ID: 1169759894

View in Genome Browser
Species Human (GRCh38)
Location 20:9079626-9079648
Sequence CCTCTGTTCTGGAGGGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169759894_1169759901 4 Left 1169759894 20:9079626-9079648 CCATTTGCCCTCCAGAACAGAGG 0: 1
1: 0
2: 3
3: 20
4: 200
Right 1169759901 20:9079653-9079675 CATGGTTGAGTGGTCAGTCCAGG 0: 1
1: 0
2: 1
3: 11
4: 101
1169759894_1169759900 -6 Left 1169759894 20:9079626-9079648 CCATTTGCCCTCCAGAACAGAGG 0: 1
1: 0
2: 3
3: 20
4: 200
Right 1169759900 20:9079643-9079665 CAGAGGTTTGCATGGTTGAGTGG No data
1169759894_1169759904 24 Left 1169759894 20:9079626-9079648 CCATTTGCCCTCCAGAACAGAGG 0: 1
1: 0
2: 3
3: 20
4: 200
Right 1169759904 20:9079673-9079695 AGGGTAGAAAGCTTATGATCTGG 0: 1
1: 0
2: 0
3: 10
4: 127
1169759894_1169759902 5 Left 1169759894 20:9079626-9079648 CCATTTGCCCTCCAGAACAGAGG 0: 1
1: 0
2: 3
3: 20
4: 200
Right 1169759902 20:9079654-9079676 ATGGTTGAGTGGTCAGTCCAGGG 0: 1
1: 0
2: 1
3: 15
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169759894 Original CRISPR CCTCTGTTCTGGAGGGCAAA TGG (reversed) Intronic
902445286 1:16459338-16459360 CCCCTCCTCTGGAGGGCAGATGG - Exonic
903464753 1:23544381-23544403 CATCTGTTCTGTGGGGCTAATGG - Intergenic
903687979 1:25146503-25146525 TCTCTGTTCAGGGTGGCAAAAGG - Intergenic
903780577 1:25817815-25817837 CATCTGGTCTGGAGGTCAGAGGG - Exonic
905176214 1:36137118-36137140 ACTGAGTTCTGGAGGGCAGAGGG + Exonic
906518524 1:46453599-46453621 CCTCTGCTCTGCAGTGCAATAGG + Intergenic
909522225 1:76582739-76582761 GCTGTGTTCCGGAGGGCAGAAGG - Intronic
909947598 1:81681058-81681080 GCTCTGTTCTATAGGCCAAAGGG - Intronic
910323206 1:85973557-85973579 CTTCTGTTCTGGGGCTCAAAAGG + Intronic
910675443 1:89811818-89811840 ACTTTGTTCTGGATGGTAAAAGG + Intronic
911272314 1:95817476-95817498 CCTCTGTACTGTATTGCAAAGGG - Intergenic
913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG + Intergenic
920647967 1:207817097-207817119 CCTCTCTTCTGGAGGACTAAGGG + Intergenic
922744485 1:228036577-228036599 CCTCTCTTCTGGGGTCCAAAAGG + Intronic
1067822603 10:49542925-49542947 CCTCTGTTCTGTAGGTCATTGGG - Intergenic
1068184392 10:53565725-53565747 CCTCTGTTCTTGAGGGATATTGG - Intergenic
1068349528 10:55824535-55824557 CCTCTCTTCTTTAGGGCTAAAGG + Intergenic
1069549058 10:69349763-69349785 CTTTTGTTATGGAGGGCAAGTGG + Intronic
1072317970 10:94222102-94222124 TCTCTGTCCTGGAGGTCTAAGGG + Intronic
1073834882 10:107429744-107429766 TCTCTGTTCAGGAGGGCTGATGG + Intergenic
1073948837 10:108784054-108784076 CCTTTGGTCTGGAGAGCACATGG + Intergenic
1074197765 10:111204380-111204402 GCTCAGTTCTGGAGGGAAGAGGG + Intergenic
1074212527 10:111350190-111350212 CCTCTCTTCTGCAGCCCAAAAGG - Intergenic
1074431922 10:113401594-113401616 CCTGTGCTCTGGAGATCAAAGGG - Intergenic
1075969511 10:126640532-126640554 CCACGGTCCTGGAGGGAAAAAGG + Intronic
1077192295 11:1260510-1260532 CCTCGGTCCTGGAGGGCCATGGG + Intronic
1077275730 11:1706763-1706785 CCTCTGCTGGCGAGGGCAAAGGG - Intergenic
1078078720 11:8186531-8186553 ACTCTGACCTGGAGGGGAAATGG - Intergenic
1078638770 11:13076505-13076527 CCTCAGTCTTGGAGGACAAAGGG + Intergenic
1079881406 11:25932055-25932077 CCTCTGTTCAGTGGGGAAAAGGG - Intergenic
1081334088 11:41842731-41842753 CCTCTGCCATCGAGGGCAAAGGG - Intergenic
1081578166 11:44332635-44332657 CCCATGTTCTGGTGGGCACATGG - Intergenic
1081747857 11:45485506-45485528 CCCCTGCTCTGGAGGCCAAGGGG + Intergenic
1082020912 11:47532399-47532421 CCCCTGTACTGGAGTTCAAAGGG - Intronic
1084066589 11:66707877-66707899 CCTCTGTCCTGCAGGGCACTTGG + Intronic
1084414164 11:69021205-69021227 CCTCTGTGCTGGTGGGCTCAGGG + Intergenic
1086061927 11:82708645-82708667 CCTATGTTCTGGACGGTCAAAGG - Intergenic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1089294027 11:117457427-117457449 GCTCATTTCTGGAGGCCAAAAGG + Intronic
1089411509 11:118246954-118246976 CCCCAGGTCTGAAGGGCAAAGGG + Intronic
1090090240 11:123690312-123690334 CCTCTCAGCTGGAGGGCAGATGG + Intergenic
1090500989 11:127261137-127261159 TCCCAGTTCTGGAGGGCAGAAGG + Intergenic
1092647977 12:10600479-10600501 CATCTCTTCTGGAGGGCATTTGG - Intergenic
1094850648 12:34380876-34380898 CCTGTGTTGTGGAAGGAAAACGG - Intergenic
1096521318 12:52186299-52186321 CCTCAGTGCTGGAGGGAAGAGGG - Intronic
1096617845 12:52844399-52844421 CCTCCCTCCTGGAGGGGAAATGG + Intronic
1096843534 12:54392842-54392864 CCTGGGTTCTGGAGGGAAATTGG + Intergenic
1097232282 12:57520180-57520202 GCTCTGTGCTGCTGGGCAAAGGG - Intronic
1097746579 12:63310325-63310347 CCTCTGCTAGTGAGGGCAAAGGG + Intergenic
1099007085 12:77247029-77247051 GCTCTGTTCTGGACAGGAAAGGG - Intergenic
1099424935 12:82511731-82511753 GCTCTGTTCTGCAGAGCAAAAGG + Intergenic
1100715202 12:97298348-97298370 CAGCTGTTCTGGAGGGAATATGG + Intergenic
1101758746 12:107642194-107642216 CCTCTGTGCTGGTTGGCACAGGG + Intronic
1102413285 12:112738817-112738839 CCTTTGGTTTGGAAGGCAAAAGG - Intronic
1103610615 12:122122050-122122072 CCTCTGTTCTGATGGGCAGATGG + Intronic
1103963889 12:124626019-124626041 TCCCCGTTCTGGAGGGCAGAAGG - Intergenic
1103966003 12:124639758-124639780 TCTCTTTCCTCGAGGGCAAAGGG + Intergenic
1104441181 12:128794616-128794638 CCTCTCTTCTGTAAGGTAAAAGG + Intronic
1104512512 12:129393358-129393380 CATCTTTTCTGGGGGGCAACTGG + Intronic
1106079083 13:26485779-26485801 ACTCTTTTCTGGAGCCCAAAAGG + Intergenic
1106244175 13:27933228-27933250 CCACTGGACTGGAGGACAAAGGG - Intergenic
1109721679 13:66283449-66283471 CCACTGCTCTGGAGGGCACAAGG - Intergenic
1114618271 14:24079977-24079999 CATCTGTTATGGAGAGCCAATGG - Intergenic
1116211387 14:41950449-41950471 ACTATGTTATGGAGGGTAAATGG + Intergenic
1117737330 14:58780967-58780989 CCTCGGTTCTGAAGGGAAACTGG + Intergenic
1118647946 14:67858184-67858206 CCTCTGCTGGTGAGGGCAAAGGG + Intronic
1118887367 14:69878619-69878641 CCTCTGAACTGGAGGGCAAGGGG - Intronic
1119678974 14:76577707-76577729 CTTCTGGTCTGAAGGACAAATGG - Intergenic
1121078809 14:91090948-91090970 CCTCTCTTGCAGAGGGCAAAGGG - Intronic
1122460461 14:101890302-101890324 CCTCTGTTATGGGTAGCAAACGG + Intronic
1124096234 15:26651078-26651100 CCTCTGTCAGTGAGGGCAAAGGG - Intronic
1125486422 15:40114278-40114300 CCACTGTCCTGGAGGGGAACAGG + Intergenic
1127691452 15:61401330-61401352 TCTCTGTTCTGAAGGGCTTACGG + Intergenic
1128736065 15:70054678-70054700 TCCCTGTTCTGGAGGGAGAAGGG + Exonic
1132654323 16:1035549-1035571 CCTGGGTTCTGGAGGGCCACGGG + Intergenic
1137716996 16:50604052-50604074 CCACTGTCCTGGAGGCCAGAGGG + Intronic
1138024115 16:53509496-53509518 ACTCTATCCTGGAGGACAAAGGG - Intergenic
1140035341 16:71367516-71367538 CCTCGATTGTGGATGGCAAATGG - Intronic
1140390066 16:74578664-74578686 CCTGTGTTCTGGCAGGCACATGG - Intronic
1140484548 16:75283257-75283279 CCTCCTTTCTGGAGGCCCAAGGG - Intergenic
1140991045 16:80211908-80211930 CCTTTGTTCTGGATGGCCTAGGG + Intergenic
1144066371 17:11628037-11628059 CCTCTGCTCTGGAGGTTTAAGGG - Intronic
1146609184 17:34289516-34289538 CCATTGATCTGGAGGGCCAATGG + Intergenic
1147791963 17:43019642-43019664 CCTCTGTGCAGGAGGGAAAGGGG + Intronic
1151018467 17:70584640-70584662 CCTCTGTTGGCAAGGGCAAAAGG + Intergenic
1151098754 17:71531381-71531403 TCTCTCTTCTGGAGGGCTATAGG + Intergenic
1155169914 18:23259816-23259838 CCTCTGTGGAGGAGGTCAAAGGG - Exonic
1156201546 18:34838150-34838172 CAGCTTTTCTGAAGGGCAAAGGG + Intronic
1157294050 18:46429340-46429362 CCTCTGGTGTGGAGGGCAAAGGG - Intronic
1160419417 18:78733945-78733967 CCTGTGTTCTGAATGGCAATGGG + Intergenic
1160498179 18:79387316-79387338 CCTCAGTTCTGGAGGCCAGAAGG + Intergenic
1163353697 19:16795858-16795880 CCTCTGTCCTTGATGGCAGAGGG - Intronic
1166309959 19:41957288-41957310 GCTGTGTTCTGGAGGGCAGTGGG - Intronic
1166357726 19:42236934-42236956 TCTCGGTTCTTGAGGGCAAAGGG + Exonic
1166504661 19:43363659-43363681 CCTCTGTTCTGTAGTGTGAATGG - Intergenic
1167500739 19:49845969-49845991 GGTCTGTGCTGGAGGGCAGATGG + Intergenic
1167762499 19:51458341-51458363 CCCCTGCTCTGGGGGACAAAGGG - Exonic
925333299 2:3075211-3075233 TCTCCGTTCTGGAGGGCATAGGG + Intergenic
925493266 2:4419183-4419205 CCTGAGTTCTGGAGGGCAGAGGG + Intergenic
925636144 2:5942809-5942831 CCTCTCCTCTGGAGGGCCATCGG - Intergenic
926117405 2:10222153-10222175 CCTGTTTTATGGAGGACAAAAGG - Intergenic
927242775 2:20933066-20933088 CCTCTGTTCTGGCCAGGAAATGG - Intergenic
929806549 2:45151323-45151345 CCTCCTTCCTGGATGGCAAAAGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
934933043 2:98444494-98444516 GCTCTTGTCCGGAGGGCAAAAGG + Intergenic
936591291 2:113807118-113807140 GCTGGCTTCTGGAGGGCAAAAGG + Intergenic
936858427 2:116987594-116987616 CCTCTGCCATTGAGGGCAAAGGG - Intergenic
938984328 2:136559081-136559103 CCTGTGTTCTGTAGAGGAAATGG + Intergenic
940061808 2:149579590-149579612 CCTCTGATCTTGAGGTCCAAAGG + Exonic
940138838 2:150470804-150470826 TCTCTTTTCTTGAGGGTAAATGG + Intronic
941223196 2:162811119-162811141 CTAATGTTCTAGAGGGCAAAGGG - Intronic
941710245 2:168704544-168704566 CCTCTTTTCAGGAGGCCAAAGGG - Intronic
941735873 2:168976582-168976604 CCTCTGGTCTGGAAGGATAATGG + Exonic
945187596 2:207155507-207155529 CCTTTGTTCTGAAGGGCTCAGGG - Intronic
946600903 2:221358852-221358874 CCTCTGTTCAAGTGGGAAAATGG - Intergenic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
948717323 2:239873760-239873782 CTTCTGTTCTGGACAGCACAGGG + Intergenic
1168855261 20:1003329-1003351 CCACTTTTCTGGGGAGCAAAGGG + Intergenic
1169012385 20:2261302-2261324 CCTCTGGTCTGGAGGCTAAAGGG - Intergenic
1169105158 20:2988268-2988290 CCCCTCTTCTGGAGGCTAAACGG - Intronic
1169759894 20:9079626-9079648 CCTCTGTTCTGGAGGGCAAATGG - Intronic
1170522550 20:17202582-17202604 CCTCAGTTCTGGAGGGGATCAGG - Intergenic
1170602386 20:17850600-17850622 ACTCTGTGCTGGAGGGCAGATGG - Intergenic
1171142036 20:22751624-22751646 GCTGGGTTCTGGAGGGCAATGGG + Intergenic
1174309009 20:49635898-49635920 CCTCTGCTCTGAAGGCCAAGAGG + Exonic
1175514685 20:59561427-59561449 GTTCTGTTCTGGATGGCAAGGGG - Intergenic
1178741426 21:35205730-35205752 CCTCTGTGCTACAGGGGAAAAGG - Intronic
1179593150 21:42424515-42424537 CCTCTGTCCAGGAGAGCAGAGGG + Intronic
1179801851 21:43814942-43814964 CCTCTGTTTTGGAGGGAGGAAGG + Intergenic
1182800459 22:33028190-33028212 CCAGTGTGCTGGAGGGGAAAGGG - Intronic
1183136478 22:35893840-35893862 CATCTGGGCTGAAGGGCAAAGGG + Intronic
1183698509 22:39436817-39436839 CCTCTGTTCTGGTGAGCTCAGGG + Intronic
949684237 3:6549669-6549691 CCTCTGTCAGTGAGGGCAAAGGG - Intergenic
951996721 3:28738005-28738027 CCTTTGTTCTGGAGAGCAACTGG - Intergenic
953049450 3:39327609-39327631 CCCCAGTTCTGGAGGCCAGATGG - Intergenic
954397772 3:50302189-50302211 CCGCAGTGCTGGAGGGCACAGGG - Exonic
955136853 3:56227523-56227545 CTTCTGTTCGGGAGGGCACAGGG - Intronic
957511339 3:81191594-81191616 CCCCAGTTCTGGAGGCCAGAGGG - Intergenic
958859110 3:99423809-99423831 CCTCTGTTCTGGAGCAGAAATGG - Intergenic
959011909 3:101087547-101087569 CCTCTAGTCTGGGCGGCAAAGGG - Intergenic
959365264 3:105450322-105450344 TCCCTGCTCTGGAGAGCAAAGGG - Intronic
959693511 3:109224563-109224585 CCTCTGCTGGCGAGGGCAAAGGG + Intergenic
960220871 3:115106806-115106828 TCTCTGCTCTGGGGGGCAGAGGG - Intronic
962133741 3:132710490-132710512 CCTCTGTGCTGCTGTGCAAAGGG + Intronic
964060591 3:152517710-152517732 CCACTATTCTGGAAGGGAAAAGG + Intergenic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
967450595 3:189618559-189618581 CCTCTGTTCTTGAGGGTAGAGGG + Intergenic
968702089 4:2062048-2062070 CCTCTGCTTGGGAGGGGAAACGG + Intronic
969261475 4:6036912-6036934 CCTCGGTGATGGAGGGCTAATGG - Intronic
969582237 4:8072137-8072159 CCTCTGCTGTGGAGGAGAAAGGG - Intronic
969623614 4:8291445-8291467 ACTGTGTTCTGTAGGGCGAAGGG - Exonic
973153458 4:46916788-46916810 CCTCTCTTCTGCATGGAAAATGG - Intergenic
975738910 4:77409181-77409203 CCCCTGTTCTTGAGGTCAACTGG - Intronic
976121879 4:81792040-81792062 CATCTATTCTGGAAGGCAAAGGG + Intronic
982485365 4:155959343-155959365 CCCCTGTTCAGGAGGGCATAAGG - Intergenic
984107771 4:175571547-175571569 CATCTGGTCTGTAGGGCACATGG + Intergenic
985126263 4:186697829-186697851 CCTCTGTTCTGGAGGTTCCAGGG - Intronic
988652009 5:33162740-33162762 GCTATGTGCTAGAGGGCAAAGGG + Intergenic
990514818 5:56521269-56521291 CCTCTTGTAGGGAGGGCAAATGG - Intronic
992635278 5:78720436-78720458 TCTTTGTGCTAGAGGGCAAAGGG - Intronic
993144035 5:84071089-84071111 CCTGTGATGTGGAGGGCAGAGGG - Intronic
993168530 5:84385484-84385506 CATCTGTTCACGGGGGCAAAAGG + Intergenic
994787058 5:104179165-104179187 CCCCTGGTCTGGAGAGCACATGG + Intergenic
996392664 5:122979118-122979140 CCTCTGTTCATGAGGGCAAATGG - Intronic
997607638 5:135186568-135186590 CCTCTGGCAGGGAGGGCAAAGGG - Intronic
999095341 5:148973065-148973087 CACCAGTTCTGGAGGGCACAGGG - Intronic
999494485 5:152083636-152083658 CCTCTATCCTGGAGGTAAAATGG + Intergenic
1001740966 5:174052372-174052394 CCTCAGGTCTAGTGGGCAAATGG - Intronic
1001959710 5:175872564-175872586 CCTCTCTTCTGGCCGGGAAACGG + Intronic
1002300571 5:178255277-178255299 CCTGAGTTCTCGGGGGCAAATGG + Intronic
1003378438 6:5601118-5601140 TCACTGTTCTGGAGGCCACAGGG - Intronic
1003756142 6:9122747-9122769 CCTCTGTTCTGGATAGAACATGG + Intergenic
1004965674 6:20848204-20848226 CATCTTTTCTGCAGGGCAGATGG - Intronic
1005999996 6:30956995-30957017 CCTGGGTTCTAGAGGGCAGATGG - Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1007032404 6:38640089-38640111 CCCCTGTTCTGGAGGGGCAGAGG - Intronic
1007291519 6:40790890-40790912 CTGCTGTTGTGGAGGGTAAATGG - Intergenic
1010272455 6:73929558-73929580 CATCTTTTCTGGAGGGAACATGG + Intergenic
1012853383 6:104473167-104473189 GCTCTGACCTGGAGGGGAAAAGG - Intergenic
1013964776 6:115941521-115941543 ACTCTGATCTGTAGGCCAAAGGG + Exonic
1014740482 6:125143273-125143295 CCTCTGCTAGTGAGGGCAAAGGG + Intronic
1019312669 7:370249-370271 CCTCCGTCCTGCAGGGCAAAGGG + Intergenic
1020032991 7:4945880-4945902 CCTCTGTCCTGGAGGAAAGAAGG - Intronic
1022246090 7:28560735-28560757 ACCATGTTCTGAAGGGCAAAGGG - Intronic
1022562963 7:31369126-31369148 CCTCTGCCATTGAGGGCAAAGGG + Intergenic
1023167319 7:37355699-37355721 CCTGTGGTCAGGAGGGAAAATGG - Intronic
1027887531 7:83928557-83928579 TCTCTGTTCTGCATTGCAAAAGG + Intergenic
1028878023 7:95845398-95845420 CATCTGTTCTGTTAGGCAAATGG - Intronic
1031414625 7:121480669-121480691 CCACAGTCCTGGAGGGCAGAAGG + Intergenic
1033861397 7:145632423-145632445 CTTCTGTTCTAGAGGGCAGTAGG + Intergenic
1035262195 7:157669174-157669196 GCTCACTTCTGGAGAGCAAATGG + Intronic
1035759673 8:2060607-2060629 CCTCTGTTCTTCAGAGGAAAAGG + Intronic
1036703527 8:11029891-11029913 CTTCTGTTATGGATGGAAAATGG - Intronic
1037472738 8:19226426-19226448 CCTGTTTACTTGAGGGCAAAGGG + Intergenic
1038052273 8:23825174-23825196 CTTCTATTCTGGGTGGCAAATGG - Intergenic
1038079892 8:24122267-24122289 CTTCTCTTCTGGAGAGGAAAAGG + Intergenic
1041838359 8:62242225-62242247 CCCCTTTTCTGGAGAGCGAATGG + Intergenic
1045499889 8:102737161-102737183 TTACTGTTCTGGAGGACAAAAGG + Intergenic
1046541272 8:115586951-115586973 CATTTGTTTTGAAGGGCAAAAGG - Intronic
1052779796 9:32769629-32769651 GCTCAGTTCTCGAGAGCAAATGG + Intergenic
1053083122 9:35194064-35194086 CCCTTGGTCTGGAGAGCAAACGG - Intronic
1055374499 9:75634385-75634407 CCTCTCTTTCGGAGGGCAACTGG + Intergenic
1059422969 9:114204458-114204480 CCTCTGTCCTGATGGCCAAAAGG - Intronic
1061316768 9:129801306-129801328 CCTCTGTTCTGGGGGGTAATAGG - Intergenic
1061678759 9:132232312-132232334 TCTCTGATCAGCAGGGCAAAGGG + Intronic
1062059664 9:134488309-134488331 CCTCTGTCCTGGAGGAAATAAGG - Intergenic
1062173145 9:135146454-135146476 CCACAGTTCTGGAGGCCACAGGG + Intergenic
1186311420 X:8323534-8323556 CCTCTGCTGGTGAGGGCAAAGGG - Intergenic
1188606065 X:32031434-32031456 ACTCTCCTCTGGAGCGCAAATGG - Intronic
1189161118 X:38809908-38809930 CCTCTGTTCTGCATTGCCAATGG + Intergenic
1190131389 X:47751886-47751908 CCTCTGCTGGCGAGGGCAAAGGG + Intergenic
1190199811 X:48351252-48351274 ACTCTGGTTTGGAGGGTAAAGGG - Intronic
1190204096 X:48388199-48388221 ACTCTGGTTTGGAGGGTAAAGGG + Intronic
1190206440 X:48407204-48407226 ACTCTGGTTTGGAGGGTAAAGGG - Intronic
1190429714 X:50367508-50367530 CCTCTGTACTCAAGGGAAAAGGG + Exonic
1190666589 X:52701733-52701755 ACTCTGGTTTGGAGGGTAAAGGG - Intronic
1190672829 X:52756675-52756697 ACTCTGGTTTGGAGGGTAAAGGG + Intronic
1196071152 X:111523682-111523704 CATTTATTCTAGAGGGCAAATGG - Intergenic
1196131566 X:112162725-112162747 CGTCTGTTGTAGATGGCAAAGGG - Intergenic
1196586806 X:117439547-117439569 CATCTTTTCTGAAGTGCAAATGG - Intergenic
1198334293 X:135651878-135651900 CCTCAGTCCTGAAGGGGAAAGGG + Intergenic
1199143486 X:144337127-144337149 CCTCATATCTGGAGAGCAAAAGG + Intergenic
1199313130 X:146344892-146344914 CCACTGTTATGGAAGGCAATGGG - Intergenic