ID: 1169763658

View in Genome Browser
Species Human (GRCh38)
Location 20:9125066-9125088
Sequence GATGGAGTCAAGCGTATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169763658_1169763661 3 Left 1169763658 20:9125066-9125088 CCTGAAATACGCTTGACTCCATC No data
Right 1169763661 20:9125092-9125114 TCACCAGGCGTGTCTCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169763658 Original CRISPR GATGGAGTCAAGCGTATTTC AGG (reversed) Intronic