ID: 1169764919

View in Genome Browser
Species Human (GRCh38)
Location 20:9138744-9138766
Sequence TAGAATAATTAGAAGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 499}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169764919_1169764928 23 Left 1169764919 20:9138744-9138766 CCTTATTCCTTCTAATTATTCTA 0: 1
1: 0
2: 1
3: 32
4: 499
Right 1169764928 20:9138790-9138812 CAGTCTTGATGTTATAAGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 93
1169764919_1169764926 19 Left 1169764919 20:9138744-9138766 CCTTATTCCTTCTAATTATTCTA 0: 1
1: 0
2: 1
3: 32
4: 499
Right 1169764926 20:9138786-9138808 TCAGCAGTCTTGATGTTATAAGG 0: 1
1: 0
2: 0
3: 5
4: 121
1169764919_1169764921 -6 Left 1169764919 20:9138744-9138766 CCTTATTCCTTCTAATTATTCTA 0: 1
1: 0
2: 1
3: 32
4: 499
Right 1169764921 20:9138761-9138783 ATTCTAGTCCCTAAAGCTTAAGG 0: 1
1: 0
2: 1
3: 13
4: 114
1169764919_1169764927 22 Left 1169764919 20:9138744-9138766 CCTTATTCCTTCTAATTATTCTA 0: 1
1: 0
2: 1
3: 32
4: 499
Right 1169764927 20:9138789-9138811 GCAGTCTTGATGTTATAAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 88
1169764919_1169764923 -4 Left 1169764919 20:9138744-9138766 CCTTATTCCTTCTAATTATTCTA 0: 1
1: 0
2: 1
3: 32
4: 499
Right 1169764923 20:9138763-9138785 TCTAGTCCCTAAAGCTTAAGGGG No data
1169764919_1169764922 -5 Left 1169764919 20:9138744-9138766 CCTTATTCCTTCTAATTATTCTA 0: 1
1: 0
2: 1
3: 32
4: 499
Right 1169764922 20:9138762-9138784 TTCTAGTCCCTAAAGCTTAAGGG 0: 1
1: 0
2: 0
3: 13
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169764919 Original CRISPR TAGAATAATTAGAAGGAATA AGG (reversed) Intronic
903409259 1:23127184-23127206 TAGAATTATTTTGAGGAATAGGG - Intronic
903901603 1:26650295-26650317 TAGCATTATTTCAAGGAATATGG + Intergenic
905950710 1:41948280-41948302 TAGAATTAGGAGAAGGAAAAAGG + Intronic
906583737 1:46957656-46957678 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
907037487 1:51229240-51229262 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
907100064 1:51824080-51824102 TAAAATAATTAGAAAGAACCTGG - Intronic
907164573 1:52398888-52398910 TAGGGTTATTAGAAGGATTAAGG - Intronic
908647041 1:66289450-66289472 TAGAAAGATAAGAAGGAAAAAGG + Intronic
908915994 1:69127137-69127159 TAGTACAATTGCAAGGAATATGG - Intergenic
909178988 1:72396772-72396794 TATAATAATTAAAAAGAATTAGG - Intergenic
909541723 1:76799195-76799217 TAGAGAAACTGGAAGGAATAAGG + Intergenic
909618975 1:77646185-77646207 TAGACTAATTAGAAGGCATTTGG - Intronic
909798524 1:79775367-79775389 TAAAATACTTAAAAGGACTAAGG - Intergenic
910155248 1:84210191-84210213 TAGAAAAATCAGAAGTAATATGG + Intronic
910178647 1:84458077-84458099 TAGAAGAATATGAAGGAATTTGG - Intergenic
910317405 1:85902033-85902055 TGGAATAATTTGTAGGAACATGG + Intronic
910328789 1:86044248-86044270 TATAATAAACAGAAAGAATAAGG + Intronic
910667997 1:89744765-89744787 TAGAATAAGTATATGAAATAGGG + Intronic
910804815 1:91179889-91179911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
911138668 1:94472173-94472195 TGGAATAATAAGCAGAAATAAGG + Intronic
911624893 1:100112361-100112383 TACAATAAATAGAAGGAAGATGG + Intronic
911666468 1:100558301-100558323 TGGAATAAGTATAAGGAATGTGG - Intergenic
911754937 1:101543106-101543128 TAGAGTGAGGAGAAGGAATAAGG + Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
913392641 1:118331644-118331666 TAGACTAAATAGAAGGCAAAAGG - Intergenic
913672129 1:121106970-121106992 TAGAATAATGAGCAGGAGAAAGG - Intergenic
914023893 1:143894327-143894349 TAGAATAATGAGCAGGAGAAAGG - Intergenic
914225864 1:145719130-145719152 TAGAATAACTAGAAGATAAAAGG - Intergenic
914662383 1:149802366-149802388 TAGAATAATGAGCAGGAGAAAGG - Intronic
915235843 1:154481026-154481048 TGGAATAACTCGAAGGAATGAGG + Exonic
915881632 1:159678537-159678559 TAGAATAAATAGTATGAGTAGGG - Intergenic
916149342 1:161771233-161771255 AAGAATAAAGAGAAGGAAAAAGG - Intronic
916981714 1:170144976-170144998 TAGGAAAATTACAAGGAATTGGG + Intergenic
917226634 1:172790576-172790598 TAAAATATGTACAAGGAATAAGG + Intergenic
917912210 1:179661245-179661267 AAAAATAATTTGAAGAAATATGG - Intronic
918445737 1:184615108-184615130 TATAAGAATTAGAAGTACTAAGG - Intronic
919235980 1:194843098-194843120 TAGACTAATTGGTAGCAATAGGG + Intergenic
920425113 1:205868867-205868889 TAGAATTAAGAGAAGGAAAAGGG - Intergenic
920816150 1:209334063-209334085 GAGATGAATTAGCAGGAATAAGG + Intergenic
921568838 1:216754163-216754185 CAGAATATTTGGAAGGAAGAAGG - Intronic
921691899 1:218161600-218161622 TATAAGAATTAGAATGAAAAGGG - Intergenic
921701843 1:218277573-218277595 TAGAACAATTAAACAGAATAGGG - Intergenic
922050674 1:221987565-221987587 AAGAATAATTTTAGGGAATAAGG + Intergenic
923455775 1:234164042-234164064 TAGAAGAAAAAGAAGAAATATGG + Intronic
923585294 1:235264735-235264757 TCGAATATTAAGAAGAAATAAGG - Intronic
923805386 1:237251896-237251918 AAGAATAATTAGAAGGGTTTAGG - Intronic
924655235 1:245968765-245968787 CAGAATTATTAAATGGAATATGG - Intronic
1063890945 10:10627889-10627911 TAAAATAATTATAAAGAATTAGG - Intergenic
1065091444 10:22238266-22238288 TAAAATTAGTAGAAGGAAAAAGG - Intergenic
1065199184 10:23297454-23297476 TAGAATTAAGAGAAGGAAAAAGG - Intronic
1067184376 10:44014625-44014647 TAGAATAATTTAGAAGAATAAGG - Intergenic
1069525416 10:69165964-69165986 TGGAAAAATAAGAAGGCATAAGG + Intronic
1070222377 10:74462277-74462299 TAGAAAAATTAGAAGTTATACGG + Intronic
1070355275 10:75633839-75633861 TAGAATAAGTTGTTGGAATATGG + Intronic
1070500406 10:77067237-77067259 TAGAATAAAAAGGAGGAGTAAGG + Intronic
1070546714 10:77458296-77458318 TAGAATGGTTGGAAGGAACAAGG - Intronic
1071216460 10:83408326-83408348 TAAAATAATTTGTAGAAATATGG - Intergenic
1071320544 10:84451572-84451594 TAGAAAAATTAGTAGAAATTAGG + Intronic
1071326908 10:84527030-84527052 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1072168225 10:92834635-92834657 TCTAATAATTATAAGGAAAACGG + Intergenic
1072471590 10:95718638-95718660 TAGAATTAGAAGAAGGAAAAAGG - Intronic
1074426007 10:113352028-113352050 AAAAAAAATTAGAAGTAATAAGG + Intergenic
1076030791 10:127156226-127156248 TAGCATAATTAGAAGGCTCAGGG - Intronic
1077838151 11:5943184-5943206 TAGAGAAAATAGAAGGAAAAAGG + Intergenic
1078745751 11:14112821-14112843 TGGAAGAATTAGAAGGAGCAAGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078811280 11:14767767-14767789 CAGAATATTTAGAGGGAAAAAGG - Intronic
1079286979 11:19143606-19143628 TGGACTAACTAGAAGAAATACGG + Intronic
1079335291 11:19565336-19565358 TTGAATAATTTGAAAGATTAGGG - Intronic
1079390806 11:20020492-20020514 GATAATAATTAGTAGGGATAAGG - Intronic
1079887259 11:26003793-26003815 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1080343805 11:31298295-31298317 TAGCATATTTAGAGGGGATAAGG - Intronic
1081262490 11:40977996-40978018 AAGAAGAATAAGAAGGAATTAGG - Intronic
1081430014 11:42966724-42966746 TAGAATTCCTAGAAGGAAAATGG - Intergenic
1081996811 11:47370710-47370732 AATAATAATTAAAAGAAATATGG + Intronic
1082995777 11:59254102-59254124 TAGAATTATGAAAAGCAATAAGG - Intergenic
1084923382 11:72491284-72491306 TAGATTTATTATAAGGAATTTGG - Intergenic
1085227893 11:74939020-74939042 TAGAAAATGTAGAAGGAATGAGG - Intronic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1085601444 11:77859523-77859545 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1085951525 11:81338261-81338283 TAGCATAAAAAGAAGGTATAAGG + Intergenic
1086441659 11:86834798-86834820 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1087026558 11:93655467-93655489 TAGAATCTTCAGAGGGAATATGG + Intergenic
1087407096 11:97744186-97744208 AAGGATATTTAGAAGGAAAAAGG + Intergenic
1087811917 11:102617343-102617365 TAAAAAAATTAGAAGCAAAAAGG - Intronic
1088517369 11:110652802-110652824 TAGTATAGTTTGAAGCAATATGG - Intronic
1088608892 11:111558418-111558440 TAGGATTATTATAAGGATTAAGG + Intronic
1088768359 11:113007994-113008016 TAAAAAAATTTGAAGTAATAAGG + Intronic
1089089720 11:115861209-115861231 AAGAAAAAGTAGAAGGAGTAAGG + Intergenic
1089231968 11:116985826-116985848 TAGAATAATTACAAACAAAAAGG + Intronic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1091835347 12:3581980-3582002 TGGAATTATTAGTAGGAATTAGG - Intronic
1093348671 12:18070447-18070469 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1094035719 12:26068357-26068379 TAGAAGAAAAAGAAGGAAAAGGG - Intronic
1094806779 12:34101709-34101731 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1094823526 12:34247738-34247760 TAAAAAAATTACAAGGCATACGG - Intergenic
1095373854 12:41502824-41502846 TAGAATAATAAGTAAGGATATGG + Intronic
1095495629 12:42780783-42780805 TAGATAAATTAGAGGGAATTTGG + Intergenic
1095650391 12:44600965-44600987 TAAAAAAATAAGAGGGAATAGGG + Intronic
1096351752 12:50906452-50906474 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1096945403 12:55401668-55401690 TAAAAAAAATAGAAGAAATATGG + Intergenic
1097960927 12:65531420-65531442 CAGAAAAGATAGAAGGAATAGGG + Intergenic
1097969937 12:65622856-65622878 TAAAAGAATTAGGAGGACTAAGG + Intergenic
1098983734 12:76987000-76987022 GTGAATAATTGGAAGGCATAGGG + Intergenic
1099160774 12:79239010-79239032 TAGGATAATTTGGAAGAATAAGG - Intronic
1099706856 12:86165177-86165199 TAGGATAATTAGATTGATTATGG + Intronic
1099739499 12:86614409-86614431 CAGAATAATTAAAGGGATTATGG + Intronic
1101467136 12:104959618-104959640 AAGTATAATTGCAAGGAATATGG + Intergenic
1101774896 12:107784767-107784789 TAGAAAAATTCAAAGCAATATGG + Intergenic
1103117237 12:118346612-118346634 TTGAATAATTAGCAGAAATGTGG + Intronic
1103528579 12:121583769-121583791 TGAAATCATTAGAAAGAATAAGG - Intergenic
1104057980 12:125245098-125245120 TAGAATTATTTCAAGGGATACGG - Intronic
1104451994 12:128877072-128877094 AAGAATAATAAGAATAAATAAGG - Intronic
1104851169 12:131874865-131874887 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1105288154 13:19024755-19024777 GAGTATAATTACTAGGAATAGGG - Intergenic
1105520843 13:21129577-21129599 TTGAATGATTAGATGGAAAATGG - Intergenic
1106437622 13:29737665-29737687 TAGAATACTTAGAATGTACAAGG - Intergenic
1106751307 13:32771654-32771676 TAGAAAAATTACATGGAAGATGG - Intronic
1107284114 13:38770561-38770583 TTGAATAATTAAAAGTAATATGG - Intronic
1108430490 13:50348315-50348337 TAGAATAATTGGGAGGGATGGGG + Intronic
1109272870 13:60273682-60273704 TAAAATAATTAGAAATAAGATGG - Intergenic
1109549178 13:63870786-63870808 TAGTATCATTAGGAGGAATAGGG - Intergenic
1109713676 13:66191901-66191923 TTGAATATTTAGAAGAACTATGG + Intergenic
1109864257 13:68242127-68242149 TAGAACTACTAGAAAGAATAGGG + Intergenic
1110485010 13:76029050-76029072 TGGATTAACTAGAAGGAAGATGG + Intergenic
1110579740 13:77107884-77107906 TAGTAAACTTAGGAGGAATATGG + Intronic
1110854454 13:80280736-80280758 TAGAATCATTATAAGAAATGTGG + Intergenic
1111022293 13:82467726-82467748 CAAAATAAATAGAATGAATAAGG - Intergenic
1111120615 13:83844052-83844074 TAGAATAATCAAGAAGAATATGG - Intergenic
1111369259 13:87294981-87295003 TAAAATAAATAGATGGGATAAGG + Intergenic
1111448642 13:88385015-88385037 TGGAATCATGAGAAGGAATGAGG + Intergenic
1112904271 13:104397949-104397971 TACAAAAAATAGAAAGAATAAGG - Intergenic
1114161420 14:20172179-20172201 GAGTATAATTACTAGGAATAGGG - Intergenic
1114358982 14:21949222-21949244 TCAAATAATTGGATGGAATAAGG - Intergenic
1114384636 14:22242470-22242492 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1115101758 14:29709733-29709755 TAGAATAAAAAGAATGACTAGGG - Intronic
1116050198 14:39793384-39793406 TAGAATAATCAGGAGGAGAACGG - Intergenic
1116141176 14:40995874-40995896 TAGAAGATGTAGAAGGAAAATGG + Intergenic
1116180900 14:41533119-41533141 TAGCATAACTAGAAGCAATCAGG - Intergenic
1116447128 14:45023008-45023030 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1116769221 14:49107874-49107896 TATATTTATAAGAAGGAATAAGG + Intergenic
1118087629 14:62436506-62436528 CACAATAATTAGAGGTAATAGGG - Intergenic
1118463625 14:66010939-66010961 TTGAATAATTGTAAGGAACATGG - Intergenic
1118522938 14:66607091-66607113 ATGAATAATAAGAATGAATAAGG + Intronic
1118926436 14:70194192-70194214 TTGAACAATGAGAAGGCATAGGG - Intergenic
1119110901 14:71972849-71972871 GAGAATAATGAGGAGGAATGAGG + Intronic
1119935086 14:78585110-78585132 GAGAAAAATAAGAAGAAATAGGG + Intronic
1119980069 14:79070637-79070659 TAGAATAATAGTAAGGAAAATGG - Intronic
1120315296 14:82885210-82885232 TAGAATAAGTAGAATCAGTACGG + Intergenic
1120340806 14:83218406-83218428 GAGAATAATTAGAATCCATATGG - Intergenic
1120380120 14:83766627-83766649 TAGAAAACTTAGGATGAATAAGG - Intergenic
1120590495 14:86368371-86368393 TTGAATTAGTAGAATGAATAAGG - Intergenic
1121956854 14:98221836-98221858 TAGAATAATAACCAGGCATAAGG + Intergenic
1124956178 15:34362047-34362069 TAGAATAAATAAAAGGAAGTGGG - Intronic
1125419142 15:39486789-39486811 AAGACTAAGTAGAAGGAATACGG - Intergenic
1125617630 15:41029777-41029799 CTGAATAATTAGGAGGAAAAAGG + Intronic
1126327616 15:47498285-47498307 TAGAATAGGAAGGAGGAATAAGG - Intronic
1126553436 15:49959432-49959454 TAGAATAATACAAAGTAATATGG - Intronic
1126949594 15:53866556-53866578 AAGAATAGTTAGAAACAATAAGG + Intergenic
1127073963 15:55308388-55308410 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127743749 15:61941640-61941662 TTTCATAATTAGAAGAAATAAGG + Intronic
1128359387 15:66950473-66950495 TAGAGCAATTTGGAGGAATAAGG - Intergenic
1135224833 16:20646711-20646733 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1137962110 16:52892276-52892298 TAAAATAACTGGAAAGAATAAGG + Intergenic
1139270279 16:65675436-65675458 TAGATTTATTATAAGGAATTTGG - Intergenic
1139842100 16:69889915-69889937 TAGAATAAAGAGATGGGATAAGG - Intronic
1140350964 16:74261578-74261600 GAGAATACTTAAAAGGAAAAGGG + Intergenic
1141852187 16:86653998-86654020 TAGAATTATGAGAAGGGACAAGG - Intergenic
1143041181 17:4038055-4038077 TAACATATTTAGAAGTAATATGG + Intronic
1144610341 17:16706572-16706594 TAGCCTAATTAGAAGGGGTAGGG - Intronic
1144902401 17:18608849-18608871 TAGCCTAATTAGAAGGGGTAGGG + Intergenic
1144928661 17:18837130-18837152 TAGCCTAATTAGAAGGGGTAGGG - Intergenic
1145130097 17:20337255-20337277 TAGCCTAATTAGAAGGGGTAGGG - Intergenic
1145716087 17:27023015-27023037 GAGTATAATTACTAGGAATAGGG - Intergenic
1145823370 17:27857752-27857774 TATAATATTTAAAAGGAAAATGG - Intronic
1146889017 17:36492942-36492964 TAGAATAAGTCGAAGGAAAAGGG + Intronic
1148996621 17:51715989-51716011 AATAATAATTAGAAAGAATGAGG - Intronic
1149273760 17:55012643-55012665 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1149918002 17:60629709-60629731 AAGATTAATGAGAAGGAATCAGG - Intronic
1150214284 17:63457986-63458008 TAGAATAAATAAATGGACTAGGG + Intergenic
1151121755 17:71800635-71800657 TAGAATGAGTAGAAGAAACAAGG + Intergenic
1151769635 17:76151709-76151731 TAGCATCATGAGGAGGAATAAGG + Intronic
1153060868 18:993938-993960 AGGAAAAATTTGAAGGAATATGG + Intergenic
1153617317 18:6946850-6946872 AAAAATTATTAGAAGGGATAGGG + Intronic
1154084405 18:11289023-11289045 TATAATAATTAGAAAGGAGATGG + Intergenic
1155303812 18:24459164-24459186 TAAAATAGTCAGATGGAATATGG - Intergenic
1155582606 18:27326790-27326812 TAGACAAATTAGAAAGAATATGG + Intergenic
1155583964 18:27343605-27343627 TAGGATAATTAGAAGTACTCTGG + Intergenic
1156055332 18:32995623-32995645 TATATTCTTTAGAAGGAATATGG - Intronic
1156859313 18:41817752-41817774 TAGAATATTAAGAAGGGATTTGG - Intergenic
1157911842 18:51623783-51623805 TAGGATTATTTGAAGCAATAAGG + Intergenic
1158495116 18:57948502-57948524 TACAATAATGAGAAAGAATCAGG - Intergenic
1159214976 18:65380815-65380837 TAAAATCATTTGAAGGATTAGGG + Intergenic
1160009420 18:75093317-75093339 TAAAAGAAGTAGAAGAAATAGGG - Intergenic
1160293353 18:77615985-77616007 ATGAATAATTAAAAAGAATAAGG - Intergenic
1162132078 19:8532490-8532512 TAGAATGATTAACTGGAATAGGG + Intronic
1163900945 19:20099770-20099792 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1163946695 19:20543521-20543543 TTGTACAAATAGAAGGAATATGG - Exonic
1164132243 19:22374711-22374733 TGGAAGAATTAGAATGAACATGG + Intergenic
1165018436 19:32902059-32902081 TAGATTTTTTGGAAGGAATAGGG - Intronic
1165182490 19:33984586-33984608 TTGAATAAGTAGATGTAATATGG + Intergenic
1166420980 19:42635552-42635574 TGGAAGAATCAGAAGGAATGTGG + Intronic
1167012170 19:46815896-46815918 GAAAAGAATTAGAAGGAACAGGG + Intergenic
1167347071 19:48953138-48953160 TAGAATTTTTAGTAGGGATAGGG + Intergenic
1167773564 19:51539516-51539538 GATAATTATTGGAAGGAATAAGG - Intergenic
1168460309 19:56549758-56549780 TTGAATAATTTGTATGAATATGG + Intronic
925578735 2:5387570-5387592 AAGAAGATTTAAAAGGAATAGGG - Intergenic
925696479 2:6585574-6585596 TAGAATAATTACAAAGAGTAGGG + Intergenic
926276981 2:11411447-11411469 CAGAATAGTGAGAAGGAAAAGGG - Intergenic
927282680 2:21323989-21324011 TAGAAAAATTAGATGCTATACGG - Intergenic
927764774 2:25796486-25796508 CAGAATAATTAGCAGTAATTAGG + Intronic
928476556 2:31632828-31632850 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928543478 2:32307139-32307161 TAGAATAATATGAAGTAATCAGG + Exonic
928677414 2:33663225-33663247 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928903539 2:36347178-36347200 AACAATAATGATAAGGAATATGG + Intergenic
929308200 2:40390394-40390416 TAGAATAATTAGCAGGAAGCAGG - Intronic
929753615 2:44743321-44743343 TAGAATCATTATAATGACTACGG + Intronic
930214053 2:48674536-48674558 TATAAACATAAGAAGGAATAGGG + Intronic
930631649 2:53760177-53760199 TAGAATTAGGAGAAGGAAAAAGG + Intronic
930756336 2:54977268-54977290 CAGAAAAATTAGAAGGAAGTGGG - Intronic
931508559 2:62961211-62961233 TAGAAAAATTAAAAGGTTTATGG - Intronic
931597623 2:63967208-63967230 TACAAAAATTAGAATGAATATGG + Intronic
932562441 2:72885316-72885338 GAAAAAAATTAGAATGAATAAGG - Intergenic
933174929 2:79164399-79164421 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
933547599 2:83734926-83734948 TAGTTTAATTTGAAGGAAAATGG + Intergenic
933848487 2:86346766-86346788 TAGAAAAATGGTAAGGAATAAGG - Intergenic
934668877 2:96195009-96195031 TAGAATGAAAAGAAAGAATAAGG + Intronic
935309462 2:101769405-101769427 TAGAATTTTGAGAAGAAATAAGG + Intronic
935501811 2:103850197-103850219 TATAAGGATTAGAAGGAATGAGG + Intergenic
935526524 2:104175843-104175865 AACAAAAATTAGCAGGAATATGG + Intergenic
936387197 2:112041035-112041057 TAGAATTAGGAGAAGGAAAATGG - Intergenic
936791065 2:116152859-116152881 CAGAAGAATTAGAAGGCAAAAGG - Intergenic
937760260 2:125592397-125592419 TAGAAAAACTAGAAAGAGTAAGG + Intergenic
937840067 2:126515869-126515891 TAGCATCATTACAAGGAAGAAGG + Intergenic
938338761 2:130521677-130521699 TAAAATAATTATAATGAATAAGG - Intronic
938351079 2:130599073-130599095 TAAAATAATTATAATGAATAAGG + Intronic
938698522 2:133855907-133855929 TTGAATAATTAGACAGAAAAAGG - Intergenic
939420909 2:141967162-141967184 TAGAGAAATTAGAAGTAGTAAGG - Intronic
939465799 2:142554666-142554688 TAAAATAATAAAAAGGTATAAGG - Intergenic
939622693 2:144439466-144439488 CAGAATAATTAGAGTTAATATGG + Intronic
939696908 2:145337543-145337565 TAGGATAATAAGTAGGCATACGG - Intergenic
939785835 2:146511064-146511086 TAAAATAATTTTAAGAAATATGG - Intergenic
940245897 2:151615573-151615595 AAGAATAAATAGAAGTAGTAAGG + Intronic
940739229 2:157488199-157488221 CAGAATAACTAGAATGACTATGG - Intronic
940765689 2:157787515-157787537 TAGAATAATCTGGAGGAACAGGG + Intronic
940843874 2:158618460-158618482 CATAATATTTAAAAGGAATATGG + Intronic
940950594 2:159668677-159668699 TAAACTAAGTAGAAGGAAGAAGG - Intergenic
942580321 2:177410469-177410491 TAGAATTAGGAGAAGGAAAAAGG - Intronic
942816596 2:180060106-180060128 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
942819177 2:180090726-180090748 TAGAAAAATCTGATGGAATAAGG + Intergenic
942900716 2:181114115-181114137 TAGAAGAATTAGAAAAAAAATGG - Intergenic
943419279 2:187649870-187649892 TAGTATGACTAGAAGTAATACGG - Intergenic
943804745 2:192110543-192110565 TAGAAGAAATAGAAAGAATTGGG - Intronic
944039237 2:195335876-195335898 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
945141942 2:206696200-206696222 TAGAAAGAAGAGAAGGAATAAGG + Intronic
945312444 2:208330295-208330317 TAGAATTATCAGAAGGTAAAAGG + Intronic
945611250 2:212006190-212006212 AAGAATAATTAGAAAGATTCTGG - Intronic
945764437 2:213957641-213957663 AAGAATATTTATAAGGTATATGG - Intronic
1168741070 20:191928-191950 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1169647506 20:7829666-7829688 TGGAAGAAGTAGAATGAATATGG - Intergenic
1169764919 20:9138744-9138766 TAGAATAATTAGAAGGAATAAGG - Intronic
1171169730 20:23005094-23005116 AAGAACAATGAGAAGGATTAGGG + Intergenic
1172968289 20:38854852-38854874 CAGAAGAATTAGAAAGAAAAAGG - Intronic
1173393116 20:42652816-42652838 TAGAATAATCAGAATGGATCTGG + Intronic
1174977446 20:55350977-55350999 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1175017105 20:55803487-55803509 TAGAAAAATTAGAAATAAAAGGG - Intergenic
1175360202 20:58403992-58404014 TAGAATACTAAGAAGCAAAAGGG - Intronic
1176972453 21:15282260-15282282 CAGAATAATTTGAAGGAATTAGG - Intergenic
1177243881 21:18497344-18497366 TATCATAATTAGAATGTATAGGG - Intergenic
1177429334 21:20970401-20970423 TATTATAATTAGGAGGAAAAAGG + Intergenic
1177443566 21:21161761-21161783 TAGAGTAATTAGAAGAGCTAGGG + Intronic
1177562193 21:22770728-22770750 TAGAAAAATAATAAGTAATATGG - Intergenic
1177903387 21:26945496-26945518 TACAATAATAAAAAGGCATATGG - Intronic
1178021807 21:28416867-28416889 GAGAAAAAATAGAAGGGATAGGG - Intergenic
1178721439 21:35014052-35014074 TGGAATAATTACTAGGATTATGG + Intronic
1178899389 21:36587144-36587166 AAGAAGATTTAGAAGAAATATGG - Intergenic
1179258809 21:39740488-39740510 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1179396218 21:41042817-41042839 AAGAAAAATAAGAAGGAAGACGG - Intergenic
1182980313 22:34664258-34664280 TAGAAAAACTAGAGGGAAAAAGG + Intergenic
1183206216 22:36420936-36420958 TAGAATAATTCAAAGGTACATGG - Intergenic
949758164 3:7437994-7438016 AAATATAATGAGAAGGAATACGG + Intronic
950325280 3:12102683-12102705 AACAATAAATTGAAGGAATATGG - Intronic
950335961 3:12193336-12193358 TAGATTAAATAAAAGTAATATGG - Intergenic
950757277 3:15185891-15185913 GAGAATAAATAGAAAGAAAATGG - Intergenic
951191493 3:19777338-19777360 CAGAGTAATTTGAAGAAATATGG + Intergenic
951574903 3:24103536-24103558 TAGAATAATTAGGACTAATTGGG - Intergenic
951635807 3:24774739-24774761 TAATACATTTAGAAGGAATAAGG - Intergenic
951686254 3:25347942-25347964 TAGACTAATTGGAAGTAGTAAGG - Intronic
955445943 3:59009546-59009568 TAGAACAAGTAGAAGAAATTTGG + Intronic
955991419 3:64631769-64631791 AAGAACCATGAGAAGGAATATGG - Intronic
956093967 3:65696537-65696559 TAAAATAATTAAAATGATTAAGG + Intronic
956569191 3:70674907-70674929 AAGAATAAGTAGAAGAAACAGGG - Intergenic
956648388 3:71479766-71479788 CAGAAAAATTATAAGGATTAAGG + Intronic
956999953 3:74874060-74874082 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
957122006 3:76105795-76105817 TCCAATAAGGAGAAGGAATATGG + Intronic
957212241 3:77274231-77274253 TAGGAAAATTAGAAAGCATATGG + Intronic
957447138 3:80327516-80327538 TAGAAAAAATAGAAGTGATAAGG + Intergenic
957710257 3:83848191-83848213 GAGAATTATTACAAGGAATTGGG - Intergenic
957764623 3:84606833-84606855 TAGAAGAATAAAAAGGAATGGGG + Intergenic
958569012 3:95855715-95855737 TACAATAAATAGAAGAAATATGG + Intergenic
958894124 3:99811302-99811324 CAGAATCATCAGAAGGAAAATGG - Intergenic
960005330 3:112775638-112775660 TAGAATAATTTTCTGGAATAAGG - Intronic
960194850 3:114753158-114753180 GAGGATAATTAGAAGTAATGGGG + Intronic
960203393 3:114865737-114865759 CAGTATAATTTGAAGGAAAAAGG + Intronic
960444231 3:117728170-117728192 TAGGATAATTATTATGAATAAGG + Intergenic
960529432 3:118746457-118746479 TAGAATATTAAGAAAGAAAATGG - Intergenic
960611721 3:119560652-119560674 TTGAATAGTTGCAAGGAATATGG + Intergenic
961908954 3:130294201-130294223 TAGAATAGTTAAAATGAAAAAGG + Intergenic
962495781 3:135937657-135937679 TAGAATTAAGAGAAGGAAAAAGG + Intergenic
963188291 3:142442095-142442117 TAGAATTAGGAGAAGGAAAAAGG + Intronic
963614882 3:147524013-147524035 TAGACCAATGAAAAGGAATAGGG - Intergenic
963916090 3:150860092-150860114 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
964346971 3:155763754-155763776 TAAAAAAAGGAGAAGGAATATGG - Exonic
964842134 3:161005866-161005888 TAAAATTATTAGAAGAAATCAGG + Intronic
965825269 3:172723294-172723316 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
965919765 3:173898117-173898139 TAGAATTGTTACAAGTAATAGGG - Intronic
966353891 3:179058902-179058924 TAGAATTAGGAGAAGGAAAAAGG + Intronic
967464974 3:189794481-189794503 TAGAAATATAAGAAGGAATGAGG + Intronic
967623878 3:191664339-191664361 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
967640218 3:191853643-191853665 TAGAATAATTGTATGGAAGATGG - Intergenic
968391065 4:193451-193473 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
969920072 4:10530077-10530099 TAAAATAACTAAAAAGAATACGG - Intronic
970380677 4:15504191-15504213 TTGCATAATTATAAGGAATGTGG + Intronic
970553098 4:17203930-17203952 TGGAAAAATCAGAAGGAAGAGGG + Intergenic
970743979 4:19273075-19273097 GAGAATAAATAAAAGTAATATGG + Intergenic
970942135 4:21646927-21646949 AAGAATGATTAGAAGAAATTGGG - Intronic
971340462 4:25764026-25764048 TAGCAAATGTAGAAGGAATAAGG + Intronic
971775118 4:30953379-30953401 TAGAAAAATTAGAAAGACTGGGG - Intronic
972468614 4:39382917-39382939 TGAAATAATTAAAAAGAATAGGG - Intergenic
972752596 4:42006823-42006845 GAAAAAAATTAAAAGGAATATGG - Intronic
972781025 4:42287039-42287061 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
974282062 4:59807889-59807911 TAGAAATATTAGCATGAATAAGG + Intergenic
974550402 4:63365064-63365086 TAGAATATTTATAAGCACTAGGG - Intergenic
974745293 4:66065484-66065506 TGGAGTAATTAGAAGGACTAGGG - Intergenic
974804687 4:66862764-66862786 AAAAAAAATTAGAAGGCATAAGG + Intergenic
976464623 4:85353355-85353377 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
976568887 4:86585781-86585803 TAGAAAACTTAGGAGGAAAATGG - Intronic
976843192 4:89456053-89456075 TGGAATAAATACAAGGAACAAGG - Intergenic
977026747 4:91828940-91828962 TAGATTAACTAGAGGGCATAAGG - Intergenic
977361370 4:96010603-96010625 GAGAATGATTAGATGGAAGAAGG + Intergenic
977617904 4:99105995-99106017 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
977636752 4:99306978-99307000 TAAAGTAATTAAAAGTAATATGG - Exonic
977790586 4:101096479-101096501 GAGAATAAATAGAAAGGATAAGG - Intronic
977851618 4:101837007-101837029 TAGAAAAATTGGGAGGAAAAAGG - Intronic
977963503 4:103114877-103114899 TAGAAATATTTGAAGGTATAAGG + Intronic
978066462 4:104409508-104409530 TAGGTTAATCAGAATGAATACGG + Intergenic
978074941 4:104516730-104516752 TATAATACTTAGAAGTATTAAGG - Intergenic
978286156 4:107079509-107079531 TTGAATAAACAGAAGGAATGTGG - Intronic
978586465 4:110280433-110280455 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
978845728 4:113270528-113270550 TATTTAAATTAGAAGGAATAAGG - Intronic
978976948 4:114888951-114888973 TAAAAAAATAAGAAGAAATAAGG - Intronic
979030426 4:115637266-115637288 TAGAATAATTAGTAGTACTGAGG - Intergenic
979302994 4:119108705-119108727 TAGAATAAATAGAAGACATTAGG + Intergenic
979845130 4:125499442-125499464 CAGAATAATCAGAAAAAATATGG - Intergenic
980444553 4:132887889-132887911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
980881725 4:138717370-138717392 TATTAAATTTAGAAGGAATAAGG + Intergenic
980998621 4:139806116-139806138 TAAAATAATTAGAAGTTACAAGG + Intronic
981140394 4:141260619-141260641 TAAAATAATTAAAAGGAATCAGG + Intergenic
982228396 4:153186390-153186412 TAAAAAAATCAGAAGAAATATGG + Intronic
982406657 4:155027966-155027988 GAAAATAATTAGAACGATTAAGG + Intergenic
982580510 4:157173196-157173218 CAGAATAGTTTGAAGGAAAAAGG - Intergenic
982713658 4:158784053-158784075 TAGCATAATTAGTGGAAATAGGG + Intronic
982866824 4:160523780-160523802 TAGGATAAATTGAAGGAATGTGG - Intergenic
982901263 4:161005584-161005606 TGGTATAATTAGGAGGAAAAAGG + Intergenic
982975401 4:162050859-162050881 TAGATTAACTAGAAGAAATTAGG + Intronic
983185363 4:164694581-164694603 TAGAATAAATATAAGAAAAATGG + Intergenic
983403336 4:167293873-167293895 TAAATTTATTATAAGGAATAAGG + Intergenic
984148283 4:176092035-176092057 TAGAATAATTTGAGGAAATTTGG - Intronic
984375070 4:178920449-178920471 TAGTAGAATAAGAAGGAATGGGG + Intergenic
984535487 4:180969685-180969707 GAGAATAGATAGAAGGAGTAAGG + Intergenic
984724064 4:183003154-183003176 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
985991214 5:3563425-3563447 TACAAGAATGAGAAGGCATATGG + Intergenic
986512450 5:8522679-8522701 GAGAATAATTTGACGGTATATGG - Intergenic
986568476 5:9139872-9139894 TAGAAGAATCAGAAGGAATCGGG - Intronic
986947780 5:13045884-13045906 TAGAATAATGAAAAGAAAGAAGG - Intergenic
987238295 5:15965919-15965941 TAAAATAAATAAAAGTAATATGG + Intergenic
987480592 5:18451897-18451919 GAGAGTAATTCAAAGGAATATGG - Intergenic
988337986 5:29930864-29930886 GAGAAAAATGAGAAGGAAAAAGG - Intergenic
988956980 5:36329923-36329945 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
989219440 5:38939669-38939691 TTGAATAATTGGGAGGAATCTGG - Intronic
989485418 5:41985170-41985192 TAGAATATTTAGTAGGATAATGG - Intergenic
989760660 5:45012322-45012344 TAGAATATTGAAAAAGAATAAGG - Intergenic
990462335 5:56041008-56041030 AAAAATAATAATAAGGAATAGGG - Intergenic
990648673 5:57873506-57873528 TAGGATAAGTAACAGGAATAGGG - Intergenic
990833079 5:59982546-59982568 TAGAATCCTTAGGAGGAATTAGG - Intronic
991382916 5:66050999-66051021 TACAATAAATAGAAGTAGTAAGG + Intronic
992007371 5:72491077-72491099 TATAATTATTTGAAGAAATAAGG + Intronic
993132123 5:83912101-83912123 CTGAATAATTAGAAGGAAAAAGG - Intergenic
993173765 5:84455313-84455335 TACAATGATTAAAAGTAATATGG - Intergenic
993382938 5:87228728-87228750 TAGAAGAATTAAAAGTAATAGGG + Intergenic
994720832 5:103378437-103378459 TAGAATAGCTTGAAGGGATAAGG - Intergenic
994897743 5:105726517-105726539 TAGAACAACTGGAAGGAAGATGG + Intergenic
995114468 5:108463861-108463883 TACAATAAGTAGAAGGTATAGGG - Intergenic
995277689 5:110295496-110295518 TTGAAAAATTAGAGGGAAAAGGG - Intronic
995465968 5:112449799-112449821 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
995554849 5:113316999-113317021 TTGAATAACTAAAAGGAATCAGG - Intronic
996045610 5:118869777-118869799 TAAGATAATTAGAAGTAAAATGG - Intronic
997621020 5:135295368-135295390 TAATATAAGCAGAAGGAATAGGG - Intronic
998616178 5:143743004-143743026 TAGAATAATTTTAAGAAATTAGG + Intergenic
999052300 5:148535688-148535710 CAAAATAATTAAAAGGAATAAGG + Intronic
999967925 5:156829832-156829854 TTGTATAATTAGAAGAAAAAGGG - Intergenic
999981927 5:156966152-156966174 TAGAATGACTAGAAGAGATAGGG + Intergenic
1000754660 5:165143211-165143233 TAAAATACTGAGAAGGAATTTGG - Intergenic
1001509459 5:172309114-172309136 GAGAATGAGCAGAAGGAATATGG + Intergenic
1001515040 5:172349736-172349758 TAGACTAATTAGAAGGTTTCTGG + Intronic
1001739762 5:174042836-174042858 TTGATTATATAGAAGGAATAAGG + Intergenic
1002154872 5:177269160-177269182 TTCAATAATTAGTAGGAATATGG - Intronic
1003238856 6:4323816-4323838 CAGAATGAGTAGAAGGGATATGG - Intergenic
1005331161 6:24751958-24751980 TAAAATAATTACAAGTAAAATGG - Intergenic
1005594883 6:27369317-27369339 TAGAATATCTAAGAGGAATAAGG - Intergenic
1005828426 6:29650826-29650848 TAGAAAAATTAGAAACGATATGG - Intergenic
1006278766 6:33029323-33029345 CAGAATAATGAGAATTAATACGG - Intergenic
1007540711 6:42641161-42641183 TAAAATAATTAAAATAAATAAGG + Intronic
1007870454 6:45030701-45030723 TAGAATAATTATGGGGAGTAAGG + Intronic
1007968276 6:46024110-46024132 TAGAATATTTTGAGGGAATTGGG + Intronic
1008460177 6:51759746-51759768 TAGAATAGTTATAAGGATTGAGG - Intronic
1008644036 6:53495248-53495270 TAGAATATTGAGAATGAAAAGGG + Intergenic
1008941503 6:57050623-57050645 CAGAATAATTAGAAACAAAACGG - Intronic
1009212406 6:60878183-60878205 TAAAATAGCTTGAAGGAATAGGG + Intergenic
1009227494 6:61032488-61032510 TATAATAATCAGAAGGAAAGAGG - Intergenic
1009619448 6:66053998-66054020 CAAAATCATTGGAAGGAATAGGG - Intergenic
1010130722 6:72490522-72490544 CAAAATAATTAAAAGAAATATGG + Intergenic
1010194947 6:73229778-73229800 TAGAACAATTAGAAAGAAGGAGG - Intronic
1010374134 6:75146760-75146782 AAAAATAATTGGAAGCAATATGG - Intronic
1010483418 6:76381439-76381461 TAAAATAATTAGAAAGAATCAGG - Intergenic
1010544961 6:77141689-77141711 TAGAATAATTAGAATAATTCTGG + Intergenic
1010893788 6:81342933-81342955 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1011077110 6:83449153-83449175 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1011238478 6:85244240-85244262 TGGAAAAATTAGAAACAATAAGG + Intergenic
1011579345 6:88841879-88841901 TAGAAGTTTTAGAAGGGATAAGG - Intronic
1011968715 6:93194553-93194575 TTGAATATTAAGAAGGAATTTGG + Intergenic
1012609222 6:101194838-101194860 TAGAATAATGATAAAAAATATGG + Intergenic
1012723267 6:102776358-102776380 AAGAATATTTAGAAGCAAAAGGG + Intergenic
1013543880 6:111136848-111136870 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1013680018 6:112514710-112514732 TAGAAGAATGAGAAGGTAAAGGG + Intergenic
1013924762 6:115457780-115457802 TACAAAAATTAGAAAGAATTAGG + Intergenic
1014030558 6:116697418-116697440 TAGAAAAATGAAAAGGAAGAAGG + Intronic
1014681413 6:124435160-124435182 CTGGATAACTAGAAGGAATATGG + Intronic
1015079591 6:129207680-129207702 TAGAAGAATTAGGAGCAAAAGGG + Intronic
1015081449 6:129230390-129230412 GAGAATAAGAAGAAAGAATATGG + Intronic
1015865159 6:137720170-137720192 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1017230258 6:152065879-152065901 TGGAATAATAAAGAGGAATATGG + Intronic
1017262940 6:152408398-152408420 TATAATAATTTTAAGTAATAAGG - Intronic
1017310592 6:152972090-152972112 TAGTATAATTAGAACTATTAGGG - Intronic
1020028846 7:4919152-4919174 CAGAATTATTAGAAAGATTAGGG + Intronic
1020508197 7:9019651-9019673 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1020552908 7:9629653-9629675 TAAAATACTTAGGAGGACTAAGG - Intergenic
1020732757 7:11904712-11904734 TAAAATAATTAGGACTAATAAGG + Intergenic
1022757957 7:33314450-33314472 TTTGACAATTAGAAGGAATAGGG + Intronic
1023037287 7:36143287-36143309 TCCAATATTTAGAAGAAATAAGG + Intergenic
1023272497 7:38479846-38479868 AAAAATAAGTAGAACGAATAAGG + Intronic
1023422253 7:39993265-39993287 TAGAATGATTAAATGGGATATGG - Intronic
1024470552 7:49765532-49765554 TGGAATAATTAGGATGCATAAGG + Intergenic
1024927469 7:54632572-54632594 TATACTAAGCAGAAGGAATAGGG + Intergenic
1027710603 7:81596068-81596090 TATGATAATTAAAAAGAATATGG - Intergenic
1028074639 7:86496852-86496874 TAAAATCATTAGAAGGCAGAAGG + Intergenic
1030337635 7:108343223-108343245 CAGTAGAATTAGAAGGAAAAAGG + Intronic
1030528721 7:110685472-110685494 AACAATAATAACAAGGAATAAGG + Intronic
1030843170 7:114380318-114380340 TAGAATTAGGAGAAGGAAAATGG - Intronic
1032753553 7:134866263-134866285 TGAAATAATAAGAAGGAAAATGG + Intronic
1033333584 7:140434612-140434634 TAGAATTTTTAAATGGAATAAGG - Intergenic
1033823407 7:145160932-145160954 TAGAGTTCTTAGAAGGAACATGG - Intergenic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035650352 8:1259457-1259479 TGGTCTAATTAGAAAGAATAAGG + Intergenic
1037383595 8:18314107-18314129 TACAATAATTACAAGCAAGAGGG + Intergenic
1037781286 8:21870951-21870973 AAGAATGATTAAAAGCAATAAGG + Intergenic
1037978471 8:23231997-23232019 TAGGATAATTAGGAGAAAGAAGG + Intergenic
1038890208 8:31713095-31713117 AAAAAAAATTAGAAGGAGTATGG - Intronic
1039164297 8:34659795-34659817 AATAAAACTTAGAAGGAATAGGG - Intergenic
1041405794 8:57497903-57497925 CAGAATAATTAGGAGAAATCGGG + Intergenic
1041663538 8:60421524-60421546 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1042056222 8:64767116-64767138 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1042214015 8:66410962-66410984 TACAAAAATTAAAAGGTATAAGG + Intergenic
1042243536 8:66688494-66688516 TAGAATAATTAGAGGAAAGGAGG - Intronic
1042364602 8:67922384-67922406 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1042435440 8:68759122-68759144 TAGAATGATTAAGAGGAATATGG - Intronic
1043109222 8:76157389-76157411 TAGAATCTTCAGAAGGAATTCGG - Intergenic
1043240861 8:77933769-77933791 AATAATAATTAGAATGGATATGG - Intergenic
1043242636 8:77955024-77955046 TATAATTATTAAAAAGAATATGG - Intergenic
1043262732 8:78222120-78222142 TAGAAAAATTAAAAGGAATAGGG + Intergenic
1043849432 8:85199163-85199185 CAGAATAATGAGAGGGAAAATGG - Intronic
1044059111 8:87612127-87612149 TAGAGTCATTAGAAAGAATTTGG - Intronic
1044640571 8:94376484-94376506 TAGAGTAAATACAAGGAAAAAGG + Intronic
1046408755 8:113811367-113811389 AAGTAAATTTAGAAGGAATAAGG + Intergenic
1046826456 8:118696743-118696765 TAGAAGAAAATGAAGGAATAAGG - Intergenic
1046976205 8:120280874-120280896 AAGAATAAACATAAGGAATATGG - Intronic
1047059870 8:121213350-121213372 CAGAATGATTTGAAGGAAAAGGG + Intergenic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1048923784 8:139252924-139252946 AAGAGTAATTATAAGGACTATGG - Intergenic
1050838617 9:10117008-10117030 TAGTATAATTAGAAGCATAAGGG - Intronic
1051221616 9:14854410-14854432 TAGAAAGATTAAAAGGAAAAGGG + Intronic
1053603883 9:39637412-39637434 CAGAACAATTAAAAGGACTAAGG + Intergenic
1053861700 9:42393459-42393481 CAGAACAATTAAAAGGACTAAGG + Intergenic
1054249658 9:62705002-62705024 CAGAACAATTAAAAGGACTAAGG - Intergenic
1054563768 9:66739534-66739556 CAGAACAATTAAAAGGACTAAGG - Intergenic
1054732083 9:68711578-68711600 TAGAATCATTAGAATAATTATGG - Intronic
1055652646 9:78421650-78421672 TATCACAATTACAAGGAATATGG - Intergenic
1056704594 9:88941239-88941261 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1058558300 9:106195247-106195269 TGAAATAATTAAAAGGAATCAGG - Intergenic
1059042046 9:110825583-110825605 AAGTATAGTTAGAATGAATAAGG + Intergenic
1059145957 9:111899677-111899699 TATAATAATTTGGAGGAATAAGG - Intronic
1059609706 9:115879244-115879266 GAGAATTATTAAAAGGAAAAAGG + Intergenic
1059738852 9:117129828-117129850 TACAACAATAAGAAGGAACAAGG - Intronic
1059820628 9:117968415-117968437 AAGAATAATTGAGAGGAATATGG - Intergenic
1186349680 X:8729693-8729715 TTTAATAATTAGAAGGAAGATGG - Intronic
1186855299 X:13620634-13620656 TAGAATACTTAGGAGAAATATGG - Intronic
1186889527 X:13946750-13946772 TAGAATAATAAAAAGAAATAAGG + Intergenic
1186948930 X:14600483-14600505 GAAAATAATTAGATGGCATATGG - Intronic
1186986953 X:15027521-15027543 TAAAATAATTAAAAAGAATTTGG - Intergenic
1187637491 X:21246928-21246950 TACGACAATTAGAAGGAAAATGG + Intergenic
1188798018 X:34490414-34490436 TATTATAACTAGAAGAAATAAGG - Intergenic
1190392976 X:49950971-49950993 AAAAATAACTAGAATGAATAAGG - Intronic
1190901179 X:54674525-54674547 TAGAATATTTAGCAAAAATATGG - Intergenic
1191046911 X:56148272-56148294 AAGAATAATTGGAAGAATTAGGG - Intergenic
1191975455 X:66866210-66866232 TAAGATGATTAGAAGAAATAAGG - Intergenic
1194127547 X:90038969-90038991 AAGAAAAATAAGAAGGAAAATGG + Intergenic
1194209529 X:91054611-91054633 TAAAATATTCAGAAGAAATAAGG + Intergenic
1194431322 X:93810450-93810472 TAGTATAAATGGAAGGAACATGG - Intergenic
1194956947 X:100192066-100192088 TAGAATAATTTGACAGAATTGGG - Intergenic
1195463237 X:105151403-105151425 TAGAATAATTAGAGAGAAAAAGG + Intronic
1196478667 X:116120577-116120599 TGAAATAATTAAAAAGAATAAGG - Intergenic
1196657674 X:118236009-118236031 TAGCAAGAGTAGAAGGAATAAGG + Intergenic
1197674287 X:129312905-129312927 TAGAACCATTATAAAGAATAAGG + Intergenic
1197954478 X:131931258-131931280 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1198577144 X:138023029-138023051 TAAAATAATTGGAAGTCATATGG + Intergenic
1199058923 X:143330022-143330044 TAAAATAATTAAAATGAATCAGG + Intergenic
1199943434 X:152647208-152647230 TAGAATATTCAGTAGGAAGAAGG - Intronic
1200948294 Y:8867478-8867500 TGCAATTATTAGAAGCAATATGG + Intergenic
1200949806 Y:8885520-8885542 TTGAAAAGTTAGAATGAATATGG - Intergenic
1201221008 Y:11770276-11770298 TAGTATAATTAGTATGACTAAGG - Intergenic
1201416667 Y:13754103-13754125 TGTAATAATTAGAAGGAAGATGG + Intergenic
1201724004 Y:17134344-17134366 TAGAATTAGGAGAAGGAAAATGG - Intergenic