:44609494-44609516 GGCGGGCAGCAGGGGAGAAGAGG + Intronic
1178531366 21:33379042-33379064 GGCTGGCAGGAGGGGAGACGGGG - Intergenic
1178531623 21:33381047-33381069 GGCTGGCAGGAGGGGAGACGAGG - Intergenic
1178628092 21:34235039-34235061 GGCTGGGAGGAGGGGAGAATGGG + Intergenic
1179837567 21:44047017-44047039 GGCTGGCAGTAAGGTGGGAAAGG - Intronic
1180251711 21:46594555-46594577 AGCTGGCATCAGGGGAGTAAAGG - Intergenic
1182004882 22:26951601-26951623 GGCTGGTACTAGGGCAGTGATGG + Intergenic
1183473810 22:38024766-38024788 GGCTGGCAGTGGGAGAGGACTGG + Intronic
1184820526 22:46906179-46906201 GGGTAGCAGTAGGGAAGAAAAGG - Intronic
949714077 3:6907971-6907993 GGCTAATAGTAAGGGAGTAAGGG - Intronic
949838976 3:8300015-8300037 GGCTGGGAGGAGGGGGGTCAGGG - Intergenic
949869833 3:8579163-8579185 TTCTGGGAGTGGGGGAGTAAGGG + Intergenic
949999342 3:9644742-9644764 GGCTGGGGGTAGGGGTGGAAAGG + Intergenic
950416009 3:12869339-12869361 AGCAGGCAGTAGGGCAGTGAGGG + Intronic
950663429 3:14480999-14481021 GGGTGGCAGTGGGGGAAGAAAGG + Intronic
950673929 3:14543450-14543472 GGCTGACAGTAGGTGAGAGAAGG + Intergenic
951032360 3:17896247-17896269 GCCTGGCAGCAGAGGAGTAGTGG - Intronic
951646368 3:24896198-24896220 GGCTGGAGGAAGGGGAGAAAGGG + Intergenic
956710232 3:72032645-72032667 AGCTGGCAGGATGGGAGGAAGGG + Intergenic
959067053 3:101668204-101668226 GGGTGACAGGAGGGGAGTATAGG + Intronic
959857086 3:111172222-111172244 AGCTGGAAGTAGGGGAGTGATGG - Intronic
960483496 3:118222731-118222753 GGCTGGAAGAAGGGGAGCTAAGG + Intergenic
961197860 3:125018359-125018381 GGCTGGGAGGAGGGGAGAATGGG + Intronic
961902204 3:130224060-130224082 GGATGGCAGTGTGGGAGGAAAGG - Intergenic
962260278 3:133897661-133897683 GTATGGCAGTAGGGGAGGGAGGG + Intergenic
962321809 3:134396717-134396739 GGCTGGCAGGAGGGCAGCAGGGG - Intergenic
962584158 3:136824902-136824924 GGCTGGTAGGTGGGGAGTCAGGG - Intronic
962849853 3:139300235-139300257 GTCTGGCAGTATAGGAGTTAGGG - Intronic
963699588 3:148607759-148607781 GGCTGGAAGTAGTGGTGGAATGG - Intergenic
963758936 3:149265793-149265815 GGGTGGTGGTGGGGGAGTAATGG + Intergenic
964636728 3:158865948-158865970 GGCAGGAAGGAGGGGAGTTAGGG + Intergenic
966958699 3:184911276-184911298 GGCTCACAGTAGTGGAATAATGG + Intronic
967214463 3:187198860-187198882 GGCTGACAGGAGGGGTGTCAAGG + Intronic
967793429 3:193573044-193573066 GGTTGGGGGGAGGGGAGTAAGGG + Intronic
970315418 4:14824506-14824528 GGAGGGCAGTAGGAGAGTTAAGG + Intergenic
970767086 4:19562710-19562732 CACTGGCAGCAAGGGAGTAAGGG + Intergenic
973806204 4:54528204-54528226 GGCTGACAGGAAGGGAGGAACGG - Intergenic
977964348 4:103126232-103126254 GTCTGGCAGGAGAGGAGAAAAGG + Intronic
978829297 4:113064519-113064541 GGCTGGCAGGTGGGGAGGGAAGG - Intronic
979317509 4:119281968-119281990 GGCTGGGAGGAGGGGAGAATGGG - Intronic
981128033 4:141129449-141129471 GGCTGGGAGTTGGGGAATAATGG + Intronic
982854933 4:160369709-160369731 AGATGGGAGTAGGGGAGCAAGGG + Intergenic
986374144 5:7113326-7113348 GGCTGGCAGGAGGGGAAAATGGG - Intergenic
986626581 5:9728640-9728662 GCTGGGAAGTAGGGGAGTAAGGG + Intergenic
989131725 5:38113692-38113714 GTGTGGGAGTAGGGTAGTAAAGG + Intergenic
989710444 5:44390052-44390074 AGCTGGCAGCAGAGGAGGAAAGG - Intergenic
990032246 5:51275857-51275879 GACTGGCAGAAGGGAAGGAAAGG + Intergenic
990298995 5:54431993-54432015 GGCTGCCAGTGTGGGATTAAAGG + Intergenic
992560030 5:77942363-77942385 GGCTGGGAGGAGGGGAAAAAGGG + Intergenic
993007226 5:82441648-82441670 GGGTAGGAGTAGGGGAGTAAAGG + Intergenic
994199215 5:96953183-96953205 GGCTGGCAGTAGGGAAAGGAAGG + Intronic
994986545 5:106940871-106940893 GGCCTGGACTAGGGGAGTAATGG - Intergenic
996961568 5:129256004-129256026 GCCTGGGATTAGGGGAGTGATGG + Intergenic
997521028 5:134524871-134524893 TGCTGGCAGGAGGGGAGTGGAGG - Intronic
999308795 5:150538188-150538210 GGATGGCTGGAGGGGAGTGAGGG + Intronic
1001591802 5:172870756-172870778 GGCAGGCAGGCGGGGAGGAAGGG - Intronic
1002640960 5:180630453-180630475 GGCTGGCAGGAGGAGAGAACGGG - Intronic
1005701193 6:28402029-28402051 GGCTGGCAGTAGGGGGCAAAGGG - Intergenic
1006075584 6:31530070-31530092 GGCAGGCAGTGGGGGAGCCAGGG + Exonic
1006382962 6:33711509-33711531 GGCTGGGACGAGGGGAGGAAAGG - Intronic
1007342763 6:41201998-41202020 GGCTGGAGGCAGGGGAGGAAGGG - Intergenic
1007347470 6:41243039-41243061 GGCTGGAGGCAGGGGAGGAAGGG + Intergenic
1007425444 6:41743384-41743406 GACTGGCTGCAGGGGAGTCAGGG + Exonic
1007515062 6:42404476-42404498 GGGTGGGGGTAGGGGAGAAAAGG - Intronic
1012140743 6:95623964-95623986 GGCTGGCTGGAGGGCAGTAGTGG + Intergenic
1012527108 6:100191192-100191214 TGCTGGCAATGGGGGAGTGACGG - Intergenic
1015820826 6:137258695-137258717 GGCTGGCAGTGGGGTGGGAAAGG + Intergenic
1018029842 6:159833138-159833160 GGCTGGCAGTAAGGGAAGGAAGG + Intergenic
1018182700 6:161238058-161238080 GGCTGGGGGTGGGGGGGTAATGG + Intronic
1018488581 6:164268697-164268719 GGGTGGGAGTAGGGGTGGAATGG + Intergenic
1020496795 7:8863620-8863642 AGCTGGCATTAGGAGAGTCATGG + Intergenic
1021627826 7:22611969-22611991 GGCTGGGAGTGGGGGTGTCAGGG - Intronic
1022503226 7:30895441-30895463 GGCAGGAAGCAGGGGAGTCAGGG - Intergenic
1023718937 7:43073153-43073175 TGCTGGCAGCAGGGGAGATAGGG - Intergenic
1028090361 7:86693063-86693085 GTCTGGCAATAGGTAAGTAATGG + Intronic
1029750428 7:102539820-102539842 GGGTGGTAGTAGGGGAGGCAGGG - Intronic
1029768380 7:102638928-102638950 GGGTGGTAGTAGGGGAGGCAGGG - Intronic
1030853668 7:114523410-114523432 GGCTGGAACCAGGGGAGGAAAGG - Intronic
1032486436 7:132291109-132291131 GGCTGCCAGGAGGGGAGAAGGGG - Intronic
1032593684 7:133217578-133217600 GGCAGGAAGTAGGGGAGTGACGG - Intergenic
1033893884 7:146047623-146047645 TGTTGGCAGTAGGTGAGTATTGG + Intergenic
1034046494 7:147934050-147934072 GGCTGGCAAGAGGGGAATACGGG + Intronic
1038582394 8:28760170-28760192 GGCTGGAAGTAGTGGGGGAATGG - Intergenic
1038980969 8:32759398-32759420 GGGTGACAGTAGTGGAGTGATGG - Exonic
1039775473 8:40732054-40732076 GGCTGGGAGGAGGGGAATCAGGG + Intronic
1039969487 8:42308994-42309016 GGCTGCCAGTTGGGGAGGAAGGG - Exonic
1041822909 8:62060174-62060196 GGCTGACAGGAAGGGAGAAATGG + Intergenic
1044933818 8:97275382-97275404 GGAAGGCAGAAGGGGAGGAAAGG + Exonic
1045297123 8:100881837-100881859 GGCTGTCAGTAGGGGAAATATGG + Intergenic
1046099689 8:109600339-109600361 GGCTGGAAGTAGGAGTGGAAGGG - Intronic
1046609063 8:116404028-116404050 GGAGGGCAGTAGGGGAGCAGTGG + Intergenic
1047353697 8:124100128-124100150 GGCAGGGAGGAGGGGAGTGAAGG - Intronic
1047962428 8:130020391-130020413 GGCTGGGAGGAGGGGAGAATGGG + Intergenic
1048260003 8:132937193-132937215 GGTTGGGAGAAGGGGAGTACAGG + Intronic
1049032620 8:140048840-140048862 AGCTGGGAGTAGGGGAGCAGGGG - Intronic
1051370216 9:16352894-16352916 GGCTGGCAGTGGGAGAGTGTGGG - Intergenic
1051475709 9:17506559-17506581 AGCTGTCAGTAGATGAGTAAGGG - Intergenic
1052211917 9:25914310-25914332 GGCTGGCAGGAGGGAAGAATGGG + Intergenic
1052830435 9:33210929-33210951 GGCTGGCAGCAGAGTAGAAAGGG + Intergenic
1052926297 9:34019504-34019526 GGCTGGGGGTAGGGGAAGAATGG + Intronic
1053152969 9:35754568-35754590 TGGTGGCAGTGGGGGAGAAAGGG - Exonic
1055202621 9:73684894-73684916 GACTGGCAGAAGGGGTGTCATGG + Intergenic
1055687445 9:78791999-78792021 TACTGGCAGTATGGGTGTAATGG - Intergenic
1057291996 9:93812737-93812759 GGCTGGCTGTAGGGGTGGACTGG + Intergenic
1057716892 9:97502275-97502297 GGGTGGGAGTGGGGGAGTAAAGG + Intronic
1059746502 9:117206698-117206720 GGCTGGAAGTAGGGTAGTGGGGG - Intronic
1059758670 9:117317840-117317862 AGCTGGCACTAAGGGAGTCAGGG - Intronic
1060553117 9:124495002-124495024 GGCAGACAGAAGGGGAGAAAAGG + Intronic
1061005952 9:127928515-127928537 GGCAGGCAGCAGGGGACTGAGGG - Intronic
1061236135 9:129343648-129343670 GGCAGGCAGTGGGGGAGCCATGG + Intergenic
1061743891 9:132725964-132725986 GCCTGGAAGCAGGGGAGAAAGGG + Intronic
1062138870 9:134944428-134944450 GGGTGGGAGTAGGGGAGACAGGG + Intergenic
1186379467 X:9042765-9042787 GTTTGGGGGTAGGGGAGTAAGGG - Intronic
1188578924 X:31686858-31686880 TGCTGGGAGTAGGGGAGGTATGG - Intronic
1190732942 X:53236498-53236520 GGGTGGCAGTCGGGGAGACAGGG + Intronic
1192265850 X:69537605-69537627 GGGTGGCTGTAGGAGAGTGAAGG - Intergenic
1192771259 X:74194805-74194827 AGCTGGCAGAAAGGGAATAAAGG - Intergenic
1197660369 X:129164383-129164405 GTCTGGCACTAGGGGAGTTTAGG + Intergenic
1197729387 X:129796996-129797018 GGGTGGGACTAGGGGAGTGAGGG + Intergenic
1198571969 X:137967151-137967173 GGGTGGCAGTCAGGGAGTCAAGG - Intergenic
1198993129 X:142539457-142539479 GGCTGGCAGATGGGGAGAAAGGG - Intergenic
1199676007 X:150189915-150189937 GGATGGCAGTAGGTGAGCACAGG - Intergenic
1200062882 X:153491480-153491502 GGCTGGGAGGAGGGGAGGCAGGG - Intronic
1201358713 Y:13123247-13123269 GGCTGGCAGTTTAGGAGAAATGG + Intergenic