ID: 1169763661

View in Genome Browser
Species Human (GRCh38)
Location 20:9125092-9125114
Sequence TCACCAGGCGTGTCTCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169763658_1169763661 3 Left 1169763658 20:9125066-9125088 CCTGAAATACGCTTGACTCCATC 0: 1
1: 0
2: 0
3: 6
4: 46
Right 1169763661 20:9125092-9125114 TCACCAGGCGTGTCTCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169763661 Original CRISPR TCACCAGGCGTGTCTCTTGA TGG Intronic
No off target data available for this crispr