ID: 1169746194

View in Genome Browser
Species Human (GRCh38)
Location 20:8945543-8945565
Sequence ACTAGGAAATTCAACCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169746192_1169746194 -6 Left 1169746192 20:8945526-8945548 CCTACTATGTGCTCTGTACTAGG 0: 1
1: 2
2: 3
3: 50
4: 379
Right 1169746194 20:8945543-8945565 ACTAGGAAATTCAACCCTGAAGG 0: 1
1: 0
2: 2
3: 14
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169746194 Original CRISPR ACTAGGAAATTCAACCCTGA AGG Intronic
903400018 1:23036296-23036318 ACTAGGGAGTTCATTCCTGACGG + Intronic
903511504 1:23878990-23879012 AGAAGGAAATTCAACCCAAAGGG + Intronic
906121849 1:43398556-43398578 ACTAGCTAAGTCAAACCTGAAGG + Intronic
906987755 1:50704310-50704332 GCTAGAAAATTCAACCCCGAAGG + Intronic
912849566 1:113110884-113110906 ACTATGAAATTTATTCCTGATGG + Intronic
917215480 1:172673991-172674013 ACTGGGAAATGCATTCCTGAAGG + Intergenic
918374447 1:183895087-183895109 CCCCAGAAATTCAACCCTGATGG + Intronic
922142399 1:222901870-222901892 AAAAGGAAATTGAACCCAGATGG + Intronic
1068275017 10:54783648-54783670 CCTAGTAGATTCAACCCAGAGGG + Intronic
1068701641 10:60025948-60025970 AGTTGGAAATGCAACCCTCAGGG + Intergenic
1070677099 10:78419611-78419633 AATAGGGAATTCAGCCTTGAGGG - Intergenic
1072048152 10:91677792-91677814 ACTAGAAAAATCAACCCTACTGG + Intergenic
1072865497 10:99056353-99056375 ACTGGTAAATTCAACCTTGAAGG + Intronic
1075283215 10:121159248-121159270 ACAAGGAAAATCATACCTGAAGG + Intergenic
1080426292 11:32157734-32157756 ACTAGGAGATCCACCTCTGAGGG - Intergenic
1085271014 11:75269864-75269886 ACTAACAAAAGCAACCCTGAAGG + Intronic
1086012930 11:82126874-82126896 GCTAGGAAATTCAAGGTTGAGGG - Intergenic
1087319954 11:96645949-96645971 AAAAGGAGATTTAACCCTGAAGG - Intergenic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1092054987 12:5501355-5501377 ACTAAGTAATTCAAGGCTGAGGG + Intronic
1094229625 12:28088000-28088022 ACTAAGCAATTAAACCTTGATGG + Intergenic
1094261689 12:28507924-28507946 CCAAGGTGATTCAACCCTGAAGG - Intronic
1094338031 12:29382682-29382704 ACTGGGAAATCCAACTCTCATGG - Intergenic
1095989304 12:48023364-48023386 AAATGGAATTTCAACCCTGAAGG + Intronic
1097532554 12:60822917-60822939 ACTATGAAATTTTATCCTGAAGG - Intergenic
1101170944 12:102092169-102092191 GCTAGGAAATTCATCGCAGAAGG + Intronic
1102823624 12:115927900-115927922 TCTTGGAAATTCAAGCCTCAGGG - Intergenic
1109763205 13:66858532-66858554 GCTAGGAAATTCTACACAGAGGG - Intronic
1112299404 13:98216539-98216561 CCCAGGAAATTCAACCCCCAGGG - Intronic
1113189319 13:107725840-107725862 ACAAGGAAATTCAACCGTTTTGG + Intronic
1118128120 14:62931995-62932017 ACTAGAAAATTCCTCCCTGAGGG + Intronic
1120643742 14:87046986-87047008 AAGAGGAAATTCAACACTGGAGG + Intergenic
1123189965 14:106559682-106559704 ACACGGATATTCATCCCTGATGG - Intergenic
1124152847 15:27197540-27197562 CCTAAGAACATCAACCCTGAAGG - Intronic
1124400926 15:29346510-29346532 ACTAGGGAAGTCAAGCCTGCTGG + Intronic
1126324452 15:47461511-47461533 ACCATGAAATTTAACTCTGATGG - Intronic
1131162907 15:90120009-90120031 ATTAGGAAATTGAACCCAGGAGG - Intergenic
1133454897 16:5933478-5933500 ACAAGGAGATTCAACCCTGACGG - Intergenic
1134423070 16:14112389-14112411 GGTAGGAAATTCAAAGCTGAGGG + Intronic
1136900578 16:34033612-34033634 ACTAGTAAATTCAAAACAGAAGG - Intergenic
1136940173 16:34516120-34516142 ACTAGTAAATTAAAAACTGAAGG + Intergenic
1136948522 16:34686816-34686838 ACTAGTAAATTAAAAACTGAAGG - Intergenic
1136959645 16:34832446-34832468 ACTAGTAAATTAAAAACTGAAGG - Intergenic
1137798690 16:51242954-51242976 ATTAGGAAATTAAACCATAAAGG - Intergenic
1142418704 16:89957379-89957401 AGAAGGAAACTCAACCCAGAGGG - Intronic
1143511960 17:7401365-7401387 ACAAGGAAGATCAACCCTGAGGG - Intronic
1145030527 17:19501571-19501593 ACTTGAAAACTGAACCCTGAAGG - Intronic
1148247057 17:46039336-46039358 ACTAGAAACTTCAGTCCTGAAGG - Intronic
1149227845 17:54496447-54496469 AAAAGGAAACTAAACCCTGAAGG - Intergenic
1155345135 18:24850173-24850195 ATTAGGAAATTCACATCTGAAGG - Intergenic
1155891970 18:31281253-31281275 TCTAGGAAGTTAAAGCCTGAGGG - Intergenic
1156692878 18:39729494-39729516 ATTAGGAAAATGAACCCTGAAGG - Intergenic
1160091508 18:75831517-75831539 AAAAGGAAATTCAACCTTCAGGG + Intergenic
1160246687 18:77165281-77165303 ACTTGGACACGCAACCCTGAAGG - Intergenic
1164791399 19:30987532-30987554 ACTAGAAATTTCATCCCAGAGGG - Intergenic
927699594 2:25259358-25259380 ACCAGGAAATTCAACTGGGAGGG + Intronic
929408009 2:41665488-41665510 ACTAGGAAATCCAAGACTGAGGG + Intergenic
934668836 2:96194528-96194550 ATTAGTAAATTTAACACTGATGG - Intronic
938924312 2:136025181-136025203 GCTAGGGAACTCAAACCTGAGGG - Intergenic
941371918 2:164676053-164676075 ATTAGGGAATTCAATCCTGTGGG - Intronic
942963118 2:181856392-181856414 GCAAGCAAATTCAACTCTGAGGG + Intergenic
1169746194 20:8945543-8945565 ACTAGGAAATTCAACCCTGAAGG + Intronic
1173789646 20:45819660-45819682 AGAAGGAAATTGAGCCCTGAGGG + Intergenic
1174452046 20:50626386-50626408 TCTAGGAAAGACAGCCCTGATGG - Intronic
1177268815 21:18819672-18819694 CCTGGGAAATTGTACCCTGATGG - Intergenic
1178123241 21:29490832-29490854 ATTAGCCAAATCAACCCTGATGG + Intronic
1178419983 21:32435538-32435560 TCTAGGAAATCCAGCCCTGAAGG - Intronic
1179027678 21:37693444-37693466 ACCAGGAAATCAAACCCTCAAGG + Intronic
956449519 3:69359548-69359570 TCCAGGAAAAACAACCCTGATGG + Intronic
960408024 3:117285757-117285779 GCCTGGAAATTCACCCCTGAAGG - Intergenic
960460228 3:117925191-117925213 ACTAGGATAATGAACCATGAGGG - Intergenic
962811746 3:138964497-138964519 AGAAGGAAATTGAACTCTGAAGG - Intergenic
964444774 3:156747540-156747562 ACAAGGAAATCCAACACTGAGGG - Intergenic
966840425 3:184083125-184083147 ACTGGTAAAGTCAGCCCTGAAGG - Intergenic
974465316 4:62248166-62248188 ACGTGGAAATACAGCCCTGAAGG - Intergenic
975223234 4:71838561-71838583 ACTAAGACATTGAACCCTGTGGG + Intergenic
975836440 4:78427102-78427124 ACAAGGTAATTGAAACCTGAAGG + Intronic
975903567 4:79182362-79182384 ACTAGGAAAATCAATACTAATGG + Intergenic
978201140 4:106024574-106024596 AGTAGGAAATTTTACTCTGATGG - Intergenic
979731915 4:124034190-124034212 ACAAGTAAATGCTACCCTGAAGG - Intergenic
980718983 4:136668162-136668184 AATAGAAAATTCTACCATGATGG + Intergenic
982216189 4:153084582-153084604 ACTCTGAGATTAAACCCTGAGGG - Intergenic
982264762 4:153528024-153528046 ACAAGGAAATTCAGACCAGACGG - Intronic
982536695 4:156615850-156615872 ACTATGAAAGGCAATCCTGATGG - Intergenic
982928659 4:161373052-161373074 ATGAGGAAATTCAAGCCTAATGG - Intergenic
990294414 5:54386061-54386083 AACAGGAAATCCAACCCTGAGGG + Intergenic
991426947 5:66501933-66501955 ACAAGGAAATTGAACCCAGAAGG - Intergenic
995628529 5:114107346-114107368 ACTAGGAAATACAATCTTAAGGG - Intergenic
1002549444 5:179976202-179976224 ACTGGAAAAGTCAACACTGAAGG + Intronic
1004566968 6:16807226-16807248 CCCAGGAAATTCTTCCCTGATGG + Intergenic
1007130424 6:39467112-39467134 ATGAGGAAGTTCAAGCCTGAAGG + Intronic
1007408116 6:41646356-41646378 ACTAGGGAACTCAACCCAAATGG + Intronic
1008256669 6:49310342-49310364 AATAGGAAATTCAACCTGAAAGG + Intergenic
1008707699 6:54182601-54182623 AATAGATAATTCATCCCTGAGGG - Intronic
1011490610 6:87887479-87887501 ACTTGGAAAATCAACCCACATGG - Intergenic
1016571578 6:145519436-145519458 ATTAGCAAAACCAACCCTGAAGG - Intronic
1017115415 6:150971576-150971598 AGAATGAAATTAAACCCTGATGG - Intronic
1017889163 6:158624988-158625010 AGAAGGGACTTCAACCCTGAAGG - Intronic
1024767879 7:52682905-52682927 ACTAGGAAATTTATCTCTAAAGG + Intergenic
1029061053 7:97798234-97798256 ACTTGGACATTGAACCCTGGCGG - Intergenic
1032491004 7:132324289-132324311 ACTAGGAAATGCAAATCTGCTGG - Intronic
1034102612 7:148463770-148463792 ACAAGGACATTCAAACCAGAAGG - Intergenic
1034312801 7:150104260-150104282 ACTATGAGATTGAACCTTGAAGG + Intergenic
1034794057 7:153996405-153996427 ACTATGAGATTGAACCTTGAAGG - Intronic
1035024746 7:155818183-155818205 TCTAGAAAATACAACCCTGAAGG - Intergenic
1037024888 8:14022917-14022939 ACTAGGAAGTTTAAAGCTGATGG - Intergenic
1040944941 8:52874347-52874369 GCCAGGACATTCATCCCTGAGGG - Intergenic
1045971725 8:108085889-108085911 ACTAAAAAATACAACCCTAATGG + Intergenic
1052403935 9:28035124-28035146 TCTAGAAAAATCAACCCTCAGGG + Intronic
1052519293 9:29523993-29524015 ACTAGGAAATGCAACCCTCGTGG + Intergenic
1052913744 9:33907690-33907712 ACTAGCAAAATAGACCCTGAGGG - Intronic
1056487165 9:87071072-87071094 ACAACAAAATTCCACCCTGATGG - Intergenic
1060419549 9:123457945-123457967 AATAGGAATTTCAAAACTGATGG - Intronic
1185803312 X:3033047-3033069 ACTCCTAAATTCTACCCTGAAGG + Exonic
1186264161 X:7813696-7813718 ATTAGGAAATTTCATCCTGATGG - Intergenic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1187599914 X:20817280-20817302 ATCAGGAAATTTAACCCTGATGG - Intergenic
1188098969 X:26058597-26058619 TCTAGGAAATTCAATCCACATGG - Intergenic
1188426364 X:30051946-30051968 GCAATGAAATTGAACCCTGAAGG - Intergenic
1193441597 X:81546273-81546295 ACAAGAAAATGCAACCCTCATGG + Intergenic
1194769486 X:97883884-97883906 AATGGGAAATTCAACCTTGAAGG + Intergenic
1201914986 Y:19172206-19172228 AATAGGAAATCCAAACCTGGAGG + Intergenic