ID: 1169757569

View in Genome Browser
Species Human (GRCh38)
Location 20:9059693-9059715
Sequence AGACAAACAACTAACAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169757569_1169757571 26 Left 1169757569 20:9059693-9059715 CCTTTGCTGTTAGTTGTTTGTCT No data
Right 1169757571 20:9059742-9059764 CTATATATATAAGGTAAACCTGG No data
1169757569_1169757570 17 Left 1169757569 20:9059693-9059715 CCTTTGCTGTTAGTTGTTTGTCT No data
Right 1169757570 20:9059733-9059755 TATAAAACACTATATATATAAGG No data
1169757569_1169757573 30 Left 1169757569 20:9059693-9059715 CCTTTGCTGTTAGTTGTTTGTCT No data
Right 1169757573 20:9059746-9059768 ATATATAAGGTAAACCTGGTGGG No data
1169757569_1169757572 29 Left 1169757569 20:9059693-9059715 CCTTTGCTGTTAGTTGTTTGTCT No data
Right 1169757572 20:9059745-9059767 TATATATAAGGTAAACCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169757569 Original CRISPR AGACAAACAACTAACAGCAA AGG (reversed) Intergenic
No off target data available for this crispr