ID: 1169763658

View in Genome Browser
Species Human (GRCh38)
Location 20:9125066-9125088
Sequence GATGGAGTCAAGCGTATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169763658_1169763661 3 Left 1169763658 20:9125066-9125088 CCTGAAATACGCTTGACTCCATC 0: 1
1: 0
2: 0
3: 6
4: 46
Right 1169763661 20:9125092-9125114 TCACCAGGCGTGTCTCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169763658 Original CRISPR GATGGAGTCAAGCGTATTTC AGG (reversed) Intronic
906328995 1:44868772-44868794 GATGAAGGCAAGTGTAGTTCTGG + Intronic
908579414 1:65498767-65498789 TATGGAGTCAAGCATATACCTGG - Intronic
924058285 1:240144895-240144917 CATGGAGTCATGAGTATATCAGG - Intronic
1063719554 10:8566260-8566282 GATAGAGTCAACCGTAGTTGAGG - Intergenic
1068586528 10:58805902-58805924 GATGTAGTCAAGTGTATGTGAGG - Intronic
1070230584 10:74562431-74562453 GATGGATTCAAGAGTATATTGGG + Intronic
1074004648 10:109408170-109408192 GATGGATTCATTCGTATTCCAGG + Intergenic
1075807338 10:125199383-125199405 GAGAGAGTCAAGAATATTTCAGG + Intergenic
1085676471 11:78524423-78524445 CATGAAGTCAAGCATATTTTAGG - Intronic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1095636397 12:44439162-44439184 GATGGAATCAAGCTCATTTCTGG - Intergenic
1100987603 12:100218496-100218518 GAAGGATTAAAGAGTATTTCCGG - Exonic
1109292590 13:60495018-60495040 AGTGGAGTCAAACATATTTCTGG + Intronic
1117665617 14:58053049-58053071 GATGGATTCAAGAGTAATTTAGG - Intronic
1118844024 14:69532965-69532987 GATGGAGTGAAGTTCATTTCTGG - Intergenic
1123977876 15:25570042-25570064 CTTGGAGTTAAGCATATTTCAGG + Intergenic
1131345563 15:91644681-91644703 GAGGGAGTCAAAAGTATTTGTGG + Intergenic
1134592164 16:15463392-15463414 GATGCCTTCAAGCGTATTTCAGG - Intronic
1152214114 17:79022613-79022635 AATGGAGACAAGCTTATCTCTGG + Intergenic
927361133 2:22235559-22235581 GATGGACTCTAGATTATTTCGGG - Intergenic
935283794 2:101545589-101545611 GATTGGGGCAAGCATATTTCTGG - Intergenic
943450932 2:188040857-188040879 GATCAAGTCAAGTCTATTTCAGG + Intergenic
945516774 2:210772334-210772356 GCTGGATTCAATGGTATTTCTGG - Intergenic
946629562 2:221652262-221652284 GATGCAGTCAAGAGTGTTTCTGG - Intergenic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1172668108 20:36614592-36614614 GATGTAGTCAAAGGTCTTTCTGG + Intronic
1174177893 20:48656582-48656604 GGGGGAGTCAAGGGGATTTCTGG - Intronic
1178213598 21:30567838-30567860 GAGGGACTCAAGTGTTTTTCAGG + Intergenic
1178675558 21:34628656-34628678 GATGGAGTAAAGCGCCTGTCTGG + Intergenic
1180915762 22:19485434-19485456 GATGGAGCCAAGAGGATTCCTGG + Intronic
954870212 3:53762014-53762036 GAGGGAGTCAAACGTGTTCCAGG - Exonic
959919629 3:111856652-111856674 TGTGTAGTCAAGTGTATTTCTGG + Intronic
963212902 3:142714305-142714327 GATGGAGTCTAGGGTATTGTAGG + Intergenic
979602672 4:122603596-122603618 GAAGGAGGCAACCGGATTTCAGG + Intergenic
987242388 5:16013900-16013922 GATGGAGTTAAGCTTCTTTAGGG + Intergenic
992217533 5:74540690-74540712 GATGGAGTCAAGAGAACCTCTGG + Intergenic
993462485 5:88200863-88200885 GATGGACTCAAACACATTTCTGG + Intronic
994409597 5:99390413-99390435 GCTGAAGTCAAGCCTATTTTAGG - Intergenic
998872046 5:146562046-146562068 GATGGGGTCACGAGTTTTTCTGG + Intergenic
1005456722 6:26027107-26027129 GGTGGGGTTAAGCGAATTTCCGG - Exonic
1005464977 6:26104071-26104093 GGTGGCGTCAAGCGCATTTCCGG + Exonic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005484324 6:26285354-26285376 GGCGGTGTCAAGCGAATTTCTGG - Exonic
1013001971 6:106031939-106031961 GATGGACTCAAGCCTATTAAAGG - Intergenic
1015697249 6:135994423-135994445 GATGGAGTCAAATGTATCTTTGG - Intronic
1032314572 7:130823360-130823382 GATGGTGTCAAGAGCATTTCTGG - Intergenic
1032429153 7:131846916-131846938 GATGGAGGGAAGCGCATTCCAGG + Intergenic
1043025419 8:75061411-75061433 GATGGATTAAAAGGTATTTCTGG - Intergenic
1055586881 9:77764148-77764170 GATTGAGTCAGGTGAATTTCAGG + Intronic
1188528637 X:31113289-31113311 AAAGGAGTCAAGAGTATTTAAGG + Intronic
1188820335 X:34767243-34767265 GATGTAATCAAACATATTTCAGG + Intergenic
1199804789 X:151287863-151287885 GATGGAGAGAAGGGCATTTCAGG - Intergenic