ID: 1169759220

View in Genome Browser
Species Human (GRCh38)
Location 20:9073308-9073330
Sequence CTCCTGTTCTAGAGAAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 325}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169759220_1169759224 -2 Left 1169759220 20:9073308-9073330 CCCTTTCTTCTCTAGAACAGGAG 0: 1
1: 0
2: 2
3: 37
4: 325
Right 1169759224 20:9073329-9073351 AGTTCTTCATTTTAGGGCCAAGG 0: 1
1: 0
2: 1
3: 26
4: 465
1169759220_1169759225 9 Left 1169759220 20:9073308-9073330 CCCTTTCTTCTCTAGAACAGGAG 0: 1
1: 0
2: 2
3: 37
4: 325
Right 1169759225 20:9073340-9073362 TTAGGGCCAAGGATGCAGTTTGG 0: 1
1: 0
2: 0
3: 14
4: 138
1169759220_1169759226 12 Left 1169759220 20:9073308-9073330 CCCTTTCTTCTCTAGAACAGGAG 0: 1
1: 0
2: 2
3: 37
4: 325
Right 1169759226 20:9073343-9073365 GGGCCAAGGATGCAGTTTGGTGG 0: 1
1: 0
2: 2
3: 24
4: 188
1169759220_1169759229 26 Left 1169759220 20:9073308-9073330 CCCTTTCTTCTCTAGAACAGGAG 0: 1
1: 0
2: 2
3: 37
4: 325
Right 1169759229 20:9073357-9073379 GTTTGGTGGGTCCACGAATGTGG 0: 1
1: 0
2: 1
3: 3
4: 59
1169759220_1169759222 -9 Left 1169759220 20:9073308-9073330 CCCTTTCTTCTCTAGAACAGGAG 0: 1
1: 0
2: 2
3: 37
4: 325
Right 1169759222 20:9073322-9073344 GAACAGGAGTTCTTCATTTTAGG 0: 1
1: 0
2: 1
3: 25
4: 205
1169759220_1169759227 13 Left 1169759220 20:9073308-9073330 CCCTTTCTTCTCTAGAACAGGAG 0: 1
1: 0
2: 2
3: 37
4: 325
Right 1169759227 20:9073344-9073366 GGCCAAGGATGCAGTTTGGTGGG 0: 1
1: 0
2: 2
3: 10
4: 161
1169759220_1169759230 30 Left 1169759220 20:9073308-9073330 CCCTTTCTTCTCTAGAACAGGAG 0: 1
1: 0
2: 2
3: 37
4: 325
Right 1169759230 20:9073361-9073383 GGTGGGTCCACGAATGTGGCTGG 0: 1
1: 0
2: 1
3: 4
4: 95
1169759220_1169759223 -8 Left 1169759220 20:9073308-9073330 CCCTTTCTTCTCTAGAACAGGAG 0: 1
1: 0
2: 2
3: 37
4: 325
Right 1169759223 20:9073323-9073345 AACAGGAGTTCTTCATTTTAGGG 0: 1
1: 0
2: 5
3: 40
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169759220 Original CRISPR CTCCTGTTCTAGAGAAGAAA GGG (reversed) Intronic
902700933 1:18171385-18171407 TTCCTGTTCCAGAGCAGAGAGGG - Intronic
902760083 1:18575380-18575402 CTCCTTTTCATGAGCAGAAAGGG - Intergenic
903292398 1:22322792-22322814 CTCCTGAGCTACAGAAGGAATGG + Intergenic
905789300 1:40782029-40782051 CTCTTGTTCTGTAGCAGAAATGG - Intergenic
907331358 1:53673723-53673745 TTCTTGTTCTAGAGAAAAATAGG - Intronic
907757145 1:57321683-57321705 CTCCCATTTTATAGAAGAAATGG - Intronic
908530145 1:65026518-65026540 TTCCTGTTCTAGAGGAGGAAGGG - Intergenic
909019838 1:70418622-70418644 ATTCTGCTCTAGAGAAGATAAGG + Intronic
909496136 1:76280789-76280811 CTCATTTTATAGAAAAGAAAAGG - Intronic
910523829 1:88154693-88154715 GTTTTATTCTAGAGAAGAAAAGG - Intergenic
911487164 1:98516356-98516378 CTCCTGCTCGAGAAAAGAAAAGG + Intergenic
912372196 1:109182461-109182483 TTCCTGTTCTACAGATGAGAAGG + Intronic
912583918 1:110744564-110744586 CTCCTTTTGGAGAGAAGCAAGGG + Intergenic
913541496 1:119825463-119825485 CTTATCTTCTAGAGAAGAACTGG - Intergenic
913648876 1:120890351-120890373 CTCCTGAGCTACAGAAGGAATGG - Intergenic
914077815 1:144373032-144373054 CTCCTGAGCTACAGAAGGAATGG + Exonic
914101364 1:144593473-144593495 CTCCTGAGCTACAGAAGGAATGG - Exonic
914172724 1:145241572-145241594 CTCCTGAGCTACAGAAGGAATGG + Intergenic
914527381 1:148482700-148482722 CTCCTGAGCTACAGAAGGAATGG + Exonic
914639013 1:149584428-149584450 CTCCTGAGCTACAGAAGGAATGG - Exonic
916980988 1:170136706-170136728 CTCTTGTTCAAGTAAAGAAAAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
919023547 1:192139338-192139360 CTTCTGTTCTACAAAAGAATAGG - Intergenic
919653743 1:200177878-200177900 CTCCTGGTCTAGAGACAGAATGG - Intergenic
922024223 1:221736006-221736028 CTCATCTTCTAAAGAATAAATGG - Intronic
923135820 1:231117774-231117796 CTCCTGAGCTACAGAAGGAATGG + Intergenic
1062806233 10:421853-421875 CTCCTGTTCCAGACAGAAAACGG + Intronic
1063948391 10:11199763-11199785 CTGCTGCTTTAGAGAAGCAATGG - Intronic
1064108061 10:12517929-12517951 CTTCTGTTTTCTAGAAGAAATGG + Intronic
1064521345 10:16205719-16205741 CTTCTGTACTACAGAACAAATGG - Intergenic
1064644079 10:17442930-17442952 CTGCTGTTCTAGATTATAAATGG + Intronic
1065368948 10:24963127-24963149 CACCTTTTCCAGAGAATAAAGGG + Intergenic
1065486010 10:26237162-26237184 CCCTTGTTCTGGGGAAGAAAGGG + Intronic
1066071806 10:31823341-31823363 TATCTGTCCTAGAGAAGAAAAGG + Intronic
1066110119 10:32188266-32188288 CTCCTGAACTACAGAAGGAATGG + Intergenic
1067518652 10:46977659-46977681 CTCCTAATGTAGAGAAGGAAAGG + Intronic
1067643596 10:48074175-48074197 CTCCTAATGTAGAGAAGGAAAGG - Intergenic
1067901722 10:50248607-50248629 CTGCTGTACCTGAGAAGAAATGG - Exonic
1068836116 10:61555919-61555941 TTCCTTCTCTACAGAAGAAAGGG - Intergenic
1069087455 10:64157867-64157889 CTCATGAGCTACAGAAGAAATGG + Intergenic
1069246921 10:66218197-66218219 CTACTGTTCTAGAAAAAAACAGG - Intronic
1070092900 10:73306245-73306267 CCCCCTTTCTAGAGAAGAAAGGG + Intronic
1070277863 10:75024962-75024984 CTTTTGTACTAAAGAAGAAAAGG + Exonic
1070953249 10:80447534-80447556 CTCCTGTTTTAAAGAAAGAAGGG - Intergenic
1071721562 10:88151826-88151848 CTCCTGTAGTAGAGAGGAACTGG - Intergenic
1072338635 10:94423817-94423839 CTACTGTTTCAGAGAAGGAATGG + Intronic
1073140189 10:101242177-101242199 CACCTGTATTAGAGAATAAAAGG - Intergenic
1073520507 10:104124270-104124292 CTCCAGATTTAGAGTAGAAAAGG + Intronic
1073665553 10:105529314-105529336 CTCCTATTAAAGAGAAAAAATGG + Intergenic
1073712289 10:106057355-106057377 TTCCAGTTCTGGGGAAGAAAGGG - Intergenic
1073841087 10:107500032-107500054 CTCCCTTTCTTGAGAAGAAAGGG + Intergenic
1074032451 10:109702362-109702384 CTCTTATTCTAGGGAAGAGATGG - Intergenic
1074109192 10:110410578-110410600 CTCCTGCTCTAGGAAGGAAAAGG - Intergenic
1074183377 10:111082007-111082029 CTCCTGCACGAGAGAAGCAAAGG - Intergenic
1074541278 10:114367181-114367203 CTCCTGTTACACAGAAGAGATGG - Intronic
1074893882 10:117758018-117758040 CTCCTTCTCTGGGGAAGAAAAGG - Intergenic
1075594636 10:123720084-123720106 ATCATTTTCTAAAGAAGAAATGG - Intronic
1076374467 10:129973817-129973839 CTGCTGCTCTGGAAAAGAAAAGG + Intergenic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1077642250 11:3892335-3892357 CTCCTGACCTACAGAAGGAATGG + Intronic
1077663595 11:4089953-4089975 CTCCTGCTCTACAGACAAAAAGG - Intronic
1079830326 11:25258322-25258344 ATGCTGTTCAAGTGAAGAAATGG + Intergenic
1080147648 11:29006559-29006581 ATCATCTGCTAGAGAAGAAAAGG + Intergenic
1085714586 11:78861320-78861342 CTCCTTTTGAAGAGGAGAAAAGG + Intronic
1087064098 11:94011349-94011371 CCCCTGATCTAGATAAGAAATGG + Intergenic
1087632500 11:100666997-100667019 CTCCTGAGATACAGAAGAAATGG - Intergenic
1087726811 11:101727995-101728017 CTGCTGTTTCAGAGAAGAACTGG + Intronic
1088057447 11:105602506-105602528 CTCAGGTGCTAGAAAAGAAATGG + Intergenic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089625147 11:119746323-119746345 CTCCTGTTCTTTAGAAGAAAGGG + Intergenic
1090516847 11:127437859-127437881 CTCCTCTGATACAGAAGAAAAGG - Intergenic
1090833341 11:130435679-130435701 CTCCTGTTCATGAGAACAGAAGG - Intergenic
1091107195 11:132933956-132933978 CTCCTGTGATGGAGAAAAAAAGG - Intronic
1092008120 12:5086754-5086776 CTTCTGTTCTACGGAAGAAGGGG + Intergenic
1092022361 12:5213042-5213064 GTCCTGTTCTGTAGAAGAAGGGG + Intergenic
1092415256 12:8286047-8286069 CACTTATTCTAAAGAAGAAAAGG - Intergenic
1094820840 12:34222998-34223020 CTTCTGTTTGAGAAAAGAAATGG + Intergenic
1095194148 12:39292902-39292924 CTTGTTTTCTAGAGAAGAGAAGG - Intergenic
1095561717 12:43573886-43573908 CTCCAGTGATAGAGAACAAAGGG + Intergenic
1096269034 12:50149025-50149047 CTACTGTTTTAGAAAAAAAATGG - Intronic
1097214504 12:57399825-57399847 CTCCTATTTTAGAGAAGAGTAGG - Intronic
1098480678 12:70956022-70956044 ATCCTATTCCAGAGAAAAAATGG - Intergenic
1099331853 12:81299046-81299068 CTCTTGCTCTAGAAATGAAAAGG + Intronic
1100838652 12:98590666-98590688 CTCCTGAGCTACAGAAGGAATGG + Intergenic
1100903643 12:99272761-99272783 CAAATGGTCTAGAGAAGAAAGGG - Intronic
1103250993 12:119499931-119499953 CTCCTCTACTTGTGAAGAAATGG - Intronic
1104321221 12:127753057-127753079 AGCCTGCTCCAGAGAAGAAAAGG + Intergenic
1104489354 12:129180769-129180791 CTCCTGATGAAGAGAAGACAAGG - Intronic
1106179583 13:27359227-27359249 CTCATGCTCTTGAAAAGAAAAGG + Intergenic
1106889511 13:34228230-34228252 CTCCTGTTCCTGAGAGGAATCGG + Intergenic
1107947944 13:45436671-45436693 CTCCTGAGCTATAGAAGGAATGG - Intergenic
1108069304 13:46611355-46611377 CTGCTGTTCTCCAGAAGAAGTGG - Intronic
1108686252 13:52821354-52821376 CTCCTGAGCTACAGAAGGAATGG - Intergenic
1108697141 13:52912538-52912560 CTGCTGCTCTAGAGAAATAAGGG - Intergenic
1109078983 13:57874013-57874035 ATCCTGGTTTAGAGAAGCAAGGG - Intergenic
1109844401 13:67967599-67967621 TTTCTTTTCTAGAGAAGAAAAGG + Intergenic
1111666192 13:91272027-91272049 CTCCTGAGCTACAGAAGGAATGG + Intergenic
1111968189 13:94882216-94882238 GTCATGTTCTAAAGGAGAAAAGG - Intergenic
1112956439 13:105064644-105064666 CTCTTGTTTTGGGGAAGAAACGG + Intergenic
1112956568 13:105066326-105066348 CCCTTGTTTTGGAGAAGAAAAGG - Intergenic
1113860208 13:113478086-113478108 ATCCTCTTCCAGAGAAGTAAAGG - Intronic
1114347894 14:21816180-21816202 CTCCCCTTCTGTAGAAGAAATGG - Intergenic
1114479710 14:23025161-23025183 CTTCTGTTAAAGAGAAGACAGGG - Intronic
1114683856 14:24509133-24509155 CTCTAGTGCTAGAGCAGAAAGGG - Intergenic
1114849841 14:26370686-26370708 CTCTTTTTCTAGAGATAAAAGGG - Intergenic
1115126051 14:29995222-29995244 CTCTTATACTAGAGTAGAAATGG - Intronic
1116871457 14:50072603-50072625 CTCCTGTGGCAGAGAAGAATCGG - Intergenic
1117476220 14:56097742-56097764 CTCCAATTCTAGAAAAGTAATGG + Intergenic
1117623382 14:57610713-57610735 ATCCTCCTGTAGAGAAGAAAGGG + Intronic
1118290483 14:64516950-64516972 CTGCTCATCTAGATAAGAAAGGG + Intronic
1119214221 14:72856284-72856306 CTCCTGTTTTAGAGGAGAAAAGG - Intronic
1119349603 14:73953041-73953063 CTCCTGTTCAAAAGAAAAAGTGG - Intronic
1119697334 14:76723722-76723744 CTCCTGTTTTTAGGAAGAAAAGG - Intergenic
1120834530 14:89027727-89027749 CTCCTGTCCGTAAGAAGAAAGGG + Intergenic
1122879130 14:104682166-104682188 CTGCTATTCTACAGGAGAAAGGG + Intergenic
1124015690 15:25872806-25872828 CTCCTCTTCTGGAGAAGGGATGG - Intergenic
1124717912 15:32083896-32083918 CTCCTTTTCAGAAGAAGAAAAGG + Intronic
1126861242 15:52885013-52885035 CTCCTGATTTCCAGAAGAAAGGG + Intergenic
1127389750 15:58495978-58496000 CTTCTTTTCCAGATAAGAAAAGG + Intronic
1128231388 15:66037854-66037876 CTCCTCTTCCAGAGAAGAAGTGG - Intronic
1128898819 15:71400288-71400310 TTCCTGTTCTGAAAAAGAAAAGG - Intronic
1133263156 16:4565358-4565380 CTCCTGTCCTGGGGAAGAAGGGG - Intronic
1133456836 16:5949683-5949705 CTGCTGTTCTACAAAACAAATGG - Intergenic
1135807143 16:25552991-25553013 GTCCTGTTCCAGAGAAGTAGTGG - Intergenic
1136121135 16:28135387-28135409 CTCCTGCACTATAAAAGAAATGG + Intronic
1136525632 16:30828145-30828167 ATCCTGTGCTAGAGGAGAAATGG + Intergenic
1136920420 16:34266355-34266377 TCCCAGTTCTCGAGAAGAAAAGG - Intergenic
1137377558 16:47966083-47966105 ATCCTATTTTACAGAAGAAATGG + Intergenic
1137861958 16:51855815-51855837 CACCTGTTCTAGATAACAAGTGG + Intergenic
1138025350 16:53517947-53517969 CTCCAATTCTGCAGAAGAAATGG + Intergenic
1141137462 16:81475655-81475677 CTCCTGAGCTACAGAAGGAACGG + Intronic
1141240607 16:82261966-82261988 CTTCTGTGCTAGAGAAGAGAGGG + Intergenic
1141608160 16:85167317-85167339 CACCTGCTCTAGAGAGGAAAGGG + Intergenic
1143932314 17:10442061-10442083 CTCCTTTTCTGGAGCAAAAATGG + Intergenic
1144166085 17:12612095-12612117 CTACAGTTCTAGATGAGAAAGGG - Intergenic
1144885956 17:18461898-18461920 CTCCTCTTCTAGGGTAGCAAAGG - Intergenic
1145376265 17:22351803-22351825 GGCCTGTTACAGAGAAGAAAAGG - Intergenic
1146080401 17:29774897-29774919 CTCCTGAGCTACAGAAGGAATGG - Intronic
1146603594 17:34239003-34239025 CTGGTTTTCTAGAGAACAAAGGG - Intergenic
1147430637 17:40368476-40368498 CTCCTGAGCTACAGAAGGAATGG - Intergenic
1148407288 17:47427368-47427390 CTGATATTCTAAAGAAGAAAAGG - Intronic
1148759447 17:49991862-49991884 CACCTGGGCCAGAGAAGAAAGGG + Exonic
1149647519 17:58250855-58250877 CTCCTGCTCTCAAGAACAAAGGG + Intronic
1149971889 17:61227150-61227172 CTCCATTCCTAGACAAGAAAAGG - Intronic
1152180528 17:78818178-78818200 CACCTGTTCTAGACATCAAAAGG + Intronic
1152423884 17:80208639-80208661 CTCCGGTTCTAGGGAAGGCATGG - Exonic
1152501946 17:80717985-80718007 CTCCTTTTGCAAAGAAGAAAAGG - Intronic
1155560303 18:27068912-27068934 TTCATGTCCTAGAAAAGAAAAGG - Intronic
1157124487 18:44943172-44943194 CTCCTGTTCATGAGCATAAATGG + Intronic
1158056628 18:53288237-53288259 TTCATGTTCTAGAAATGAAAAGG - Intronic
1159077521 18:63698689-63698711 CTGCTGTTATAGGTAAGAAATGG - Intronic
1159139673 18:64378337-64378359 GTACAGTTCTAGAGAAGAGATGG + Intergenic
1159864026 18:73683369-73683391 CCCCTGATCCAGAGAAGAAAGGG - Intergenic
1160550227 18:79690143-79690165 CTCCTGATCTGTAGAAGGAAGGG + Intronic
1162459978 19:10809155-10809177 CTCCTGTTCTATAGCAGATGTGG + Intronic
1162633185 19:11945003-11945025 CACTTATTCTAAAGAAGAAAAGG - Intronic
1164655953 19:29922004-29922026 CTCCGGAGCTAGAGAAGGAATGG - Intergenic
1165674265 19:37707767-37707789 CTTCTGATGTGGAGAAGAAATGG - Intronic
1165681797 19:37783190-37783212 GGCCTGTTACAGAGAAGAAAAGG + Intronic
1167487852 19:49773605-49773627 CTCACGTTCTAGAGAGGAGATGG + Intronic
1168297062 19:55382561-55382583 CTCCTGGTGTAGAGAAGAGCAGG + Intronic
925725526 2:6867096-6867118 GTACTGTCTTAGAGAAGAAAAGG - Intronic
927862447 2:26568533-26568555 CTCCTTCTCTCCAGAAGAAAGGG + Intronic
928284680 2:29979528-29979550 TTCAAGTTCTGGAGAAGAAAAGG - Intergenic
930934903 2:56936988-56937010 TTCAGGTTATAGAGAAGAAAGGG - Intergenic
931397325 2:61899197-61899219 CTCCTGCTTTAAAGAAGAAAAGG - Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931566013 2:63616325-63616347 CTCCTGTTTTAGGAAAGAAAAGG + Intronic
931800041 2:65749240-65749262 CTCCTGTTGAACAGAAGAAGGGG - Intergenic
931918506 2:66986204-66986226 TTTCTGTTCAAGAGGAGAAATGG - Intergenic
932025260 2:68125782-68125804 CTCCTGAGCTACAGAAGGAATGG - Intronic
934119081 2:88823128-88823150 TCCATGTTCTAGAGAAGAATAGG - Intergenic
934515961 2:94986774-94986796 TCCGTGTTCTAGAGAAGAATGGG + Intergenic
934524285 2:95042087-95042109 CTCATGTTCCAGGCAAGAAAGGG + Intronic
934740604 2:96719179-96719201 CTCCTGTTCTATAGAATTGATGG - Intronic
935796036 2:106642348-106642370 CTCCAGTTCCAGGGAGGAAAAGG - Intergenic
936162537 2:110095504-110095526 TTCATGTTCTAGAGAAGAATAGG - Intronic
936251020 2:110868391-110868413 CTCCTTTTCCCAAGAAGAAAAGG - Intronic
938760290 2:134419182-134419204 CTTCAGTTGAAGAGAAGAAAAGG + Intronic
939021091 2:136959316-136959338 CTACTGATCGAGAGAAGAGAGGG - Intronic
940912343 2:159219698-159219720 CTCTTTGTCTAGAGAAGAAAGGG - Exonic
941345878 2:164368917-164368939 ATACTGTTATAGAGAAGAACAGG + Intergenic
942042341 2:172079086-172079108 CTCTTCTTTTAGAGAAGGAAGGG - Intronic
942230286 2:173854746-173854768 ATCTTGTACTAGAGAGGAAAAGG - Intergenic
942569129 2:177295516-177295538 CTCATCTTGTAGAGAAGGAAGGG + Intronic
944501921 2:200370285-200370307 TTCCTGTTCAATAGAATAAATGG + Intronic
944856885 2:203776595-203776617 ATGCTATTTTAGAGAAGAAATGG + Intergenic
945066301 2:205950182-205950204 CTCCTGAGCTACAGAAGGAATGG - Intergenic
945217640 2:207451624-207451646 ATCAAATTCTAGAGAAGAAAGGG - Intergenic
945608268 2:211964226-211964248 CTCCTCTTCTGGAGAATGAATGG + Intronic
946963900 2:225015767-225015789 CTCATGTACTAGAAATGAAACGG - Intronic
1169759220 20:9073308-9073330 CTCCTGTTCTAGAGAAGAAAGGG - Intronic
1170130991 20:13020096-13020118 CAACTGTTCCAGAGAAGACAGGG + Intronic
1170462329 20:16588923-16588945 CTCCTGTTCTCAAGAAGGGATGG - Intergenic
1171470620 20:25368218-25368240 CTCCTGAGCTACAGAAGGAATGG + Intronic
1171526842 20:25820110-25820132 GGCCTGTTACAGAGAAGAAAAGG + Intronic
1171549985 20:26035775-26035797 GGCCTGTTACAGAGAAGAAAAGG - Intergenic
1171724131 20:28600230-28600252 CTACTGTGCTAAAGAATAAATGG + Intergenic
1171753928 20:29082803-29082825 CTACTGTGCTAAAGAATAAATGG - Intergenic
1171788315 20:29494724-29494746 CTACTGTGCTAAAGAATAAATGG + Intergenic
1171859235 20:30379791-30379813 CTACTGTGCTAAAGAATAAATGG - Intronic
1172794979 20:37530575-37530597 CTCCTGAGCTACAGAAGGAATGG - Intergenic
1174702459 20:52622695-52622717 CTCCTCTTCAGGAGAAGGAAGGG + Intergenic
1174740190 20:53005424-53005446 TTCCTGTTCCAGAGGAGAAATGG + Intronic
1176662182 21:9647434-9647456 TTCCTCCTCTAGGGAAGAAAAGG + Intergenic
1177857543 21:26416492-26416514 TCCCTGTTCTAGTTAAGAAAGGG - Intergenic
1178110741 21:29367585-29367607 CTCCACGCCTAGAGAAGAAAGGG - Intronic
1178303100 21:31469024-31469046 CTTCAGTTCTAGGGAACAAAGGG + Intronic
1179310879 21:40195447-40195469 TTCATTTTATAGAGAAGAAAGGG + Intronic
1180297683 22:10958905-10958927 CTACTGTGCTAAAGAATAAATGG + Intergenic
1180410743 22:12604880-12604902 CTACTGTGCTAAAGAATAAATGG - Intergenic
1181833568 22:25583090-25583112 CTCTTGTCCTAGGGAAGAGAGGG + Intronic
952426412 3:33179143-33179165 GTCCCATTGTAGAGAAGAAATGG - Intronic
953185925 3:40638428-40638450 CTTCACTTTTAGAGAAGAAATGG + Intergenic
953486656 3:43304838-43304860 ATCATGTTCTGGAAAAGAAAGGG + Intronic
953836836 3:46353741-46353763 TTCATGTTCCAGAGAATAAAGGG - Exonic
954101404 3:48375518-48375540 ATCCTGTTCTATATATGAAACGG + Intronic
955232247 3:57109537-57109559 CTCGGGTTCTAAAGAAGAAAGGG + Exonic
955316352 3:57942336-57942358 CCCCTGAGCTACAGAAGAAATGG - Intergenic
955608477 3:60732090-60732112 CTCCTGAGCTACAGAAGGAATGG + Intronic
956090255 3:65659049-65659071 TTCCTATTTTATAGAAGAAAAGG + Intronic
956099819 3:65756151-65756173 CCCCTCTTACAGAGAAGAAAAGG + Intronic
956125610 3:66008408-66008430 CTCATGTTTTAGAGACTAAATGG - Intronic
956292560 3:67676720-67676742 CTCCTGACCTAGATAAAAAATGG + Intergenic
957123591 3:76128857-76128879 CTCCTTTTATTGTGAAGAAAAGG - Intronic
958859110 3:99423809-99423831 CCTCTGTTCTGGAGCAGAAATGG - Intergenic
959289565 3:104456673-104456695 CTGCTGTTATAAAGAAGATAAGG - Intergenic
960383761 3:116994969-116994991 CTTCTGATCTATAGTAGAAATGG + Intronic
960490752 3:118314137-118314159 CTCCTGTTGGAGAAAAGCAAAGG + Intergenic
962169358 3:133084381-133084403 CTCCCACTCTAGAGAAGAAATGG + Intronic
962195472 3:133358941-133358963 CTCCTGATCTAGAGATGGCAGGG - Intronic
962317180 3:134366206-134366228 CTTTTGTTCTAGAGAAAAATTGG - Intronic
962473298 3:135732404-135732426 CACCTGTGCTAGACAAGAAATGG - Intergenic
962877308 3:139545219-139545241 CTCCTGTACTAAACAAGGAAAGG + Intergenic
964097835 3:152953740-152953762 CACCTGTTCTAGACAAAAGAAGG - Intergenic
965976493 3:174630330-174630352 CTCCTGTTTTAGAGAAAACCTGG + Intronic
966302293 3:178493264-178493286 CTCCTGAACTACAGAAGGAATGG + Intronic
966872539 3:184300260-184300282 CTCCTGATCAAGAGACGACAGGG - Exonic
967219524 3:187236914-187236936 CTGCCTTTCTAGAGAAGGAAGGG - Intronic
967595915 3:191327001-191327023 TTTCTGGCCTAGAGAAGAAATGG - Intronic
968678088 4:1896338-1896360 CTCCAGGTCTAGAAATGAAAAGG - Intronic
971183906 4:24355397-24355419 CTCCTCTTCTTGACAATAAAAGG - Intergenic
971432404 4:26581825-26581847 CACCTGCTCTAGGCAAGAAATGG - Intronic
971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG + Intergenic
971773162 4:30925874-30925896 GTACTGTCCTAGAGAAGAATTGG + Intronic
974572532 4:63671775-63671797 CTAAAGTTCTAGAGAAGCAAGGG - Intergenic
976266283 4:83188455-83188477 ATCAAGTTCTAGAGAAGACAGGG + Intergenic
976526532 4:86098585-86098607 CTCCTGTTCTAGTGGATATATGG - Exonic
978604815 4:110467750-110467772 GTCCTGTTCTGGAGATGAACTGG + Intronic
978672763 4:111271012-111271034 CTCATGTTTTAGGGAGGAAAGGG - Intergenic
979531250 4:121771359-121771381 CTCCTGGACTAGAGAAGCAAAGG + Intergenic
979918624 4:126471856-126471878 CTTGAGTTCTAGAGAAAAAAGGG + Intergenic
982508846 4:156254685-156254707 CTAATCTTCAAGAGAAGAAATGG + Intergenic
984172463 4:176376940-176376962 AAACTGTTCTAGAGAAAAAAAGG + Intergenic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
985413212 4:189709082-189709104 TTCCTCCTCTAGGGAAGAAAAGG - Intergenic
987785205 5:22490462-22490484 CTCCTGTTCTCGATATGAAATGG - Intronic
989564880 5:42892259-42892281 CTCCTGAGCTACAGAAGGAATGG + Intergenic
989732080 5:44661318-44661340 CCCCTGTTCTGGAAAAGAAGAGG + Intergenic
990509306 5:56475922-56475944 CTCCTGTTTTCAGGAAGAAAAGG + Intronic
991433513 5:66572587-66572609 CTCCTGAGCTACAGAAGGAATGG - Intergenic
991950646 5:71944110-71944132 CTGCTCTTCAAGAGAAGGAAAGG + Intergenic
992045971 5:72889788-72889810 CTCCTCTTCTAGGGTAGCAAAGG - Exonic
992966671 5:82009542-82009564 CTCCTGAGCTACAGAAGGAATGG + Intronic
993076083 5:83233504-83233526 GTCCTTTTCTGGAGAAGAATGGG - Intronic
993214299 5:84999758-84999780 CTCCTGAGCTACAGAAGGAATGG + Intergenic
993926269 5:93870042-93870064 CACCCATTCTAGAGAAAAAACGG + Intronic
994332714 5:98526204-98526226 CTCCTGGTTTATAAAAGAAATGG - Intergenic
994702484 5:103153591-103153613 AGCCATTTCTAGAGAAGAAAAGG + Intronic
995331171 5:110948477-110948499 TCCCAGTTCTAGAGAAGAAAAGG - Intergenic
995365701 5:111357604-111357626 CCCCTCTTCTAGAAAATAAATGG - Intronic
997531532 5:134584486-134584508 CTACTGCTCTGGAGAGGAAATGG - Intergenic
998634009 5:143932239-143932261 CTCCTGTTCGAGAAAAGGAGAGG + Intergenic
999403718 5:151287757-151287779 CTCATTTTGTGGAGAAGAAAAGG - Intronic
999958065 5:156723990-156724012 CTCATGTTCCAGAGGAGAGATGG + Intronic
1002656088 5:180748752-180748774 CTCCTGTCCTGGAGAAGCGATGG + Intergenic
1004741057 6:18461601-18461623 CTCTGGTTCTGGAGATGAAATGG + Intronic
1006074147 6:31519126-31519148 CTCCTGAGCTACAGAAGCAATGG + Intergenic
1007779570 6:44245200-44245222 CTCCATTTCTGGAGCAGAAAGGG + Intergenic
1009192194 6:60642577-60642599 CTACTGTTGTGGAGAAGACAAGG - Intergenic
1010786614 6:80009455-80009477 CCATTTTTCTAGAGAAGAAAGGG - Intronic
1011026994 6:82880275-82880297 CTCCTGGTTCAGAGAAGAAAGGG + Intergenic
1011472193 6:87718914-87718936 CTCCTGTTCTAAGAAAGACAAGG + Intergenic
1012016438 6:93857926-93857948 CACGTGTTGAAGAGAAGAAAAGG - Intergenic
1013173287 6:107656774-107656796 CTCATTTTATAGTGAAGAAATGG - Intronic
1013567151 6:111377776-111377798 CTCATCTTCAGGAGAAGAAATGG - Exonic
1013812977 6:114065514-114065536 CTCATATTGTAGATAAGAAAAGG - Intronic
1014535054 6:122605041-122605063 CTCCTTTTGTATAGCAGAAAGGG - Intronic
1015528990 6:134201874-134201896 CTGATGTGCTGGAGAAGAAAGGG + Intronic
1015620234 6:135124244-135124266 CTCCTGGTTTACAGAAGAGAGGG - Intergenic
1015723221 6:136268257-136268279 TCCCAGTTCTCGAGAAGAAAAGG - Exonic
1017172348 6:151469155-151469177 CTCCTTTTCTGGGGATGAAAAGG - Exonic
1017759200 6:157555159-157555181 CTTCCATTCTAGAAAAGAAAAGG + Intronic
1017890638 6:158635892-158635914 CTCCTCTTCTAGAGGTGAAGGGG - Intergenic
1019110644 6:169709509-169709531 CACCTTTTCTTCAGAAGAAAAGG + Intronic
1021112594 7:16712656-16712678 CTACTTTTCCAGAGAAGACACGG - Intergenic
1022217528 7:28279150-28279172 CTCCTGAGCTACAGAAGGAATGG + Intergenic
1024834929 7:53505597-53505619 CTCCTGTGTTGGAGAATAAAAGG + Intergenic
1025015565 7:55436327-55436349 CTGATTTTATAGAGAAGAAATGG - Intronic
1025298832 7:57799827-57799849 GGCCTGTTACAGAGAAGAAAAGG - Intergenic
1025951416 7:66148359-66148381 CTCCTTCTCTAGAAAACAAAAGG + Intronic
1027127693 7:75568530-75568552 GTCCTGGACTAGAGAAGAAATGG + Intronic
1028073530 7:86481816-86481838 CTAATGTTCTAGGGAGGAAAAGG + Intergenic
1028976422 7:96919440-96919462 CTCCTCTGCTAAACAAGAAATGG + Intergenic
1029147073 7:98454056-98454078 CTCCTGAGCTACAGAAGGAATGG + Intergenic
1030050572 7:105533388-105533410 CTCCCGTACTAGGGAGGAAATGG - Intronic
1031291359 7:119940295-119940317 CTCCTGTTCTTGAGATTAGAGGG + Intergenic
1031734889 7:125346305-125346327 CTCCTGAGCTGCAGAAGAAATGG - Intergenic
1032564549 7:132928392-132928414 CTCCTACTCTAAAGAATAAATGG + Intronic
1033444431 7:141407985-141408007 CTCCTTTTCCAGAAAAGGAATGG + Intronic
1033741646 7:144280598-144280620 CTCATGTTTGTGAGAAGAAAGGG - Intergenic
1033752255 7:144369016-144369038 CTCATGTTTGTGAGAAGAAAGGG + Intronic
1034514581 7:151564932-151564954 CCACTGTTCTAAAGAAGAAAAGG - Intronic
1035465352 7:159071558-159071580 CTCCTGTTCTGGACAAGGAGGGG - Intronic
1035928755 8:3758273-3758295 TTCCTTTTATAGAGAAGCAAGGG + Intronic
1036649334 8:10632326-10632348 CTCCATTTCCAGAGGAGAAAAGG - Intronic
1037685932 8:21139406-21139428 CTCCTGATCTAGTGTAGAAGAGG + Intergenic
1038079892 8:24122267-24122289 CTTCTCTTCTGGAGAGGAAAAGG + Intergenic
1038513542 8:28163072-28163094 CTGCTGTCCTAGATAAGGAATGG - Intronic
1038756855 8:30349800-30349822 CTCCTGAGCTACAGAAGGAAAGG + Intergenic
1039378388 8:37060557-37060579 CTCCTATGCTAGAGAAGAGATGG + Intergenic
1039880677 8:41623658-41623680 CTGATGTTTTAGAGAAGCAATGG - Exonic
1040673578 8:49722002-49722024 CTGCTTTTCTAGATCAGAAATGG - Intergenic
1041182301 8:55261255-55261277 TTCCTCTTCTGGAAAAGAAATGG + Intronic
1041554739 8:59141085-59141107 CTCCTGGTATAGAAAAAAAAAGG + Intergenic
1043996709 8:86826546-86826568 TTAATGTTCTAGAGAAGAAATGG - Intergenic
1044264634 8:90167134-90167156 CTCATGTTCTAAAGGAGAGAAGG - Intergenic
1046799964 8:118415196-118415218 CTCCTGTCCTTCAGAAGAAAAGG + Intronic
1047589270 8:126309867-126309889 TTCCTTTTCTTGAGAAGAAAAGG - Intergenic
1047669578 8:127130315-127130337 ATACTGGTATAGAGAAGAAATGG - Intergenic
1047680608 8:127250601-127250623 CTCTGGTTCCTGAGAAGAAAGGG - Intergenic
1047852806 8:128877293-128877315 CTCCTGGTCTAGCGCAGCAACGG + Intergenic
1048009835 8:130446650-130446672 CTCCTGGTAGAGAGGAGAAAGGG - Intergenic
1048316517 8:133367074-133367096 CACCTGCTCTATAGAAGAAAAGG + Intergenic
1048887227 8:138918228-138918250 CTCCTGTTTTAGACAAGGTAGGG + Intergenic
1048935905 8:139356884-139356906 CTCATGGTTTAAAGAAGAAATGG - Intergenic
1050634647 9:7598409-7598431 CTCCTGAGCTACAGAAGGAATGG - Intergenic
1051145009 9:14017727-14017749 CTACTGTTCTAGACAATATAAGG + Intergenic
1051390000 9:16553714-16553736 CTTTAGTTCTAGAGAAGAGATGG - Intronic
1052019729 9:23511823-23511845 CTCTTGTTGAAAAGAAGAAAAGG - Intergenic
1053725473 9:40994839-40994861 CTACTGTGCTAAAGAATAAATGG - Intergenic
1053794765 9:41716204-41716226 GGCCTGTTATAGAGAAGAAAAGG + Intergenic
1054150409 9:61598615-61598637 GGCCTGTTATAGAGAAGAAAAGG - Intergenic
1054183176 9:61928263-61928285 GGCCTGTTATAGAGAAGAAAAGG + Intergenic
1054340469 9:63857038-63857060 CTACTGTGCTAAAGAATAAATGG + Intergenic
1054470185 9:65529721-65529743 GGCCTGTTATAGAGAAGAAAAGG - Intergenic
1054655331 9:67660211-67660233 GGCCTGTTATAGAGAAGAAAAGG - Intergenic
1055464315 9:76549225-76549247 CTCCTGAGCTACAGAAGGAATGG + Intergenic
1055634741 9:78265352-78265374 AGCCTGGTCGAGAGAAGAAAAGG - Exonic
1057615326 9:96584454-96584476 CTCCTGACCCAGAGAAGAGAAGG + Intronic
1058718510 9:107742731-107742753 CTCCTGTTCTGGAGATGAACAGG + Intergenic
1058776658 9:108290917-108290939 TCCCTGCACTAGAGAAGAAAAGG - Intergenic
1061724056 9:132571790-132571812 CACCATTTCTTGAGAAGAAAGGG + Intronic
1061724782 9:132576129-132576151 CACCATTTCTTGAGAAGAAAGGG + Intergenic
1061859949 9:133462862-133462884 CTCATGTGCAAGAGGAGAAACGG + Intronic
1203449339 Un_GL000219v1:97132-97154 CTACTGTGCTAAAGAATAAATGG + Intergenic
1189017894 X:37303215-37303237 CTCCTGTTTTAGAGAGGATTGGG + Intergenic
1189076506 X:37920993-37921015 CTCCAGTAATAGAGAGGAAAGGG + Intronic
1190135983 X:47798473-47798495 GTTCTTTTGTAGAGAAGAAAAGG + Intergenic
1192699431 X:73452143-73452165 TTCCTTTTCTGGAGATGAAAGGG + Intronic
1195018347 X:100800242-100800264 CTCCTGAGCTACAGAAGGAATGG + Intergenic
1195666849 X:107439593-107439615 CTTCTGTACTAGATAAGTAAAGG + Intergenic
1196187591 X:112761335-112761357 TTCCAGTTCTAGAGAAGCAGGGG + Intergenic
1197566834 X:128098531-128098553 ATCCTTTTCCAGAGAAGAACAGG - Intergenic
1197700012 X:129592342-129592364 CTGCTGTCTTAGGGAAGAAATGG + Exonic