ID: 1169757573

View in Genome Browser
Species Human (GRCh38)
Location 20:9059746-9059768
Sequence ATATATAAGGTAAACCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169757569_1169757573 30 Left 1169757569 20:9059693-9059715 CCTTTGCTGTTAGTTGTTTGTCT No data
Right 1169757573 20:9059746-9059768 ATATATAAGGTAAACCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169757573 Original CRISPR ATATATAAGGTAAACCTGGT GGG Intergenic
No off target data available for this crispr