ID: 1169763658 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:9125066-9125088 |
Sequence | GATGGAGTCAAGCGTATTTC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1169763658_1169763661 | 3 | Left | 1169763658 | 20:9125066-9125088 | CCTGAAATACGCTTGACTCCATC | No data | ||
Right | 1169763661 | 20:9125092-9125114 | TCACCAGGCGTGTCTCTTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1169763658 | Original CRISPR | GATGGAGTCAAGCGTATTTC AGG (reversed) | Intronic | ||