ID: 1169745159

View in Genome Browser
Species Human (GRCh38)
Location 20:8935835-8935857
Sequence ACAGTCCTCAGGGTTCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169745159_1169745163 0 Left 1169745159 20:8935835-8935857 CCACTTGGAACCCTGAGGACTGT No data
Right 1169745163 20:8935858-8935880 CTCCTCTCCAACAGAAACAAGGG No data
1169745159_1169745171 30 Left 1169745159 20:8935835-8935857 CCACTTGGAACCCTGAGGACTGT No data
Right 1169745171 20:8935888-8935910 ATCAGGATAGACCATCTGTCGGG No data
1169745159_1169745166 13 Left 1169745159 20:8935835-8935857 CCACTTGGAACCCTGAGGACTGT No data
Right 1169745166 20:8935871-8935893 GAAACAAGGGCCCACCAATCAGG No data
1169745159_1169745162 -1 Left 1169745159 20:8935835-8935857 CCACTTGGAACCCTGAGGACTGT No data
Right 1169745162 20:8935857-8935879 TCTCCTCTCCAACAGAAACAAGG No data
1169745159_1169745170 29 Left 1169745159 20:8935835-8935857 CCACTTGGAACCCTGAGGACTGT No data
Right 1169745170 20:8935887-8935909 AATCAGGATAGACCATCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169745159 Original CRISPR ACAGTCCTCAGGGTTCCAAG TGG (reversed) Intronic