ID: 1169747161

View in Genome Browser
Species Human (GRCh38)
Location 20:8954051-8954073
Sequence CGAATTTCAATATAAGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 917
Summary {0: 1, 1: 0, 2: 9, 3: 120, 4: 787}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169747154_1169747161 7 Left 1169747154 20:8954021-8954043 CCTCCTAACACCATCAACCTGTG 0: 1
1: 1
2: 9
3: 100
4: 615
Right 1169747161 20:8954051-8954073 CGAATTTCAATATAAGAATTTGG 0: 1
1: 0
2: 9
3: 120
4: 787
1169747160_1169747161 -10 Left 1169747160 20:8954038-8954060 CCTGTGGGGTGTTCGAATTTCAA 0: 1
1: 0
2: 0
3: 12
4: 62
Right 1169747161 20:8954051-8954073 CGAATTTCAATATAAGAATTTGG 0: 1
1: 0
2: 9
3: 120
4: 787
1169747153_1169747161 11 Left 1169747153 20:8954017-8954039 CCTGCCTCCTAACACCATCAACC 0: 1
1: 0
2: 15
3: 137
4: 726
Right 1169747161 20:8954051-8954073 CGAATTTCAATATAAGAATTTGG 0: 1
1: 0
2: 9
3: 120
4: 787
1169747152_1169747161 12 Left 1169747152 20:8954016-8954038 CCCTGCCTCCTAACACCATCAAC 0: 1
1: 3
2: 31
3: 176
4: 750
Right 1169747161 20:8954051-8954073 CGAATTTCAATATAAGAATTTGG 0: 1
1: 0
2: 9
3: 120
4: 787
1169747157_1169747161 4 Left 1169747157 20:8954024-8954046 CCTAACACCATCAACCTGTGGGG 0: 1
1: 0
2: 1
3: 29
4: 250
Right 1169747161 20:8954051-8954073 CGAATTTCAATATAAGAATTTGG 0: 1
1: 0
2: 9
3: 120
4: 787
1169747159_1169747161 -3 Left 1169747159 20:8954031-8954053 CCATCAACCTGTGGGGTGTTCGA 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1169747161 20:8954051-8954073 CGAATTTCAATATAAGAATTTGG 0: 1
1: 0
2: 9
3: 120
4: 787

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169747161 Original CRISPR CGAATTTCAATATAAGAATT TGG Intronic
900079354 1:844012-844034 AGGACTTCAACATAAGAATTTGG - Intergenic
900694262 1:4000326-4000348 AGGATTTCAACATATGAATTTGG + Intergenic
901219075 1:7572742-7572764 AGGATTTCAACATAGGAATTTGG + Intronic
901826703 1:11866651-11866673 CAGATTTCAACATACGAATTTGG + Intergenic
902446813 1:16471897-16471919 CTGATTTCAACATATGAATTTGG + Intergenic
902901699 1:19521466-19521488 AGAAATTCATTATAAGAAATTGG + Intergenic
902902642 1:19530222-19530244 AGGATTTCAATGTATGAATTTGG - Intergenic
902913170 1:19616302-19616324 TGAAATTAAATATAAGAATCGGG - Intronic
903001761 1:20271213-20271235 AGGATTTCAACATATGAATTTGG - Intergenic
903072956 1:20736858-20736880 AGGACTTCAACATAAGAATTTGG - Intergenic
906020907 1:42628511-42628533 CAAAATTCAAGATAAGATTTGGG - Intronic
906260459 1:44384317-44384339 TGAATTTCAACATATGAATTTGG + Intergenic
906370130 1:45247004-45247026 TCATTTTCAACATAAGAATTTGG - Intronic
907715494 1:56922500-56922522 AGGATTTCAACATAGGAATTTGG - Intergenic
908206798 1:61858699-61858721 TAAAATTCAATATAAGATTTTGG + Intronic
908450229 1:64247398-64247420 CAAATATCAACATAAGATTTGGG - Intronic
908466368 1:64399959-64399981 ACAACTTCAATATATGAATTTGG + Intergenic
908621315 1:65983424-65983446 AGAATTTCAACATATGATTTGGG - Intronic
908666642 1:66499363-66499385 GGTACTTCAATATATGAATTTGG - Intergenic
908890665 1:68843976-68843998 AGAACTTCAACATATGAATTGGG - Intergenic
909187252 1:72503364-72503386 AGGATTTCAGTATATGAATTTGG + Intergenic
909272130 1:73636359-73636381 CCCATTTCATAATAAGAATTTGG - Intergenic
909274003 1:73661398-73661420 AGAATTTTAATATATAAATTTGG + Intergenic
909545781 1:76844907-76844929 AGGATTTCAACATATGAATTTGG + Intergenic
909707452 1:78604532-78604554 AGAATTTCAACATATAAATTTGG - Intergenic
910271193 1:85396564-85396586 CAAATTTCAACATGAGATTTGGG + Intronic
910667790 1:89742921-89742943 AGGATTTCAATACATGAATTTGG + Intronic
910783235 1:90965501-90965523 AGGATTTCAACATAAGAATTTGG + Intronic
911085133 1:93970493-93970515 AGAATTTCAACATGTGAATTTGG + Intergenic
911154605 1:94625642-94625664 AGAATTTCACCATAAGAATTTGG + Intergenic
911214158 1:95174306-95174328 ATAATGTCAATATAAGAATTTGG - Intronic
911216841 1:95203943-95203965 AGAATTTCAATATATGAATTTGG - Intronic
911381883 1:97125594-97125616 GGGGTTTCAATATATGAATTGGG - Intronic
911691306 1:100837741-100837763 AGGATTTCAACATATGAATTTGG + Intergenic
911880070 1:103225653-103225675 CAAATTTCAAAAGAAGATTTTGG - Intergenic
911893419 1:103401021-103401043 TGAAATTCAAGATAAGATTTGGG + Intergenic
911960540 1:104296617-104296639 CGAAATTGAAGATAAGCATTGGG + Intergenic
912092150 1:106092536-106092558 TGGAATGCAATATAAGAATTAGG - Intergenic
912278718 1:108289989-108290011 AGGATTTCAATATATGAATTTGG + Intergenic
912289508 1:108404368-108404390 AGGATTTCAATATATGAATTTGG - Intronic
912860019 1:113205989-113206011 AGGACTTCAATATATGAATTTGG + Intergenic
913616678 1:120566900-120566922 AGGATTTCAACATATGAATTTGG - Intergenic
913647567 1:120873718-120873740 AGGATTTCAATATACAAATTTGG - Intergenic
914079071 1:144389142-144389164 AGGATTTCAATATACAAATTTGG + Intergenic
914100108 1:144577360-144577382 AGGATTTCAATATACAAATTTGG - Intergenic
914173975 1:145257689-145257711 AGGATTTCAATATACAAATTTGG + Intergenic
914298881 1:146360322-146360344 AGGATTTCAATATACAAATTTGG + Intergenic
914388605 1:147197439-147197461 CAAAATTCAAGATAAGATTTGGG - Intronic
914528636 1:148498874-148498896 AGGATTTCAATATACAAATTTGG + Intergenic
914573597 1:148944010-148944032 AGGATTTCAACATATGAATTTGG + Intronic
914637756 1:149568233-149568255 AGGATTTCAATATACAAATTTGG - Intergenic
915775430 1:158479883-158479905 GGTATGTGAATATAAGAATTTGG - Exonic
916373805 1:164129370-164129392 AGGATTTCAAAATATGAATTTGG + Intergenic
916772388 1:167924059-167924081 CGAATATAAATATTAGCATTTGG - Intronic
916899689 1:169207362-169207384 CACATTTCAATATGAGATTTGGG + Intronic
916982749 1:170155907-170155929 TGTCTTTCAATATAAAAATTTGG - Intronic
918111283 1:181457329-181457351 AGGATTTCAACATATGAATTTGG + Intronic
919270585 1:195338438-195338460 AGCATTTCAACATATGAATTTGG - Intergenic
919322929 1:196065706-196065728 AGAATTTGAACATATGAATTTGG - Intergenic
919470533 1:197973542-197973564 AGAGTTTTAAGATAAGAATTAGG - Intergenic
920834387 1:209495311-209495333 TGAATTTTAACATATGAATTTGG + Intergenic
921354533 1:214273900-214273922 AGGATTTCAACATATGAATTTGG + Intergenic
921490117 1:215765106-215765128 TGAATTTAAATATATGAATTTGG + Intronic
921803192 1:219425270-219425292 AGGATTTCAACATATGAATTTGG + Intergenic
922199727 1:223391879-223391901 AGAATTTTAACATATGAATTTGG + Intergenic
922329582 1:224562552-224562574 CAAATTTCAACATGAGATTTGGG - Intronic
922743454 1:228029748-228029770 AGGATTTCAATGTAGGAATTGGG - Intronic
922806378 1:228392092-228392114 AGGATTTCAACATATGAATTTGG + Intergenic
923615341 1:235532770-235532792 AGGATTTCAACATACGAATTTGG + Intergenic
923623713 1:235597406-235597428 TGGATTTCAATATAGGAATTTGG - Intronic
924183558 1:241463852-241463874 AGGATTTCAACATATGAATTTGG - Intergenic
924286455 1:242492953-242492975 AGGATTTCAATATATGAATTTGG + Intronic
924415653 1:243853513-243853535 AGGATTTCAATCTATGAATTTGG + Intergenic
924513660 1:244748973-244748995 ACTATTTCAATATATGAATTGGG - Intergenic
924895561 1:248334641-248334663 AGAATTTCAACATATGAATGGGG + Intergenic
1063797736 10:9532152-9532174 AGAATTTCAACATATCAATTTGG - Intergenic
1063826940 10:9908732-9908754 TGCATTTCAATATGAGATTTGGG + Intergenic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1064936318 10:20682802-20682824 AGAACTTCAACATATGAATTTGG - Intergenic
1065530345 10:26663185-26663207 CGAAATTCAAGATGAGATTTGGG + Intergenic
1066018814 10:31276021-31276043 CATGTTACAATATAAGAATTGGG - Intergenic
1066112124 10:32206922-32206944 GGAATTTCAACATCTGAATTTGG - Intergenic
1066136273 10:32449711-32449733 CCAATTTCAACATGCGAATTTGG - Intronic
1066641605 10:37559670-37559692 AGGTTTTCAATATATGAATTGGG + Intergenic
1067140710 10:43654016-43654038 CAAATTTCAACATAAGGTTTGGG + Intergenic
1067280790 10:44870597-44870619 AAATTTTCAATATATGAATTTGG + Intergenic
1067968276 10:50939908-50939930 TAAATTTCAACATATGAATTTGG - Intergenic
1067983883 10:51119785-51119807 GGAATTTTAAAATAAGACTTTGG + Intronic
1068233980 10:54208375-54208397 AGGATTTCAACATATGAATTTGG - Intronic
1068621588 10:59189355-59189377 TGAAATTAAATATAAAAATTAGG - Intronic
1069187578 10:65444729-65444751 AGGATTTCAACATAGGAATTTGG - Intergenic
1069246998 10:66219154-66219176 AGAATTTCACTATATGAATCAGG - Intronic
1069339992 10:67398664-67398686 CTAAATTCAAGATAAGATTTGGG - Intronic
1069576618 10:69535001-69535023 TCAAATTCAATATTAGAATTTGG - Intergenic
1071071171 10:81696169-81696191 AGGATTTCAATATGTGAATTTGG + Intergenic
1071097399 10:81993657-81993679 GGAATTGGAAAATAAGAATTTGG - Intronic
1071200598 10:83217778-83217800 AGGATTTCAATATACGAATGTGG + Intergenic
1071456077 10:85852567-85852589 CTAACTTCAAAATAAGACTTGGG + Intronic
1072708693 10:97701110-97701132 ACGATTTCAACATAAGAATTTGG + Intergenic
1073478345 10:103769069-103769091 CAAATTTCAACATAAGACTTGGG + Intronic
1073573849 10:104604500-104604522 TGAGTTTCACTATAAGAATTCGG - Intergenic
1073672968 10:105613025-105613047 AGGATTTCAACATATGAATTTGG + Intergenic
1073973262 10:109069391-109069413 AGGATTTCAACATATGAATTTGG + Intergenic
1074218772 10:111414914-111414936 CATAATTCAATATAAGAATGTGG + Intergenic
1074800167 10:116991727-116991749 CAAATTTCAACATGAGATTTTGG + Intronic
1075186895 10:120270301-120270323 AGGATTTCAACATACGAATTTGG + Intergenic
1076040105 10:127239135-127239157 CGATTTTGAAAATAAGCATTAGG + Intronic
1076071571 10:127494178-127494200 AGGATTTCAACATAGGAATTTGG + Intergenic
1076499627 10:130927211-130927233 TGAATGTGAATATAAGTATTAGG - Intergenic
1076633311 10:131866085-131866107 CAACCTTCAAGATAAGAATTTGG - Intergenic
1078723560 11:13906433-13906455 CAAATTTCAACATAAGGCTTTGG + Intergenic
1079902749 11:26208203-26208225 AGGATTTCAATATAAGAATTGGG + Intergenic
1080341653 11:31272280-31272302 GGAAATTCAATATGAGATTTGGG + Intronic
1080766287 11:35300362-35300384 TAAGTTTCAACATAAGAATTTGG - Intronic
1081598921 11:44478618-44478640 GTGATTTCAATATATGAATTTGG - Intergenic
1081658167 11:44871435-44871457 AGGGTTTCAATATATGAATTTGG + Intronic
1083138553 11:60702836-60702858 AGAATTTCAACACATGAATTTGG + Intronic
1084377451 11:68787526-68787548 AGGATTTCAATATATGAATGGGG - Intronic
1084838365 11:71823497-71823519 CGAATATCAAAATAAGATTTGGG + Intergenic
1085598104 11:77828875-77828897 TGAATTTCCATATTAGTATTAGG - Intronic
1086762895 11:90655361-90655383 CGAATATCAATTTATTAATTTGG + Intergenic
1087664035 11:101021838-101021860 CAGATTTCAGTATAAGAATAAGG + Intergenic
1087737545 11:101851817-101851839 GGGATTTCAATATATGAATTTGG + Intronic
1087739240 11:101868845-101868867 AGGATTTCAACATATGAATTTGG + Intronic
1087813289 11:102631612-102631634 AGAATTTCAACATATGAATTTGG - Intergenic
1087934519 11:104016973-104016995 AGAATTTCAACATGTGAATTTGG - Intronic
1087970760 11:104479764-104479786 AGGATTTCAACATATGAATTTGG - Intergenic
1088053173 11:105543612-105543634 TGAATTTCAATATATAATTTTGG + Intergenic
1088210417 11:107448639-107448661 AGGATCTCAACATAAGAATTTGG - Intronic
1088258811 11:107926164-107926186 TGAATATCGATATAAGAATTTGG + Intronic
1088262960 11:107961447-107961469 AGCATTTCAACATAAGAATTTGG + Intronic
1088824012 11:113478461-113478483 AGGATTTCAACATATGAATTGGG + Intergenic
1089370886 11:117956158-117956180 AGGATTTCAACATATGAATTTGG - Intergenic
1089770472 11:120798890-120798912 AGAACTTCAGTATATGAATTTGG + Intronic
1090428504 11:126627152-126627174 TGTATTTCAATATAAGCATAAGG + Intronic
1091366487 11:135025190-135025212 AGAATTTCAATATAGCAATCAGG - Intergenic
1091667544 12:2430232-2430254 AGGATTTCAACATAGGAATTTGG + Intronic
1091868207 12:3861250-3861272 AGAATTTCAACATAATAATTTGG - Intronic
1091933220 12:4414188-4414210 AGGATTTCAATATATGAATTTGG - Intergenic
1092400336 12:8170594-8170616 CGAATATCAAAATAAGATTTGGG - Intronic
1092471535 12:8786208-8786230 CTCATTTCCACATAAGAATTTGG - Intergenic
1092662554 12:10754789-10754811 GGAAATTCAAGATAAGATTTGGG + Intergenic
1093795691 12:23307819-23307841 AGGGTTTCAACATAAGAATTGGG - Intergenic
1094038917 12:26102573-26102595 TTGATTTCAATATATGAATTTGG - Intergenic
1094083128 12:26559585-26559607 AGAATTTCAGCATATGAATTTGG + Intronic
1094230178 12:28093570-28093592 TGAATTCAAATATAAAAATTTGG - Intergenic
1094254298 12:28403630-28403652 AGGATTTCAACATATGAATTTGG + Intronic
1094815344 12:34178302-34178324 TACATTTCAATATAAGATTTTGG + Intergenic
1095163856 12:38948534-38948556 TAAATTTCAATATATGAATTTGG + Intergenic
1095251680 12:39986237-39986259 AGGATTTCAATATATGAATTGGG + Intronic
1095730218 12:45498386-45498408 TACATTTCAATATAAGAATTGGG + Intergenic
1097346319 12:58497457-58497479 TTAATTTTAATATATGAATTGGG - Intergenic
1098316396 12:69197987-69198009 AGAATTTCAACATATGATTTTGG - Intergenic
1098700268 12:73615226-73615248 CTAATTTCTATATAAAAATTTGG + Intergenic
1098854136 12:75633218-75633240 AGAATTTAAACATAAAAATTTGG - Intergenic
1099230858 12:80022950-80022972 AGGATTTCAATAAATGAATTTGG + Intergenic
1099648469 12:85392220-85392242 AGAATTTCAGCATATGAATTTGG + Intergenic
1099661704 12:85571931-85571953 AGGACTTCAATATATGAATTTGG - Intergenic
1099668228 12:85658377-85658399 GGAAATTCAAGATAAGATTTGGG - Intergenic
1099771816 12:87069384-87069406 CAGATATCAATATAATAATTTGG + Intergenic
1099792264 12:87350582-87350604 AGGATTTCAACATAAGAATTTGG + Intergenic
1100626013 12:96333312-96333334 GGAAATTTAATATAATAATTTGG - Intronic
1100642602 12:96496674-96496696 AGGATTTCAACATATGAATTGGG + Intronic
1100768085 12:97890522-97890544 CTAATTTCAATAGAAGAAAATGG - Intergenic
1100802145 12:98243118-98243140 AGGACTTCAATATATGAATTTGG + Intergenic
1101071010 12:101076143-101076165 AGGATTTCAACATATGAATTTGG - Intronic
1101645984 12:106631442-106631464 AGAGTTTCAACATATGAATTTGG - Intronic
1101733146 12:107443123-107443145 AGGATTTCAACATAGGAATTTGG + Intronic
1102015682 12:109646364-109646386 GGGATTTCCATATATGAATTTGG - Intergenic
1102414297 12:112747168-112747190 AGAATTTCAACATAGGAATTTGG - Intronic
1102713685 12:114951751-114951773 AGGATTTCAACATATGAATTTGG - Intergenic
1102718651 12:114997074-114997096 AAGATTTCAATATATGAATTTGG + Intergenic
1102851932 12:116255046-116255068 TGCATTTCAATATAAGTTTTAGG - Intronic
1103247133 12:119467361-119467383 AGGATTTCAACATATGAATTTGG - Intronic
1103249228 12:119485759-119485781 CGAATTTCAACAAATGAATCTGG + Intronic
1103448260 12:121009135-121009157 AGGATTTCACCATAAGAATTTGG - Intronic
1103542826 12:121678155-121678177 TACATTTCAATATAAGATTTGGG + Intergenic
1104237624 12:126954447-126954469 AGGATTTCAACATATGAATTTGG - Intergenic
1104267775 12:127252574-127252596 AGAATTTCAAGATATGAATTTGG - Intergenic
1104432959 12:128731720-128731742 AGGATTTCAACATATGAATTTGG + Intergenic
1105944755 13:25179721-25179743 AGGATTTCAACATATGAATTTGG + Intergenic
1106131664 13:26945195-26945217 CGAATTTCCATATAAATTTTAGG - Intergenic
1106761235 13:32869887-32869909 AGGATTTCAACATATGAATTTGG - Intergenic
1107648946 13:42525066-42525088 AGAATTCCAATATAGGAAATAGG + Intergenic
1107735878 13:43398125-43398147 AGGATTTCAACATATGAATTTGG + Intronic
1107962581 13:45571625-45571647 TGAACTTCAACATATGAATTTGG - Intronic
1108507403 13:51124859-51124881 CGAGGTTTAATTTAAGAATTAGG - Intergenic
1108588283 13:51890216-51890238 CGAATTTCAACATGAGCTTTTGG - Intergenic
1108716207 13:53080711-53080733 AGGATTTCAACATATGAATTTGG - Intergenic
1108733591 13:53259671-53259693 CAAATTTCAATTTTAGACTTAGG + Intergenic
1108923585 13:55708102-55708124 TGTATTTTAATATAATAATTCGG - Intergenic
1108936143 13:55882590-55882612 TAAATTACAATATAATAATTGGG + Intergenic
1109139432 13:58695901-58695923 GGAATTTCAATATGAGATTTGGG - Intergenic
1109147831 13:58803644-58803666 AGAATTTCAATATATACATTTGG + Intergenic
1109213923 13:59565952-59565974 AGAATTGCAATATATGAGTTTGG + Intergenic
1109926545 13:69148558-69148580 AGGATTTCAATATATAAATTTGG + Intergenic
1109999732 13:70180096-70180118 TAGATTTCAACATAAGAATTGGG - Intergenic
1110146481 13:72197661-72197683 TGAATTTTAATGTAAAAATTAGG + Intergenic
1110272301 13:73604463-73604485 TAGATTTCAATATATGAATTTGG + Intergenic
1110297679 13:73887296-73887318 TGCATTTCAATATGAGATTTGGG - Intronic
1110357796 13:74588642-74588664 AGGATTTCAACATATGAATTTGG - Intergenic
1110605551 13:77427700-77427722 GAGATTTCAATATAAAAATTGGG + Intergenic
1110791719 13:79593120-79593142 AGGATTTCAACATAGGAATTTGG - Intergenic
1110915737 13:81018514-81018536 AGAAACTCAATATATGAATTTGG - Intergenic
1110950628 13:81485681-81485703 GGAATTTTAACATATGAATTTGG - Intergenic
1111058685 13:82983369-82983391 AGAATTTCAAAGTATGAATTGGG - Intergenic
1111073557 13:83201977-83201999 CAAATTACAGTATAGGAATTAGG - Intergenic
1111258478 13:85704017-85704039 TGGATTTCAATATACAAATTTGG - Intergenic
1111400236 13:87724069-87724091 TGAATTTCAATGGAAGAAATTGG - Intergenic
1111514181 13:89306238-89306260 CTTATTTAAATATAATAATTTGG - Intergenic
1111937569 13:94572379-94572401 AGTACTTCAACATAAGAATTTGG - Intergenic
1112039111 13:95528140-95528162 CAAAATTCAAGATGAGAATTGGG - Intronic
1112071085 13:95851133-95851155 CTAATTTCCATGTTAGAATTAGG + Intronic
1112122494 13:96428667-96428689 AGGACTTCAATATATGAATTTGG + Intronic
1112163828 13:96896637-96896659 AGGATTTCAATACATGAATTTGG - Intergenic
1112396364 13:99036232-99036254 AGGGTTTCAACATAAGAATTTGG - Intronic
1112531149 13:100204695-100204717 CAAATTTTAATAGAAGAATGGGG - Intronic
1112683607 13:101796492-101796514 TGGACTTCAATATATGAATTTGG - Intronic
1112893891 13:104273970-104273992 AGGATTTCAACATATGAATTTGG - Intergenic
1112894624 13:104284075-104284097 AGAATTTCAACCTATGAATTTGG - Intergenic
1113121285 13:106926151-106926173 AGGATTTCAACATATGAATTTGG + Intergenic
1113248561 13:108426050-108426072 AGGATTTCAACATAGGAATTTGG + Intergenic
1114168432 14:20246293-20246315 AGGATTTCAACATATGAATTTGG - Intergenic
1114194487 14:20465210-20465232 AGAGCGTCAATATAAGAATTTGG + Intergenic
1114366081 14:22028501-22028523 CAGATTTCAACATATGAATTTGG - Intergenic
1114744079 14:25127978-25128000 AGGATTTCAAAATATGAATTGGG - Intergenic
1115096094 14:29637260-29637282 CGAATTCCAATATATTAAATTGG + Intronic
1115995862 14:39195128-39195150 GGAATTTCAACATATGAATTTGG + Intergenic
1116053744 14:39837965-39837987 AGAGTTTCAACATATGAATTTGG - Intergenic
1116364449 14:44041712-44041734 CCAATTTCAACATGAGATTTGGG - Intergenic
1116408437 14:44594601-44594623 CAAGTTTCAATATAAAAAATAGG + Intergenic
1116443259 14:44979055-44979077 TGAATTTTGATATAACAATTAGG + Intronic
1116588383 14:46739289-46739311 GGAGTTTCATTATAAGAAATGGG - Intergenic
1116681796 14:47980978-47981000 GGTATTTAAATATAAGCATTGGG - Intergenic
1117083453 14:52175509-52175531 AGGATTTCAATATATGAATTTGG + Intergenic
1117155422 14:52935387-52935409 AGGATTTCAACATATGAATTTGG - Intronic
1117303662 14:54452195-54452217 AGGATTTCAACATAAGAACTTGG + Intergenic
1117579166 14:57134538-57134560 CAAAATTCAATATAAGGACTTGG + Intergenic
1118567119 14:67153555-67153577 GGAGTTTCAACATATGAATTTGG + Intronic
1119150466 14:72354750-72354772 TAGATTTCAATATATGAATTTGG + Intronic
1119881965 14:78106708-78106730 AGAATTTCAACATATAAATTTGG - Intergenic
1119975761 14:79022336-79022358 CCAATTTAAAAAAAAGAATTGGG - Intronic
1120026553 14:79591848-79591870 TGAATTTCAGTGTAAGAAATCGG - Intronic
1120633176 14:86916446-86916468 GGGATCTCAAGATAAGAATTGGG - Intronic
1120713596 14:87817693-87817715 AGGATTTTAATATATGAATTTGG - Intergenic
1120722950 14:87907204-87907226 AGGGTTTCAGTATAAGAATTGGG - Intronic
1121215743 14:92246307-92246329 CAAATTTCAACATGAGACTTTGG + Intergenic
1121249852 14:92491439-92491461 AGAACTTCAACATATGAATTTGG + Intronic
1121814184 14:96916406-96916428 AGAACTTCAATATGTGAATTTGG - Intronic
1122331951 14:100925107-100925129 TGAATTTCAATATAACATATAGG + Intergenic
1122368643 14:101214672-101214694 AGAATTTCAACATATAAATTTGG - Intergenic
1123984749 15:25635479-25635501 AGAACTTCAATATATGAATGGGG + Intergenic
1124055292 15:26236202-26236224 TCAATTTCAACATAAGAATTTGG - Intergenic
1124062150 15:26303518-26303540 AGAATTTCAACATATGAATTTGG + Intergenic
1124154121 15:27210059-27210081 AGGATTTCAACATATGAATTTGG + Intronic
1124385651 15:29206363-29206385 AGAATTTCAACATAGAAATTCGG + Intronic
1124644827 15:31430997-31431019 AGAATTTCAACGTATGAATTGGG - Intronic
1124663292 15:31568637-31568659 TGCATTTCAATATGAGATTTGGG - Intronic
1124680899 15:31729982-31730004 AGGGTTTCAATATATGAATTTGG - Intronic
1124684845 15:31773573-31773595 AGGATTTCAACATATGAATTTGG + Intronic
1125007414 15:34833331-34833353 TAAGTTTCAATATATGAATTTGG + Intergenic
1125780037 15:42257162-42257184 CAAATTTCAATATGAAATTTGGG - Intronic
1126163970 15:45638241-45638263 AGGGTTTCAATATATGAATTTGG - Intronic
1126193196 15:45900603-45900625 CCAATTTCAATATAAGCCTATGG + Intergenic
1126229305 15:46306732-46306754 AGGATTTCAACATATGAATTTGG - Intergenic
1126444751 15:48729858-48729880 AGATTTTCAATATAAAAAGTTGG + Intronic
1126754575 15:51913270-51913292 CAAATTAAAATATAAGAATAAGG - Exonic
1127304007 15:57684199-57684221 AGGATTTCAAAATATGAATTTGG + Intronic
1127764251 15:62169428-62169450 AGGATTTCAACATAGGAATTTGG - Intergenic
1127972435 15:63971926-63971948 AGAATTTCAAAATATGAACTTGG - Intronic
1127985020 15:64062472-64062494 AGGATTTCAACATATGAATTTGG + Intronic
1128272456 15:66322900-66322922 TCAATATCAATGTAAGAATTTGG - Exonic
1128350606 15:66885880-66885902 CGGATTTCAATATATAAATTTGG + Intergenic
1129923106 15:79337413-79337435 CAGAATTCAACATAAGAATTTGG + Intronic
1130007526 15:80114477-80114499 AGAATTTCAATAAATGTATTAGG + Intronic
1130163175 15:81423061-81423083 AGGATTTCAACATATGAATTTGG - Intergenic
1131433305 15:92403568-92403590 CGATTTTCAAAATTAGAACTGGG - Intronic
1131659241 15:94496735-94496757 AGAATTTCAGCATATGAATTTGG - Intergenic
1132216291 15:100063984-100064006 AGAACTTCAACATACGAATTTGG - Intronic
1134037869 16:11045521-11045543 AGGATTTCAACATATGAATTTGG + Intronic
1134297224 16:12957631-12957653 AGGATTTCAACATATGAATTTGG + Intronic
1134374482 16:13659082-13659104 AGAACTTCAACATAAAAATTTGG + Intergenic
1135201642 16:20442517-20442539 AGGACTTCAACATAAGAATTTGG + Intergenic
1135217466 16:20585349-20585371 AGGACTTCAACATAAGAATTTGG - Intergenic
1135762799 16:25150712-25150734 TTTTTTTCAATATAAGAATTAGG - Intronic
1135833706 16:25803541-25803563 TGAATTTAAAAATAATAATTTGG - Intronic
1135907905 16:26530330-26530352 TGAATTTCAAGAGAAGTATTTGG + Intergenic
1135927990 16:26711921-26711943 AGGATTTCAACATATGAATTCGG + Intergenic
1137909432 16:52361366-52361388 AGAATTTCAACATATGAATTTGG - Intergenic
1138574494 16:57898858-57898880 AGGATTTCAATATATGAATTTGG - Intronic
1138730290 16:59186576-59186598 AGAATTTCAACATATAAATTTGG + Intergenic
1138909855 16:61383531-61383553 TAGATTTCAACATAAGAATTTGG - Intergenic
1138970068 16:62133284-62133306 CAGATTTCAATATGACAATTTGG + Intergenic
1139131008 16:64145062-64145084 CAAATTGCAAAATAAAAATTAGG + Intergenic
1139149532 16:64364305-64364327 AGAATTTCAATATAGGATTGTGG - Intergenic
1139325105 16:66146412-66146434 AGGATTTCAACATATGAATTTGG - Intergenic
1139974320 16:70796803-70796825 AGAACTTCAATATATGAATCTGG - Intronic
1140020461 16:71233514-71233536 TGAATTTCAACACATGAATTTGG - Intergenic
1140557240 16:75936035-75936057 AGAACTTCAACACAAGAATTTGG + Intergenic
1140704629 16:77615209-77615231 CACATTTCAACATAAGATTTGGG + Intergenic
1141000971 16:80307535-80307557 AAAATTTCAACATATGAATTTGG + Intergenic
1141259793 16:82442001-82442023 AGGATTTCAATACATGAATTTGG + Intergenic
1141446771 16:84064426-84064448 AGAATTTGAAAATAGGAATTTGG - Intronic
1142267160 16:89069915-89069937 AGGATTTCAATATATGAATTTGG - Intergenic
1142439513 16:90086581-90086603 TACATTTTAATATAAGAATTTGG - Intronic
1143649226 17:8253051-8253073 AGGGTTTCAATATATGAATTGGG + Intronic
1143782395 17:9236104-9236126 CAAGTTCCAACATAAGAATTTGG + Intronic
1143974167 17:10817921-10817943 CAAATTTTAATATAAGAATTTGG - Intergenic
1144338211 17:14291048-14291070 AAAGTTTCAATATATGAATTTGG + Intergenic
1146366781 17:32235000-32235022 AGGATTTCAACATAAGAAATTGG + Intronic
1146600302 17:34208811-34208833 TGAATTTCAATATAAATTTTGGG + Intergenic
1147281287 17:39363312-39363334 CAAATTTAAAAATAAAAATTTGG - Intronic
1149789666 17:59466026-59466048 AGGACTTCAACATAAGAATTTGG - Intergenic
1149953938 17:61023943-61023965 CGAGTTTGAATATAGTAATTTGG + Intronic
1150159480 17:62883737-62883759 AGGATTTCAATATATAAATTTGG - Intergenic
1150844836 17:68645262-68645284 AGAATTTCAATATATGAATTTGG - Intergenic
1151146818 17:72048967-72048989 AGAATTTCAATATATTAATTTGG - Intergenic
1151590376 17:75039924-75039946 CGAATTTCAAAATAATTATGCGG - Intronic
1152456194 17:80417653-80417675 ATAATTTCAACATAGGAATTTGG + Intronic
1153655756 18:7280741-7280763 AGGATTTCAACATATGAATTTGG + Intergenic
1154249968 18:12736258-12736280 AGGATTTCAACATAGGAATTTGG + Intergenic
1154393846 18:13969104-13969126 AGGATTTCAATATCTGAATTTGG + Intergenic
1155397503 18:25402304-25402326 CAAGTTTCAAGATAGGAATTGGG - Intergenic
1155433088 18:25782393-25782415 AGAATTTCAAGATATAAATTTGG + Intergenic
1155466622 18:26142888-26142910 AGGATTTCAACATACGAATTTGG + Intronic
1155727883 18:29112372-29112394 AGAATTTCAACACATGAATTTGG + Intergenic
1156481270 18:37437862-37437884 CAGGTTTCAACATAAGAATTTGG - Intronic
1156902245 18:42313290-42313312 GGAAATTCAAGATAAGATTTGGG + Intergenic
1156945343 18:42822798-42822820 CCTATTTGAAAATAAGAATTGGG + Intronic
1157541836 18:48516136-48516158 AGAACTTCAACATATGAATTTGG - Intergenic
1158129153 18:54133548-54133570 AGAAATTCAACATATGAATTTGG - Intergenic
1158484972 18:57858085-57858107 AGGATTTCAACATATGAATTTGG - Intergenic
1158710187 18:59830631-59830653 AGAATTACAAAATAACAATTGGG - Intergenic
1159007376 18:63024906-63024928 AGAACTTTAATATATGAATTTGG + Intergenic
1159314052 18:66748207-66748229 TGAATTTCAATTTAATACTTGGG - Intergenic
1159375943 18:67593366-67593388 CAAATGTAAATATAAAAATTTGG - Intergenic
1159430989 18:68353233-68353255 CAAAGTTTAATATATGAATTAGG + Intergenic
1160346544 18:78137055-78137077 TGGGTTTCAATATATGAATTTGG - Intergenic
1160958264 19:1705365-1705387 CAAATTTCAACATGAGACTTGGG + Intergenic
1161218286 19:3105627-3105649 AGAATTTTAACATAGGAATTTGG + Intronic
1161259882 19:3331962-3331984 AGAACTTCAACATATGAATTTGG + Intergenic
1161541916 19:4857061-4857083 AGGACTTCAACATAAGAATTTGG - Intronic
1164864293 19:31591055-31591077 TGAACTTCAACATAGGAATTTGG - Intergenic
1165638064 19:37360411-37360433 TGAATTTCAATGTAAGTTTTAGG + Intronic
1166656963 19:44619291-44619313 CGCATTTCAACATGAGATTTTGG + Intronic
1167416081 19:49373428-49373450 AGAATTTCAAAATATGAATTTGG + Intronic
1168014119 19:53557514-53557536 AGAATTTCAATATAGGAATCTGG + Intronic
925214108 2:2078879-2078901 AGAATTTCAACATATGAATTTGG - Intronic
925559906 2:5180084-5180106 GGAATTTCAATATGTGGATTTGG + Intergenic
925642492 2:5999310-5999332 AGGGTTTCAATATATGAATTTGG + Intergenic
925721589 2:6833624-6833646 AGGAATTCAACATAAGAATTTGG + Intergenic
925965322 2:9060248-9060270 CGTACTTCCATATATGAATTTGG - Intergenic
925983565 2:9196675-9196697 AGAATTTCAACATATGAGTTGGG - Intergenic
926446971 2:12955109-12955131 GGAATTTCAAGATGAGATTTGGG - Intergenic
926592799 2:14757759-14757781 AGAACTTCAACATAAGAATTTGG + Intergenic
927405980 2:22767224-22767246 TGGATTTCAACATATGAATTTGG + Intergenic
928512879 2:32017830-32017852 AGGATTTCAACATATGAATTTGG - Intronic
928842509 2:35627245-35627267 AGGATTTCAACATATGAATTTGG - Intergenic
928977606 2:37105238-37105260 CAAATTTCAACATGAGATTTTGG - Exonic
929074591 2:38069505-38069527 GGAATTTTAATATATTAATTAGG + Exonic
929224862 2:39502227-39502249 AAGATTTCAATATATGAATTTGG - Intergenic
929267887 2:39939547-39939569 TAAGTTTCAACATAAGAATTTGG + Intergenic
929446387 2:42004597-42004619 AGGATTTCAACATATGAATTTGG + Intergenic
929547596 2:42865860-42865882 AGAATTTCAACCTAGGAATTTGG - Intergenic
929840234 2:45452561-45452583 CTAATTTGAATAAATGAATTTGG + Intronic
930170345 2:48245402-48245424 AGGATTTCAACATATGAATTTGG - Intergenic
930673442 2:54175837-54175859 CGGATTTCAACATATGATTTTGG - Intronic
932299138 2:70653069-70653091 AGGATTTCAACATATGAATTTGG - Intronic
932647578 2:73520110-73520132 CTAATTTTAATTTAAGAATTAGG + Intronic
932792469 2:74667584-74667606 CGTATTTGAAAATAAGATTTCGG - Intronic
932985015 2:76715541-76715563 AGAGTTTAAATATAAGACTTAGG - Intergenic
933056949 2:77682390-77682412 CAAATTTCAGAATATGAATTTGG + Intergenic
933242808 2:79941970-79941992 TTAATTACAATATGAGAATTTGG - Intronic
933501841 2:83122576-83122598 CCAATTTCAACATAATAATTTGG + Intergenic
933588113 2:84201667-84201689 AGGATTTCAACCTAAGAATTTGG + Intergenic
933781169 2:85802429-85802451 AGAATGTCAACATATGAATTAGG - Intergenic
933784879 2:85830661-85830683 TTGATTTCAATATATGAATTTGG - Intergenic
933843919 2:86309834-86309856 AGAACTTCAAAATACGAATTTGG + Intronic
933869721 2:86553964-86553986 AGGATTTCAACATACGAATTTGG - Intronic
933927079 2:87103534-87103556 CAAATTTCAGAATATGAATTTGG + Intergenic
933982426 2:87562574-87562596 AGAATTCCAACATATGAATTTGG + Intergenic
933993564 2:87651068-87651090 AGGATTTCAACATATGAATTTGG - Intergenic
933998791 2:87689195-87689217 CCCATTTCAATATGAGATTTGGG + Intergenic
934521256 2:95021494-95021516 AGGATTTCAACATAGGAATTTGG - Intergenic
935012458 2:99148450-99148472 CAAATATTAATATAACAATTAGG - Intronic
935559120 2:104543096-104543118 AGGATTTCAACATATGAATTTGG - Intergenic
935636703 2:105254732-105254754 AGGATTTCAACATATGAATTTGG - Intergenic
936295058 2:111261683-111261705 CCCATTTCAATATGAGATTTGGG - Intergenic
936300299 2:111299815-111299837 AGGATTTCAACATATGAATTTGG + Intergenic
936311416 2:111388219-111388241 AGAATTCCAACATATGAATTTGG - Intergenic
936472053 2:112807934-112807956 TGAAATTCAATAAAAGAGTTGGG - Intergenic
936565924 2:113582718-113582740 AGGGTTTCAACATAAGAATTTGG + Intergenic
936708347 2:115102332-115102354 AGAGTTTCAAAATATGAATTTGG + Intronic
937442419 2:121927932-121927954 AGGATTTCAACATATGAATTTGG + Intergenic
937462543 2:122101936-122101958 TAAGTTTCAACATAAGAATTTGG + Intergenic
937542144 2:122969430-122969452 AGAATTTCTAGATATGAATTTGG + Intergenic
937713779 2:125009167-125009189 AGCATTTCAACATATGAATTGGG - Intergenic
938227505 2:129628469-129628491 TGCATTTCAACATAAGATTTGGG - Intergenic
938635625 2:133223176-133223198 CTAATTTCAATATAGACATTTGG - Intronic
938718314 2:134041116-134041138 CGAAATTCAACATGAGATTTGGG + Intergenic
938872894 2:135499822-135499844 TGAACTTCAACATATGAATTTGG - Intronic
939104352 2:137932134-137932156 GGAATTTCAACATAGGAATTTGG + Intergenic
939627183 2:144492260-144492282 CAAATTTCATTATGAAAATTGGG - Intronic
940344495 2:152615320-152615342 GGAAATTAAATATGAGAATTTGG + Intronic
940397487 2:153207645-153207667 CCAATTTCAAAATAATGATTTGG + Intergenic
940672957 2:156693509-156693531 GGAATTTCAACATAAGAATTTGG - Intergenic
941456727 2:165718199-165718221 AGGATTTCAACATATGAATTTGG - Intergenic
941478729 2:165979705-165979727 AGGATTTCAATATATGAATTCGG - Intergenic
942120462 2:172771354-172771376 AGGATTTCAACATATGAATTTGG + Intronic
942202729 2:173588288-173588310 GAAATTGCAATATGAGAATTAGG - Intergenic
942493386 2:176512365-176512387 AGGATTTCAACATATGAATTTGG - Intergenic
942860046 2:180598464-180598486 AGGATTTCAACATATGAATTGGG + Intergenic
943068654 2:183115499-183115521 TATATTTCAATATAAGATTTGGG + Intergenic
943430605 2:187796295-187796317 CATATTTCAATATGAGATTTAGG + Intergenic
943547957 2:189304696-189304718 TGCATTTCAACATGAGAATTGGG + Intergenic
943642610 2:190375860-190375882 AGGATTTCAACATATGAATTTGG - Intergenic
943674978 2:190707607-190707629 AGGATTTCAATATATGAATTTGG - Intergenic
943692854 2:190886237-190886259 CACATTTCAATATAAATATTAGG - Intronic
943854136 2:192766590-192766612 TGAAATTCAAGATATGAATTAGG - Intergenic
943862089 2:192879879-192879901 CTAAATACAATATTAGAATTTGG - Intergenic
943937644 2:193942675-193942697 AGAATTTCAAAATACGAATTTGG - Intergenic
944403133 2:199351439-199351461 TGAATTACACTATAAGGATTAGG - Intronic
944965461 2:204927210-204927232 AGGATTTCAACATAGGAATTTGG - Intronic
945286642 2:208089074-208089096 CGTATATCAATTAAAGAATTTGG + Intergenic
945704788 2:213215926-213215948 GGAATTTCAACATATGAATTTGG - Intergenic
945732918 2:213562996-213563018 AGGATTTCAACATAGGAATTTGG + Intronic
945833441 2:214811506-214811528 CAACTTTTAATATATGAATTTGG - Intergenic
945935212 2:215896904-215896926 AGGATTTCAACATATGAATTTGG + Intergenic
946678998 2:222193981-222194003 AGGATTTCAACATAAAAATTTGG + Intergenic
946830794 2:223726385-223726407 AGGGTTTCAATATATGAATTTGG + Intergenic
947383262 2:229565089-229565111 AGGATTTCAACATATGAATTTGG + Intronic
947647553 2:231754935-231754957 AGGATTTCAATGTATGAATTTGG - Intronic
948097343 2:235346955-235346977 AGAATTTCTACATGAGAATTTGG + Intergenic
948152196 2:235753106-235753128 AGGATTTCAGTATAAGAATTTGG + Intronic
948364696 2:237447086-237447108 AGAATTTCAACACAAGAATTTGG + Intergenic
948790270 2:240373178-240373200 TCGATTTCAACATAAGAATTCGG + Intergenic
948871524 2:240801594-240801616 AGGATTTCAACATAAGAATTTGG - Intronic
948914871 2:241029521-241029543 CGGATCTCAACATAGGAATTTGG + Intronic
1168906015 20:1404452-1404474 GAAATTTCAACATATGAATTTGG + Intergenic
1169292147 20:4361907-4361929 AGGATTTCAACATATGAATTAGG - Intergenic
1169548287 20:6673664-6673686 AGGATTTCAACATATGAATTTGG + Intergenic
1169747161 20:8954051-8954073 CGAATTTCAATATAAGAATTTGG + Intronic
1169815927 20:9656031-9656053 AGGATTTCAATATATGAACTTGG + Intronic
1170022346 20:11850397-11850419 AGGATTTCAACATATGAATTTGG - Intergenic
1170122886 20:12929050-12929072 AGAATTTCAACATATGAATTTGG + Intergenic
1170453018 20:16505343-16505365 GGAATTTAAAAGTAAGAATTGGG - Intronic
1170755094 20:19195882-19195904 AGGATTTCAGCATAAGAATTTGG + Intergenic
1170789976 20:19499677-19499699 AGGATTTCAACATATGAATTTGG + Intronic
1170928979 20:20751455-20751477 GGAATTTCATTGTTAGAATTAGG + Intergenic
1171037914 20:21731190-21731212 CACATTTCAATAAATGAATTTGG - Intergenic
1171818621 20:29812058-29812080 TATATTTCAATATAAGATTTTGG + Intergenic
1171899179 20:30840956-30840978 TATATTTCAATATAAGATTTTGG - Intergenic
1172582487 20:36059255-36059277 AGGATTTCAACATAGGAATTTGG + Intergenic
1173291530 20:41719162-41719184 AGGATTTCAACATATGAATTTGG + Intergenic
1174320504 20:49738317-49738339 TAAGTTTCAATATATGAATTTGG + Intergenic
1175039464 20:56033289-56033311 AGAACTTCAACATAGGAATTTGG + Intergenic
1176049315 20:63108291-63108313 CTAATTTCAACATAGGAATTTGG - Intergenic
1176691856 21:9921874-9921896 AGAATTTTAATATACAAATTTGG - Intergenic
1177114140 21:17065179-17065201 AGGATTTTAATATATGAATTTGG + Intergenic
1177210620 21:18066670-18066692 GGATTTCCAATATATGAATTTGG - Intronic
1177530505 21:22352471-22352493 AGGATTTCGATATATGAATTGGG + Intergenic
1177950814 21:27534430-27534452 GGAATCTCAATAAAAGAAGTTGG + Intergenic
1178010222 21:28276262-28276284 AGGGTTTCAATATATGAATTTGG + Intergenic
1178255177 21:31045607-31045629 AGAATTCCAACATAGGAATTTGG + Intergenic
1178318674 21:31588325-31588347 AGGATTTCAACATATGAATTTGG - Intergenic
1178745961 21:35250613-35250635 AGAATTTCAATAGATGAATTTGG - Intronic
1178949486 21:36974494-36974516 AGAACTTCAACATTAGAATTTGG - Intronic
1180073018 21:45447639-45447661 TGAAATTCAATTTAAGTATTGGG - Intronic
1180322067 22:11331442-11331464 TATATTTCAATATAAGATTTTGG + Intergenic
1180332846 22:11548260-11548282 TATATTTCAATATAAGATTTTGG - Intergenic
1181293705 22:21818200-21818222 AGAATTTCAAGAAAAGAAGTCGG + Intronic
1181665648 22:24394482-24394504 AGGATTTCAACATAAGAATTTGG + Intronic
1181681407 22:24498244-24498266 AGGATTTCAACATATGAATTTGG + Intronic
1182918439 22:34057145-34057167 TGAATTTGAATATAATTATTTGG - Intergenic
1183806165 22:40212952-40212974 TGAAATTCAATTTAAAAATTAGG - Intronic
1184740562 22:46426597-46426619 AGGATTTCAATATAGCAATTTGG + Intronic
949232340 3:1766109-1766131 AGGATTTTAATATATGAATTTGG + Intergenic
949406086 3:3716284-3716306 AGGATTTCATTATATGAATTGGG + Intronic
949589900 3:5483127-5483149 AGGATTTCAACATATGAATTTGG + Intergenic
950390223 3:12690732-12690754 CTAATTTTAATAAAAAAATTTGG - Intergenic
951425477 3:22539679-22539701 AGAATTTAAACATATGAATTTGG + Intergenic
951836607 3:26990299-26990321 AGGATTTCAAGACAAGAATTTGG + Intergenic
951932622 3:27985741-27985763 AGGATTTCAACATATGAATTTGG - Intergenic
951949659 3:28185688-28185710 AGGACTTCAATATATGAATTAGG + Intergenic
952686815 3:36159531-36159553 AGAATTTCAACATATGAATTTGG + Intergenic
953307806 3:41845772-41845794 CAAATTTCAACATGAGATTTGGG - Intronic
953505278 3:43480124-43480146 TGACATTCAATAGAAGAATTGGG + Intronic
953649089 3:44783547-44783569 CAAATTTCAACATGAGAATTGGG + Intronic
954170654 3:48799443-48799465 AGGACTTCAATATATGAATTTGG + Intronic
955184163 3:56699211-56699233 AGAGTTTCAACATATGAATTTGG - Intergenic
955293814 3:57717046-57717068 AGAATTTCAACATGAGAATTTGG + Intergenic
955351689 3:58198129-58198151 AGAACTTCAACATAGGAATTTGG - Intronic
955597062 3:60602723-60602745 AGGATTTCAACATATGAATTTGG - Intronic
955905238 3:63800699-63800721 CAAATTTTAATAAAATAATTAGG - Intergenic
956342151 3:68237375-68237397 AGGATTTCAACATATGAATTTGG + Intronic
956413799 3:69005994-69006016 AGAATTTCAACATATGAATTTGG - Intronic
956521434 3:70108558-70108580 GGAGTTTCAGTATATGAATTTGG - Intergenic
956868233 3:73390251-73390273 CAAATTTTAATACAAGTATTTGG - Intronic
956967111 3:74474711-74474733 TGCATTTCAATATGAGATTTGGG - Intronic
956984336 3:74679780-74679802 AGAATTTCAATATATGAACTTGG - Intergenic
957181078 3:76878074-76878096 AGAACTTCAACATATGAATTTGG + Intronic
957183811 3:76916073-76916095 AGGGTTTCAATATATGAATTTGG + Intronic
957191797 3:77019430-77019452 AGGATTTCAACATATGAATTTGG + Intronic
957296463 3:78339614-78339636 AGGATTTCAATATATGAGTTTGG - Intergenic
957428186 3:80067345-80067367 CAAATTTCAATATGAGGCTTTGG - Intergenic
957563407 3:81855112-81855134 AGGATTTCAACATAGGAATTTGG + Intergenic
958129850 3:89404207-89404229 GAAATTTCTATATAAAAATTAGG + Intronic
958655016 3:96989853-96989875 AGAATTTCAAGATGAGATTTGGG + Intronic
958860424 3:99438582-99438604 AGAACTTCAACATATGAATTTGG - Intergenic
959223244 3:103549200-103549222 CATATTTCAACATAGGAATTTGG - Intergenic
959420621 3:106124057-106124079 AGGATTTCAACATATGAATTTGG - Intergenic
959436938 3:106327087-106327109 AGGATTACAACATAAGAATTTGG - Intergenic
959788972 3:110333809-110333831 GGAAATTCAAGATAAGATTTGGG + Intergenic
960812568 3:121638417-121638439 CTAATTTCCATTTAAGAATGGGG + Intronic
960910598 3:122645320-122645342 AGGGTTTCAATATAAGAATTTGG + Intergenic
961099122 3:124183537-124183559 TGCATTTCAACATAAGATTTGGG + Intronic
961101185 3:124200572-124200594 AGAATTTCAACATATAAATTTGG + Intronic
961698288 3:128722041-128722063 CACATTTCAATATAAGATTTTGG - Intergenic
961948221 3:130716359-130716381 CGCATTTAAATGTAAGACTTTGG + Intronic
962621294 3:137182320-137182342 CGAATTTCAACATGAGATTTGGG - Intergenic
963369630 3:144382369-144382391 GGGTTTTCAATATAAAAATTTGG - Intergenic
963512714 3:146268941-146268963 AGAATTTCAACATATGAATTTGG - Intergenic
963534245 3:146508129-146508151 AGAGTTTCAACATATGAATTTGG - Intergenic
964203643 3:154146333-154146355 AGGATTTCAATATATGAATTTGG + Intronic
964298124 3:155256451-155256473 GGAATTTGGATATAAGAGTTTGG - Intergenic
964557331 3:157954052-157954074 CAAATTTCAACATCAGATTTTGG + Intergenic
964809920 3:160652452-160652474 AGGATTTCAACATATGAATTGGG - Intergenic
964834527 3:160922898-160922920 CAAATTTCAATATTAGGATATGG - Intronic
964888894 3:161515457-161515479 CGAAAAACAATATCAGAATTAGG + Intergenic
965157560 3:165084017-165084039 GGAATTTCAGCATATGAATTTGG - Intergenic
965211453 3:165794691-165794713 AGTATTTCAACATATGAATTTGG + Intronic
965523634 3:169693740-169693762 CGTATTTTAAAATACGAATTTGG - Intergenic
965631779 3:170740654-170740676 AGGATTTCAATATATGGATTTGG + Intronic
965840070 3:172894651-172894673 AGAATTTCAACATATGAATTTGG - Intronic
966004281 3:174989226-174989248 CAAATTTCAAAATGAGATTTGGG + Intronic
966080452 3:175993804-175993826 AGAATTTCACCATATGAATTTGG - Intergenic
966294190 3:178399960-178399982 AGGATTTCAATGTATGAATTTGG - Intergenic
966297761 3:178444023-178444045 AGGATTTCAATATATGAATTTGG - Intronic
966462833 3:180196659-180196681 AGAACTTCAACATATGAATTTGG - Intergenic
966480747 3:180405648-180405670 ATAATTTCAACATATGAATTTGG + Intergenic
966566919 3:181393197-181393219 TAAATTTCAATATGAGATTTGGG + Intergenic
966979292 3:185115963-185115985 AGGATTTCAATATATGAATTTGG + Intronic
967042432 3:185705890-185705912 AGGATTTCAACATAAGAATTTGG + Intronic
967489059 3:190067943-190067965 ACAATTTAAATATAAAAATTAGG + Intronic
967669864 3:192219914-192219936 GGAATTTCAAAAGAAAAATTAGG - Intronic
967870715 3:194226748-194226770 AGGATTTCAACATATGAATTGGG - Intergenic
969323942 4:6430093-6430115 TGAATTTCCATTTAAGAAGTGGG + Intronic
969324315 4:6432080-6432102 TTAATTTCAATATACGAATTTGG + Intronic
969368296 4:6713367-6713389 AGAATTTAAATATATGAATTTGG + Intergenic
969779789 4:9391032-9391054 CGAATATCAAAATAAGATTTGGG + Intergenic
969939226 4:10713587-10713609 CGAATTTTAACATGAGATTTTGG - Intergenic
970207554 4:13669970-13669992 AGAATTTCAACATATGATTTTGG + Intergenic
970356633 4:15260164-15260186 AGGATTTCAATGTATGAATTTGG - Intergenic
970398590 4:15696332-15696354 TGAATGTCAATATATAAATTTGG + Intronic
970407056 4:15773956-15773978 AGGATTTCAACATATGAATTTGG - Intergenic
970558702 4:17261208-17261230 GGGATTTCAACATATGAATTTGG + Intergenic
970726633 4:19053610-19053632 AGGATTTCAACATATGAATTGGG - Intergenic
970786461 4:19803270-19803292 AGGATTTCAACATATGAATTTGG + Intergenic
970968788 4:21957635-21957657 GGGATTTCAACATATGAATTTGG - Intergenic
971032888 4:22660126-22660148 ACAATTTCAACATATGAATTTGG + Intergenic
971203211 4:24532361-24532383 CGTATTTGAATATTTGAATTTGG + Intronic
971646584 4:29214125-29214147 AGGATTTCAACATATGAATTTGG - Intergenic
972042220 4:34616884-34616906 AGGATTTCAACATATGAATTTGG + Intergenic
972108970 4:35530955-35530977 AGAATTTCAATATATGAATTTGG + Intergenic
972304071 4:37814941-37814963 AGGATTTCAACATATGAATTTGG - Intergenic
972856264 4:43111110-43111132 AGGGTTTCAACATAAGAATTTGG - Intergenic
973077337 4:45945863-45945885 AGAATTTCAATGTATAAATTAGG - Intergenic
973602840 4:52558904-52558926 AGGATTTCAATGTACGAATTTGG + Intergenic
973628133 4:52793029-52793051 CAAATTTCAACATGAGATTTGGG - Intergenic
973801924 4:54486953-54486975 AGGATTTCAACATATGAATTTGG - Intergenic
974031981 4:56784432-56784454 AGGATTTCAATATATGAATTTGG - Intergenic
974683895 4:65198962-65198984 TGAATTGCCATATCAGAATTAGG - Intergenic
974700715 4:65442147-65442169 AGGACTTCAATATATGAATTTGG - Intronic
974904964 4:68044371-68044393 TGATTTTCAACATATGAATTTGG - Intergenic
975284670 4:72603399-72603421 CAAATTTCAACATGAGATTTGGG + Intergenic
975318154 4:72978904-72978926 AGAACTTCAACATATGAATTTGG - Intergenic
975447311 4:74480891-74480913 GGAACTGCAACATAAGAATTAGG + Intergenic
975458165 4:74617996-74618018 CTAAATTCGATATTAGAATTTGG - Intergenic
975499486 4:75069176-75069198 AGAATTTCAACACAGGAATTTGG - Intergenic
975687735 4:76934047-76934069 AGCATTTAAATATATGAATTTGG - Intergenic
976489927 4:85658496-85658518 AGAATTTCAGTATAAGAAGCTGG - Intronic
976547024 4:86347854-86347876 AGGACTTCAACATAAGAATTTGG + Intronic
976605872 4:86982450-86982472 AGAATTTCAACATATAAATTTGG - Intronic
976885704 4:89981060-89981082 GGGACTTCAACATAAGAATTTGG - Intergenic
977034110 4:91927495-91927517 AGGATTTCAATATATGAATTTGG + Intergenic
977589128 4:98807278-98807300 AGAATTTCAACATGTGAATTGGG - Intergenic
977589133 4:98807314-98807336 AGAATTTCAACATATGAATGGGG - Intergenic
977605689 4:98983091-98983113 AGAATTTCAACATATGAATTTGG + Intergenic
977697692 4:99985014-99985036 AGAATTTCAACATATGAATTTGG - Intergenic
978514218 4:109554151-109554173 TGAAATTAAATATAAGAAATTGG - Intergenic
978875577 4:113636820-113636842 TGAACTTCAACATATGAATTGGG + Intronic
979071928 4:116219266-116219288 GGGATTTCAACATATGAATTTGG - Intergenic
979484335 4:121253821-121253843 AGGATTTCAATATCTGAATTTGG + Intergenic
979573863 4:122263194-122263216 CGAATGTCAATGTAGGCATTTGG + Intronic
979749207 4:124256059-124256081 CGTATTTCAACATAGGCATTAGG - Intergenic
979975025 4:127185456-127185478 CGAAATTCAATATGAGATTTGGG - Intergenic
980184223 4:129441598-129441620 TGAATTTCAAAATGAAAATTAGG - Intergenic
980201189 4:129658109-129658131 AGAATTTCAAGATGAGATTTGGG + Intergenic
980364441 4:131782075-131782097 AGAATTTTAATATACAAATTTGG - Intergenic
980434207 4:132747947-132747969 TAAATTTCAATATAAGTATTGGG + Intergenic
980559590 4:134455532-134455554 TTTATTTCAATATATGAATTTGG + Intergenic
980805187 4:137803246-137803268 TGAATTTTATTATAATAATTTGG - Intergenic
980906220 4:138951032-138951054 AGGAATTCAATATATGAATTTGG + Intergenic
981157863 4:141461212-141461234 AGAATTTCAACATATGAATTTGG - Intergenic
981272072 4:142856990-142857012 CGCATTTCAACATATGAATTTGG + Intergenic
981330445 4:143502337-143502359 AGAATTTCAATATATGAATTTGG + Intergenic
981450607 4:144893098-144893120 AGATTATCAATATAAAAATTTGG - Intergenic
981773295 4:148335132-148335154 AGGATTTCAATCTATGAATTGGG + Intronic
981865443 4:149412396-149412418 AGAATACAAATATAAGAATTAGG - Intergenic
981917556 4:150051540-150051562 AGAATTTCAACATAAGAGTTTGG - Intergenic
982070162 4:151687599-151687621 CGCGCTTCAATATAGGAATTTGG - Intronic
982113437 4:152076953-152076975 AGGATTTCAATATATGAATCTGG - Intergenic
982424592 4:155243381-155243403 TGGATTTCAATATATGAATTTGG + Intergenic
982924780 4:161321687-161321709 AGGATTTCAACATAAGAATTTGG - Intergenic
982953959 4:161739103-161739125 AGAATTTCAACATATGAATTTGG - Intronic
983267242 4:165521029-165521051 CAAATATCAACATATGAATTTGG - Intergenic
983892941 4:173049537-173049559 AGGATTTCAATATATAAATTTGG + Intergenic
983947023 4:173598002-173598024 AGGATTTCAACATATGAATTTGG - Intergenic
984046302 4:174803639-174803661 CAAATTTCAGCATAAGATTTTGG - Intronic
984215636 4:176910208-176910230 ATGATTTCAATATATGAATTTGG + Intergenic
984428916 4:179623607-179623629 AGGATTTCAATATATGAATTTGG + Intergenic
984537514 4:180995095-180995117 AGGGTTTCAATATAGGAATTTGG + Intergenic
985171716 4:187157344-187157366 CGAATTTCAAAATATCAATGTGG - Intergenic
985934702 5:3088039-3088061 TGGATTTCAACATATGAATTTGG + Intergenic
986064204 5:4219936-4219958 AGGATTTCAATGTAGGAATTTGG + Intergenic
986197776 5:5553769-5553791 AGAATTCCAACATATGAATTTGG - Intergenic
986673935 5:10167526-10167548 AGAATTTCAACTTATGAATTGGG + Intergenic
987717663 5:21593042-21593064 GGAAATTCAAGATAAGATTTGGG + Intergenic
987838804 5:23196603-23196625 AGCATTTCTATATATGAATTTGG - Intergenic
987884060 5:23789714-23789736 AGAATTTCATAATATGAATTTGG + Intergenic
988115029 5:26875850-26875872 CAAATTTCAATAAAAATATTGGG - Intergenic
988515366 5:31899661-31899683 AGGATTTCAACATATGAATTAGG - Intronic
988521729 5:31951475-31951497 TAAGTTTCAACATAAGAATTTGG + Intronic
989428627 5:41326072-41326094 AGGATTTCAACATATGAATTTGG + Intronic
989439747 5:41456595-41456617 CAGATTTCAACATATGAATTTGG - Intronic
989487327 5:42007052-42007074 AGGACTTCAACATAAGAATTTGG - Intergenic
989599745 5:43190429-43190451 AAGATTTCAATATATGAATTGGG - Intronic
989619705 5:43372176-43372198 CTAATTTCAATATGAGTTTTGGG + Intergenic
989978823 5:50617099-50617121 AGGATTTCAATATACAAATTCGG - Intergenic
990336448 5:54777125-54777147 AGGAATTCAATATATGAATTTGG + Intergenic
990661273 5:58018229-58018251 AGGATTTCAACATATGAATTTGG - Intergenic
990827753 5:59921407-59921429 AGAATTTCAACAAAAGAAATGGG + Intronic
990962742 5:61411864-61411886 AGGATTTCAACATATGAATTGGG + Intronic
991148788 5:63341074-63341096 AGAATTTCAATATATGAGTTAGG - Intergenic
991335863 5:65546563-65546585 AGGATTTCAACATAGGAATTTGG - Intronic
992266040 5:75019072-75019094 AGGATTTCAACATACGAATTTGG - Intergenic
992761988 5:79958709-79958731 AGGATTTCAACATAGGAATTTGG - Intergenic
992903406 5:81321432-81321454 AGGATTTCAACATATGAATTTGG + Intergenic
992930245 5:81635939-81635961 TTCATTTCAATATATGAATTTGG - Intronic
993401498 5:87458327-87458349 AGAACTTCAATATATAAATTTGG + Intergenic
993419712 5:87685462-87685484 AGGATTTCAACATATGAATTTGG + Intergenic
993684415 5:90920356-90920378 AGAGTTTCAACATATGAATTCGG + Intronic
993896664 5:93543076-93543098 GGAATTTCAAGCTAAGATTTTGG + Intergenic
994507866 5:100664838-100664860 TACATTTCAATATAAGAATTGGG + Intergenic
994553284 5:101263034-101263056 GGAAATTCAAGATAAGATTTGGG - Intergenic
994951944 5:106474927-106474949 TAAATTACACTATAAGAATTAGG + Intergenic
995411928 5:111867552-111867574 AGTGTTTCAATATATGAATTGGG + Intronic
995602875 5:113817318-113817340 CAAAATTAAAAATAAGAATTGGG - Intergenic
995634180 5:114166736-114166758 GGGATTTCAACATATGAATTTGG - Intergenic
995921706 5:117322200-117322222 TGAATTTCAATATAAGTTTTTGG + Intergenic
996126253 5:119728353-119728375 TAAAATTCAATATAAGATTTGGG - Intergenic
996167278 5:120240435-120240457 TTAATTTCTATATAAGTATTAGG - Intergenic
996379696 5:122850416-122850438 AGAATTTCAGCATGAGAATTTGG + Intronic
997321167 5:132979865-132979887 CAAATTTCAATATGAGGCTTGGG + Intergenic
997778244 5:136630467-136630489 TGAAGTTCATTATATGAATTAGG + Intergenic
998388163 5:141770259-141770281 AGGATTTCAGTATATGAATTTGG + Intergenic
998638543 5:143984020-143984042 AGAGCTTCAATATATGAATTTGG + Intergenic
998739662 5:145186185-145186207 AGAGTTTCAATATGTGAATTTGG + Intergenic
999066047 5:148686590-148686612 AGGATTTCAACATATGAATTAGG - Intergenic
999509316 5:152231582-152231604 CAAATTTTAATGTAAGATTTGGG - Intergenic
999511607 5:152258119-152258141 AGAACTTCAACATATGAATTTGG + Intergenic
999825717 5:155272011-155272033 CAAATTTCATTCTATGAATTTGG + Intergenic
999841846 5:155436311-155436333 AGCATTTCAACATATGAATTTGG - Intergenic
1000211532 5:159110692-159110714 TGGGTTTCAATATATGAATTTGG - Intergenic
1000710357 5:164567747-164567769 AGAATTTCAATATATTAATTTGG - Intergenic
1001285671 5:170421706-170421728 TAGATTTCAATATATGAATTTGG + Intronic
1001508924 5:172303787-172303809 AGAATTTCAACATAAGAATTTGG + Intergenic
1002951994 6:1823178-1823200 GGCATTTAAATATAAAAATTGGG - Intronic
1003317982 6:5028717-5028739 AGGATTTCAACATAGGAATTTGG - Intergenic
1003743419 6:8969643-8969665 AAGATTTCAATATATGAATTTGG + Intergenic
1003836561 6:10077730-10077752 GTAACTTCAATATAAGAATTTGG + Intronic
1003948669 6:11097722-11097744 AGGATTTCAACATATGAATTTGG + Intronic
1004241969 6:13931808-13931830 AGAATTTCAACATATGAATTTGG - Intronic
1004250505 6:14019443-14019465 GGGATTTCAACATACGAATTTGG + Intergenic
1005211968 6:23476424-23476446 AAAATTTAAATATAAGATTTAGG + Intergenic
1005984920 6:30865525-30865547 TACATTTCAATATAAGATTTGGG + Intergenic
1007277087 6:40682371-40682393 TAGATTTCAATATATGAATTTGG + Intergenic
1008150660 6:47947722-47947744 ATAATTTCAATATAAATATTTGG + Intronic
1008779754 6:55089205-55089227 CAAATTTCAATATGAAATTTGGG + Intergenic
1009397598 6:63217925-63217947 AGAATTTCCATATAGAAATTTGG + Intergenic
1009467086 6:63984997-63985019 AGAACTTCAATATATGAATTTGG - Intronic
1009501010 6:64413799-64413821 AGGATTTCAACATATGAATTTGG - Intronic
1009547866 6:65045399-65045421 CAGATTTCAACATAAAAATTCGG - Intronic
1009560299 6:65232771-65232793 AGAACTTCAACATATGAATTTGG + Intronic
1009922975 6:70085881-70085903 TGAATTTCAAAATACAAATTGGG - Intronic
1010041394 6:71389015-71389037 AGAACTGCCATATAAGAATTTGG - Intergenic
1010278350 6:73994784-73994806 AGGATTTCAACATATGAATTTGG + Intergenic
1010292529 6:74154709-74154731 CAATTTTCAAAATATGAATTTGG + Intergenic
1010362639 6:75012641-75012663 AGGATTTCAATATATGAATATGG + Intergenic
1010380343 6:75216826-75216848 GGGATTTCAACATATGAATTTGG + Intergenic
1010533974 6:77002777-77002799 AGAATTTCAACATATAAATTTGG + Intergenic
1010606815 6:77900213-77900235 CTAATTTGGATATATGAATTTGG - Intronic
1011171646 6:84511273-84511295 AGGATTTCAACATATGAATTTGG - Intergenic
1011600602 6:89056594-89056616 AGAATTTCAACGTATGAATTTGG + Intergenic
1011990909 6:93516045-93516067 CCAAATTCAATATAAGAAAAGGG + Intergenic
1012059206 6:94456117-94456139 GGAGCTTCAACATAAGAATTTGG - Intergenic
1012132763 6:95518213-95518235 CAAATTTTAATATAATAACTAGG + Intergenic
1012244910 6:96915163-96915185 TAAATTTCAGTAGAAGAATTTGG - Intergenic
1012347548 6:98209311-98209333 AGACTTTCAGTATATGAATTTGG + Intergenic
1012489980 6:99771710-99771732 AGGACTTCAACATAAGAATTTGG + Intergenic
1012766998 6:103379846-103379868 TGCATTTCAACATAAGATTTGGG + Intergenic
1012786008 6:103626904-103626926 AGGATTTCAATATATGATTTTGG - Intergenic
1013223456 6:108101058-108101080 AGGACTTCAATATATGAATTTGG - Intronic
1013447976 6:110250509-110250531 AGAATTTCAACATATTAATTTGG + Intronic
1013499938 6:110739153-110739175 AGGATTTCAACATACGAATTTGG - Intronic
1013626759 6:111945562-111945584 AGGATTTCAACATATGAATTTGG + Intergenic
1013826928 6:114223830-114223852 TAAATTTCAATATAAATATTTGG + Intronic
1013894132 6:115064667-115064689 CAAATTCCAATATCACAATTAGG - Intergenic
1013916249 6:115340624-115340646 TGGATTTCAAAATATGAATTTGG - Intergenic
1013948649 6:115752922-115752944 TGAGCTTCAATATATGAATTTGG - Intergenic
1014218937 6:118780815-118780837 CAAATTTCAATTTCACAATTTGG + Intergenic
1015116168 6:129651839-129651861 AGGATTTCAGTATATGAATTTGG - Intronic
1015553714 6:134439215-134439237 CGCAATTCAAAATAATAATTTGG - Intergenic
1015776384 6:136818985-136819007 TAAATTTCAACATATGAATTTGG + Intergenic
1015908890 6:138146988-138147010 AGAATTTTAATGTAAGAACTAGG + Intergenic
1016050642 6:139526636-139526658 GGAACTTCAACATATGAATTTGG - Intergenic
1016177808 6:141101343-141101365 AGAATTTCAACATATGAATTTGG - Intergenic
1016225288 6:141727762-141727784 AGGATTTCAACATATGAATTAGG + Intergenic
1016752963 6:147651422-147651444 AGGATTTCAACATATGAATTTGG - Intronic
1016758004 6:147708079-147708101 AGGATTTCAATGTATGAATTTGG - Intronic
1016872869 6:148836439-148836461 TGAATTTCAATAAAGGAATTAGG - Intronic
1017423134 6:154294163-154294185 CAAAGTTGAATAAAAGAATTGGG - Intronic
1017581741 6:155872339-155872361 AGGATTTCCATATATGAATTTGG + Intergenic
1017937061 6:159015081-159015103 AGAACTTCAACATATGAATTTGG - Intergenic
1018240587 6:161770387-161770409 AGAACTTCAATGTATGAATTTGG - Intronic
1018263475 6:161994036-161994058 GAAATTTCAACATAAGATTTGGG + Intronic
1018761813 6:166899866-166899888 AGAATTTCAACACAGGAATTGGG - Intronic
1020160391 7:5766371-5766393 AGAGCTTCAATATAGGAATTTGG - Intronic
1020198331 7:6059423-6059445 CGAATGTCAGTGTAAGAATCAGG + Intergenic
1020412765 7:7911502-7911524 AGGATTTCAACATAAGAATGGGG + Intronic
1020597045 7:10220141-10220163 CTAATTTCAGGATAAGATTTTGG + Intergenic
1020601849 7:10285384-10285406 GGAATTTGAAGATAAGTATTGGG + Intergenic
1021022623 7:15622770-15622792 AGGATTTTAACATAAGAATTTGG - Intronic
1021432227 7:20573059-20573081 AGGACTTCAATATATGAATTTGG + Intergenic
1021882991 7:25111913-25111935 AAAATTTCAATATGAGATTTGGG - Intergenic
1022407218 7:30101626-30101648 AGGATTTCAACATATGAATTTGG + Intronic
1022767593 7:33431431-33431453 TAAGTTTCAATATATGAATTTGG - Intronic
1023062418 7:36341488-36341510 AGGATTTCAAAATAAGAATGTGG - Intronic
1023174801 7:37425392-37425414 AGGATTTCAACATAAGAATTTGG + Intronic
1023240165 7:38135926-38135948 AGGATTTCAATACATGAATTTGG + Intergenic
1024135193 7:46399692-46399714 GGAATTTCAGCATATGAATTTGG - Intergenic
1024507543 7:50175002-50175024 AGGATTTCAATATATGAATTTGG + Intergenic
1024800000 7:53065937-53065959 AGGATTTCAACATAGGAATTCGG - Intergenic
1025288577 7:57690384-57690406 AAAATATCAATTTAAGAATTTGG + Intergenic
1025986535 7:66457829-66457851 AGAATCTCAACATATGAATTTGG + Intergenic
1026003129 7:66578738-66578760 AGAATTTCAACATATGAATTTGG + Intergenic
1026028473 7:66767557-66767579 AGAATTTCAACATATGAATTTGG - Intronic
1026185811 7:68082043-68082065 AGAGTTTCAATATACGAATTTGG - Intergenic
1026639638 7:72113106-72113128 CAAATTTCAACATGAGATTTTGG - Intronic
1027209802 7:76136681-76136703 AGAATTTCAACATATGAATTTGG + Intergenic
1028245902 7:88477040-88477062 AGGATTTCAACATATGAATTTGG - Intergenic
1028505062 7:91561516-91561538 AGAATTTCAACATATAAATTTGG + Intergenic
1028920978 7:96309817-96309839 GGAACTTCAACATATGAATTAGG - Intronic
1029935657 7:104421801-104421823 AGCATTTCAATGTATGAATTTGG - Intronic
1030145512 7:106350089-106350111 AGAATTTCAACATATGAATTTGG - Intergenic
1030195202 7:106846464-106846486 CAGATTTCAACATAAGAATTTGG - Intergenic
1030249487 7:107426688-107426710 AGAATTTCAAAATATGAATTTGG + Intronic
1030751924 7:113239856-113239878 CCAAATTCAATATGAGATTTGGG - Intergenic
1030800524 7:113844779-113844801 AGGACGTCAATATAAGAATTTGG - Intergenic
1031194940 7:118601381-118601403 TGGGTTTCAATATATGAATTTGG - Intergenic
1031297720 7:120024444-120024466 AGGACTTCAACATAAGAATTTGG + Intergenic
1031357753 7:120808819-120808841 AGAATTTCAACATATGCATTTGG - Intronic
1031395086 7:121263926-121263948 AGAATGTCAATGTATGAATTTGG - Intronic
1031448477 7:121884166-121884188 CGATTTTCAATAGAAGTATTTGG + Intronic
1032647480 7:133841288-133841310 AGGATTTCAACATATGAATTTGG + Intronic
1032805704 7:135352197-135352219 AGAAATTCAATATATGAATTAGG + Intergenic
1033625039 7:143102017-143102039 TAAATTTCAAAATATGAATTTGG + Intergenic
1034006834 7:147482417-147482439 CAATTTTCAAAATAAGAATCAGG + Intronic
1034511229 7:151536638-151536660 GCAATTTCAACATATGAATTTGG - Intergenic
1034876457 7:154728962-154728984 TGGGTTTCAATATATGAATTTGG + Intronic
1035526274 8:315672-315694 AGGACTTCAACATAAGAATTTGG + Intergenic
1036121917 8:6027549-6027571 AGAACTTCAATCCAAGAATTTGG + Intergenic
1036277210 8:7364966-7364988 CGAATATCAAAATAAGATTTGGG + Intronic
1036344119 8:7945378-7945400 CGAATATCAAAATAAGATTTGGG - Intronic
1036638791 8:10569352-10569374 CGATTTTAAAAATAAGTATTGGG + Intergenic
1036839461 8:12106147-12106169 CGAATATCAAAATAAGATTTGGG - Intronic
1036861250 8:12352389-12352411 CGAATATCAAAATAAGATTTGGG - Intergenic
1036982133 8:13481707-13481729 AACATTTCAACATAAGAATTGGG - Intronic
1037692578 8:21194608-21194630 AGGATTTCAACATATGAATTTGG + Intergenic
1037760170 8:21736849-21736871 TGAATTTCATTTTGAGAATTAGG + Intronic
1037900932 8:22689322-22689344 AGAATTTAAATATAAGTATATGG - Exonic
1038168431 8:25106935-25106957 AGGGTTTCAACATAAGAATTTGG + Intergenic
1038340972 8:26684632-26684654 AGGGCTTCAATATAAGAATTTGG - Intergenic
1038361803 8:26886983-26887005 AGAATTTCAACATGCGAATTTGG + Intergenic
1038491865 8:27977247-27977269 AGGATTTCAACATAGGAATTTGG + Intronic
1039192197 8:34988765-34988787 GGAAGTTCAACATATGAATTTGG + Intergenic
1039211514 8:35220555-35220577 AGAATTTCAACATATGAATTTGG - Intergenic
1039234751 8:35489345-35489367 AGAACTTCAACATATGAATTTGG - Intronic
1039487524 8:37922778-37922800 AGAACTTCAACATATGAATTTGG - Intergenic
1039653174 8:39366323-39366345 CCAATTTCCATCTAAGAATTTGG - Intergenic
1039930720 8:41985769-41985791 GGAAGTTAAGTATAAGAATTAGG - Intronic
1040399778 8:47037871-47037893 CGGATTTTAAGGTAAGAATTTGG - Intergenic
1040716193 8:50255821-50255843 AGAAGTTCAACATAAGAATTTGG + Intronic
1040857390 8:51961987-51962009 AGAATTTCAACATATGAATTTGG + Intergenic
1040885447 8:52258267-52258289 TGAATTTCTATATAAAACTTAGG + Intronic
1040939030 8:52813826-52813848 AGGATTTCAACATATGAATTTGG - Intergenic
1041070067 8:54119703-54119725 AGGATTTCAACATATGAATTTGG - Intergenic
1041102797 8:54413500-54413522 AGAAATTAAATATAACAATTGGG - Intergenic
1041407682 8:57518091-57518113 AGAATTTCAACATATGAATTTGG + Intergenic
1041420285 8:57660377-57660399 AGGATTTCAACATATGAATTTGG + Intergenic
1041776655 8:61529961-61529983 CAAATTTCAATAGATGAATGTGG + Intronic
1042937101 8:74070400-74070422 CAATTTTCAAAACAAGAATTTGG + Intergenic
1043337845 8:79199116-79199138 TGAATTTCAACATATGAATCTGG + Intergenic
1043629196 8:82307692-82307714 TGTATTTCAATATAAAAATATGG + Intergenic
1044152136 8:88794176-88794198 TAAATTTCAACATATGAATTTGG - Intergenic
1046481387 8:114822736-114822758 TGCATTTCAATATGAGATTTTGG + Intergenic
1046848570 8:118947030-118947052 CAAATATCAATATATGAATCTGG + Intronic
1047017395 8:120737996-120738018 AGGATTTCAATATGTGAATTTGG - Intronic
1047202180 8:122776355-122776377 AGGATTTCAACATATGAATTGGG + Intergenic
1047603121 8:126447296-126447318 GGGACTTCAATATATGAATTTGG - Intergenic
1048038040 8:130696212-130696234 CACATTTCAATATGAGATTTGGG - Intergenic
1048241190 8:132743091-132743113 GGAATTTCAAGATGAGATTTGGG + Intronic
1048349157 8:133602015-133602037 AGGATTTCAACATAAGAATTTGG + Intergenic
1048651008 8:136477648-136477670 AGGATTTCAACATATGAATTTGG - Intergenic
1048700244 8:137080205-137080227 TAAGTTTCAATATATGAATTTGG + Intergenic
1048870117 8:138790378-138790400 AGGATTTCAACATATGAATTTGG + Intronic
1050389791 9:5129447-5129469 ATAATTTCAGTACAAGAATTAGG - Intergenic
1050759704 9:9052295-9052317 GGAATTTCAATATATGAATTTGG + Intronic
1051062168 9:13057058-13057080 AGAATTTCAATGTACAAATTTGG + Intergenic
1051234330 9:14982572-14982594 CAAATTTCAACATAAGTTTTGGG + Intergenic
1052100315 9:24438107-24438129 AGCATTTCAACATATGAATTTGG + Intergenic
1052231340 9:26157869-26157891 TGCATTTCAATATGAGATTTGGG - Intergenic
1052397893 9:27963084-27963106 CAAATGTCAAAATCAGAATTTGG - Intronic
1053552581 9:39099759-39099781 CTAAATTCAATAGAGGAATTTGG + Intronic
1053628793 9:39907967-39907989 AGAATTTTAATATACAAATTTGG - Intergenic
1053777274 9:41558377-41558399 AGAATTTTAATATACAAATTTGG + Intergenic
1053816698 9:41919918-41919940 CTAAATTCAATAGAGGAATTTGG + Intronic
1054106960 9:61063600-61063622 CTAAATTCAATAGAGGAATTTGG + Intergenic
1054215094 9:62342735-62342757 AGAATTTTAATATACAAATTTGG + Intergenic
1054364459 9:64320109-64320131 AGAATTTTAATATACAAATTTGG - Intergenic
1054613897 9:67267525-67267547 CTAAATTCAATAGAGGAATTTGG - Intergenic
1054672387 9:67812614-67812636 AGAATTTTAATATACAAATTTGG - Intergenic
1054929567 9:70621994-70622016 AGAATATCAACATATGAATTTGG - Intronic
1054949889 9:70838270-70838292 TGAATTTCAACATATAAATTTGG - Intronic
1056085795 9:83148287-83148309 AGAACTTCAAAATATGAATTTGG - Intergenic
1056219309 9:84435632-84435654 AGGATTTCAACATAGGAATTTGG + Intergenic
1056222931 9:84467897-84467919 AGGATTTCAACATATGAATTTGG - Intergenic
1056335297 9:85562833-85562855 AGGATTTCAACATATGAATTGGG - Intronic
1056526955 9:87452354-87452376 AGGATTTCAACATATGAATTTGG - Intergenic
1058032252 9:100213181-100213203 AGAATTTCAACACATGAATTGGG + Intronic
1058783257 9:108360826-108360848 GGAATTTCAACCTATGAATTTGG - Intergenic
1059564723 9:115372292-115372314 AGAATTTCAACATATGAATTTGG + Intronic
1059814643 9:117899077-117899099 CCAAATTCCATATAAGAAATGGG - Intergenic
1061555788 9:131368039-131368061 AGGATTTCAACATATGAATTTGG - Intergenic
1185839049 X:3371674-3371696 AGGATTTCAGTATATGAATTTGG - Intergenic
1185917097 X:4047612-4047634 GGCATTTCAACATATGAATTTGG - Intergenic
1185940627 X:4315105-4315127 AGAGTTTCAACATAGGAATTTGG + Intergenic
1185948280 X:4402007-4402029 AGGATTTCAACATATGAATTTGG - Intergenic
1186103123 X:6177801-6177823 ACAATTTCAACATAGGAATTTGG - Intronic
1186172874 X:6896032-6896054 AGGATTTCAATATAGGAACTTGG + Intergenic
1186208393 X:7224419-7224441 AGAATTAAAATATATGAATTTGG - Intronic
1186416120 X:9384440-9384462 AGAGTTTCAACATATGAATTTGG + Intergenic
1186449551 X:9660864-9660886 AGGATTTCAACATAGGAATTCGG - Intronic
1186689023 X:11955247-11955269 AGGATTTCAACATATGAATTTGG + Intergenic
1186804074 X:13122217-13122239 AGGATTTCAATATGTGAATTTGG - Intergenic
1187053165 X:15714335-15714357 GGAACTTCAACATATGAATTTGG + Intronic
1187178150 X:16915642-16915664 AGGATTTCAAGATAGGAATTTGG - Intergenic
1187892436 X:23948772-23948794 AGAATTTCAACATATGAATTGGG + Intergenic
1187954682 X:24505621-24505643 CTAATTTTATGATAAGAATTTGG - Intronic
1188317496 X:28692272-28692294 CAAATTTAAATATGAGATTTAGG + Intronic
1188393753 X:29654833-29654855 CGAATTTTTTTATAAGATTTGGG + Intronic
1188475399 X:30586562-30586584 CAAATTTCAACATAAGGTTTGGG + Intergenic
1188512693 X:30953758-30953780 AAAATTTCAACATATGAATTTGG - Intronic
1188803356 X:34558596-34558618 CAAATTTCAATATGAGCTTTGGG - Intergenic
1189255192 X:39632590-39632612 TGAGTTTCAACATATGAATTTGG + Intergenic
1189337779 X:40181008-40181030 AGGATTTCAACATACGAATTTGG + Intergenic
1189950496 X:46225488-46225510 GGAACTTCAATATATGAATTTGG - Intergenic
1190381973 X:49847825-49847847 AGGATTTCAACATATGAATTTGG + Intergenic
1191044156 X:56118109-56118131 AGGATTTCAACATAAGAATGAGG + Intergenic
1191727333 X:64294858-64294880 AGGATTTCAACATATGAATTTGG + Intronic
1191749945 X:64531562-64531584 GGGATTTCAATATATGAATTTGG - Intergenic
1192004944 X:67200271-67200293 AAAATTTCAACATATGAATTTGG + Intergenic
1192028782 X:67486654-67486676 CAAATTTCAAAATAATAAATGGG + Intergenic
1192918475 X:75680504-75680526 AGAATTTCAATGTCTGAATTTGG - Intergenic
1193460669 X:81787689-81787711 GGAAATTCAATGTAAGATTTGGG + Intergenic
1193563626 X:83050555-83050577 CAAATTTCAATATAATTTTTTGG - Intergenic
1193724449 X:85022832-85022854 CAAATTTCAATATGAGGTTTGGG - Intronic
1194197897 X:90918147-90918169 AGAGTTTCAACATATGAATTTGG + Intergenic
1194389873 X:93303134-93303156 GGAATTTCAACATATGAACTTGG + Intergenic
1194484378 X:94470077-94470099 GGGAATTCAATATAAGATTTTGG - Intergenic
1194543925 X:95208093-95208115 TGCATTTCAATATGAGATTTGGG + Intergenic
1194827738 X:98583352-98583374 ACAATTTCAACATAAGAATTTGG - Intergenic
1195164196 X:102202149-102202171 AGAATTTCAACATATAAATTTGG - Intergenic
1195194664 X:102484946-102484968 AGAATTTCAACATATAAATTTGG + Intergenic
1195588749 X:106599493-106599515 AGGATTTCAATATATGAATTTGG + Intergenic
1196327287 X:114421664-114421686 AGGATTTTAATATATGAATTTGG + Intergenic
1196541338 X:116912095-116912117 CACATTTCAATATGAGATTTGGG - Intergenic
1196758246 X:119176923-119176945 AGAATTTCAAAATAAGGATCAGG - Intergenic
1197005691 X:121494120-121494142 TGCATTTCCATATAAAAATTTGG + Intergenic
1197059873 X:122164742-122164764 TGCATTTCAATATGAGATTTGGG + Intergenic
1197121803 X:122901990-122902012 AGGATTTCAACATATGAATTTGG + Intergenic
1197606168 X:128588045-128588067 AGGATTTCAACATATGAATTTGG - Intergenic
1197610954 X:128637577-128637599 AGAATTTCAGCATATGAATTTGG + Intergenic
1197711698 X:129676183-129676205 AGGATTTCAACATATGAATTTGG + Intergenic
1198144693 X:133843209-133843231 AGAATTTCAACATGAGATTTGGG - Intronic
1198317155 X:135479571-135479593 TAGATTTCAATATATGAATTTGG - Intergenic
1198463237 X:136882794-136882816 AGGATTTCAACATATGAATTTGG - Intergenic
1198573992 X:137989975-137989997 AGGATTTCAAAATATGAATTGGG + Intergenic
1199522522 X:148752139-148752161 AGGATTTCAACATATGAATTTGG + Intronic
1199583269 X:149382429-149382451 TAATTTTTAATATAAGAATTGGG - Intergenic
1199754853 X:150854488-150854510 AGGATTTCAATGTATGAATTGGG - Intronic
1200320332 X:155181777-155181799 AGGATTTCAACATATGAATTTGG + Intergenic
1200543841 Y:4494675-4494697 AGAGTTTCAACATATGAATTTGG - Intergenic
1201068017 Y:10117741-10117763 TATATTTCAATATAAGATTTTGG - Intergenic
1201446660 Y:14064464-14064486 AGGATTTCAACATAGGAATTTGG - Intergenic
1201760315 Y:17530011-17530033 TACATTTCAATATAAGATTTTGG + Intergenic
1201841239 Y:18375979-18376001 TACATTTCAATATAAGATTTTGG - Intergenic