ID: 1169745046

View in Genome Browser
Species Human (GRCh38)
Location 20:8935080-8935102
Sequence AGAAAACGGCCCAGGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169745046_1169745051 7 Left 1169745046 20:8935080-8935102 CCAGCCTTCCTGGGCCGTTTTCT No data
Right 1169745051 20:8935110-8935132 GAGGATTTCTCTCTGAGAACTGG 0: 1
1: 0
2: 3
3: 17
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169745046 Original CRISPR AGAAAACGGCCCAGGAAGGC TGG (reversed) Intronic