ID: 1169757945

View in Genome Browser
Species Human (GRCh38)
Location 20:9063659-9063681
Sequence ATTCCAGAAGGACCTTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169757933_1169757945 27 Left 1169757933 20:9063609-9063631 CCATGAAGAGAACTGTGGAGCCT No data
Right 1169757945 20:9063659-9063681 ATTCCAGAAGGACCTTCCAAGGG No data
1169757932_1169757945 30 Left 1169757932 20:9063606-9063628 CCACCATGAAGAGAACTGTGGAG No data
Right 1169757945 20:9063659-9063681 ATTCCAGAAGGACCTTCCAAGGG No data
1169757937_1169757945 7 Left 1169757937 20:9063629-9063651 CCTGGGAAAAAAGGAGAACCTGG No data
Right 1169757945 20:9063659-9063681 ATTCCAGAAGGACCTTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169757945 Original CRISPR ATTCCAGAAGGACCTTCCAA GGG Intergenic
No off target data available for this crispr