ID: 1169765049

View in Genome Browser
Species Human (GRCh38)
Location 20:9139912-9139934
Sequence TTTCTTTGAAGGGGCTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 365}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169765039_1169765049 27 Left 1169765039 20:9139862-9139884 CCATCCAGTCACCTGTGGTTGAC 0: 1
1: 0
2: 1
3: 11
4: 110
Right 1169765049 20:9139912-9139934 TTTCTTTGAAGGGGCTGAGGTGG 0: 1
1: 0
2: 1
3: 42
4: 365
1169765044_1169765049 0 Left 1169765044 20:9139889-9139911 CCAAGTCTTGTGCTATTAAAGAT 0: 1
1: 0
2: 0
3: 14
4: 190
Right 1169765049 20:9139912-9139934 TTTCTTTGAAGGGGCTGAGGTGG 0: 1
1: 0
2: 1
3: 42
4: 365
1169765043_1169765049 16 Left 1169765043 20:9139873-9139895 CCTGTGGTTGACAGGGCCAAGTC 0: 1
1: 0
2: 0
3: 12
4: 93
Right 1169765049 20:9139912-9139934 TTTCTTTGAAGGGGCTGAGGTGG 0: 1
1: 0
2: 1
3: 42
4: 365
1169765041_1169765049 23 Left 1169765041 20:9139866-9139888 CCAGTCACCTGTGGTTGACAGGG No data
Right 1169765049 20:9139912-9139934 TTTCTTTGAAGGGGCTGAGGTGG 0: 1
1: 0
2: 1
3: 42
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169765049 Original CRISPR TTTCTTTGAAGGGGCTGAGG TGG Intronic
900291477 1:1925500-1925522 GCTCTGTGCAGGGGCTGAGGAGG + Intronic
901001998 1:6153515-6153537 TTTGATGGAAGGGGCTGAGGGGG - Intronic
901417549 1:9128352-9128374 TTCCTTGGACGGGGCTGGGGAGG - Intronic
901527537 1:9833343-9833365 ATTCTTTGATGAGGCTGAGACGG + Intergenic
902168528 1:14592253-14592275 TCTCTTGGAGGGGGATGAGGAGG + Intergenic
902701862 1:18177915-18177937 TTTATCTGAAGGGGCAGGGGTGG + Intronic
902749381 1:18496619-18496641 GCACTTTGAGGGGGCTGAGGTGG + Intergenic
902785810 1:18731898-18731920 TTTCTCAGAAGGGGCTTGGGTGG - Intronic
903350649 1:22714484-22714506 TTACTTTGATGTGTCTGAGGAGG + Intronic
903681301 1:25099027-25099049 CTTCTCTGAAGGGGCTGGGCTGG + Intergenic
903780720 1:25818513-25818535 TTTGTTTGGTGGGGCTGGGGGGG + Intronic
904296974 1:29526150-29526172 TTTCTTCCAAGTGGCTGGGGAGG + Intergenic
904897601 1:33828599-33828621 TTTCCATGTAGGGGCTGATGTGG + Intronic
905775441 1:40664929-40664951 TTTCTTTTATGGGGTGGAGGGGG + Intronic
905968247 1:42117332-42117354 TGTCTTTGAAGGGGCAGAGAGGG + Intergenic
906984295 1:50666452-50666474 GCACTTTGAGGGGGCTGAGGTGG - Intronic
907124803 1:52040334-52040356 GTTACTTGAGGGGGCTGAGGTGG - Intronic
908145979 1:61244296-61244318 AGGCTTTGAAGGGGTTGAGGTGG + Intronic
908215207 1:61944156-61944178 TTTCTTTGGAGGAGAAGAGGCGG - Intronic
908673881 1:66579175-66579197 TTTCTTTTAAGAAGCTAAGGTGG + Intronic
908674059 1:66581911-66581933 TTTCTTTTAAGAAGCTAAGGTGG + Intronic
909080330 1:71103187-71103209 GTTCTTTGAAAGGGCTGAATGGG - Intergenic
909711710 1:78658621-78658643 TTTATTTGAAGGGGCAGAGAAGG - Intronic
909750340 1:79152062-79152084 TTTCCTTGATGGGATTGAGGTGG + Intergenic
910457876 1:87417327-87417349 TTACATTGAATAGGCTGAGGAGG + Intergenic
910558763 1:88566946-88566968 CTTCTTTGTTGGGGCAGAGGAGG - Intergenic
911680500 1:100710016-100710038 TTTCTTTTAATAGACTGAGGAGG + Intergenic
912061603 1:105678746-105678768 TTTCTATTAATGGGCTGTGGAGG + Intergenic
913617181 1:120572659-120572681 TTTCTTTTAAGGGGCTCATTAGG - Intergenic
914315143 1:146503804-146503826 TTACATTGAATAGGCTGAGGAGG + Intergenic
914499211 1:148229572-148229594 TTACATTGAATAGGCTGAGGAGG - Intergenic
914573095 1:148938255-148938277 TTTCTTTTAAGGGGCTCATTAGG + Intronic
915599714 1:156914543-156914565 TTGCCTTGAAGAGGCTGAAGAGG + Intronic
916369072 1:164068744-164068766 TTTCTTTGGAAGGGAAGAGGGGG + Intergenic
917229795 1:172823589-172823611 CCTTATTGAAGGGGCTGAGGTGG - Intergenic
918450851 1:184656543-184656565 TTTCTTTGAACTGGCTGAGTGGG - Intergenic
919192048 1:194233235-194233257 TTTATTTTAAGTGGCTGAGTAGG + Intergenic
922186129 1:223276335-223276357 TTTCTGTACAGGGGCTGTGGAGG - Intronic
922941070 1:229466660-229466682 TTCCATTGAATGGGCTGAAGTGG - Exonic
1063400157 10:5736048-5736070 GCTATTTGAGGGGGCTGAGGTGG - Intronic
1063736039 10:8756198-8756220 TTTGTTTGAAGGGGCGGGGACGG - Intergenic
1063809620 10:9689868-9689890 TTTCTTTGAAGATGCAGAGGTGG + Intergenic
1066802482 10:39206803-39206825 TTTCTTTTAAGGGTTTGAGGAGG + Intergenic
1068136417 10:52954246-52954268 TTTCTTTGAAGGGTTTAAGGAGG + Intergenic
1068873361 10:61969540-61969562 ATTTTGTGAAGGTGCTGAGGAGG + Intronic
1069628520 10:69882876-69882898 CTTCCTGGAAGGAGCTGAGGGGG - Intronic
1070903003 10:80047322-80047344 TCTCAGTGAAGGGGGTGAGGAGG + Intergenic
1071481250 10:86066781-86066803 TTTCCTTAAAGGGGAGGAGGTGG - Intronic
1075008157 10:118845250-118845272 TCTCTTTGAAGAGGAGGAGGTGG + Intergenic
1075175501 10:120156945-120156967 CTACTTTGAAGTGGCAGAGGGGG + Intergenic
1075295288 10:121269912-121269934 TCCCTTTGAAGGAGCTGGGGAGG + Intergenic
1075858921 10:125656919-125656941 TTTCTCTGAAAAGTCTGAGGAGG + Intronic
1078064675 11:8070619-8070641 TTTCTTTAAAGTTCCTGAGGGGG - Intronic
1078216006 11:9312386-9312408 GCTATTTGAGGGGGCTGAGGTGG + Intronic
1078286154 11:9958076-9958098 TTTCTTTGAGGGACCTGAGAGGG - Intronic
1078408448 11:11091883-11091905 CTACTTAGAAGGGGCTGCGGGGG - Intergenic
1078493774 11:11795763-11795785 TTTCTTTGGAGGGGATTATGAGG - Intergenic
1080721950 11:34858196-34858218 TTTCATTGAAGGGGTAGAAGTGG - Intronic
1081240574 11:40700937-40700959 TTTCTTTGAGGGGAGTGAGTTGG - Intronic
1081296569 11:41397334-41397356 TTTCATTGAGCAGGCTGAGGAGG - Intronic
1083632301 11:64102084-64102106 TTTCTTTGTAGGGCCTAAGGTGG - Intronic
1084033766 11:66495636-66495658 TGGCTTTGAGGGGGCTGATGCGG + Exonic
1084060697 11:66671992-66672014 GCACTTTGAGGGGGCTGAGGCGG - Intronic
1085804925 11:79626790-79626812 CTTCTTTTTAGGGCCTGAGGAGG + Intergenic
1085856811 11:80184535-80184557 GAGCTTTGAAGGGGCTGAGGTGG - Intergenic
1089231201 11:116978368-116978390 TTTCTTGGAGTGGGATGAGGTGG - Intronic
1089325302 11:117652792-117652814 TGCCTTTTATGGGGCTGAGGGGG - Intronic
1089349651 11:117815143-117815165 TGTATTTGCAGGGGCTGTGGGGG + Intronic
1089686281 11:120149010-120149032 TTTCTTTGAAGTTGCTGACTAGG + Intronic
1090081980 11:123619548-123619570 TCTCTGTAAAAGGGCTGAGGGGG - Intronic
1092528850 12:9327658-9327680 TTTCTTTTAAGGGTTTGAGGAGG + Intergenic
1093718929 12:22415250-22415272 TTTCTTTGAAAATGCTGAAGAGG + Intronic
1095456539 12:42391613-42391635 TTTTTTTCCAGGGGGTGAGGGGG - Intronic
1095757430 12:45784549-45784571 CTACTTTCAGGGGGCTGAGGCGG + Intronic
1096234609 12:49917717-49917739 CTCCTTTGAAGGGGCTCAGAGGG - Intergenic
1096257476 12:50072277-50072299 TTTCTCTGCAGGGCCAGAGGAGG - Intronic
1097688340 12:62711672-62711694 AGTGTTTGAAGGGTCTGAGGGGG + Intronic
1097878196 12:64662903-64662925 TGTGTTTTAAGGGGCTCAGGGGG + Intronic
1098028353 12:66229730-66229752 TTGCTTTCAAAGGGCTGAGGTGG + Intronic
1099462206 12:82937526-82937548 TATCTTTTGAGGGGGTGAGGGGG + Intronic
1099623632 12:85036806-85036828 TTTCTTTACAGGGGTTGAAGGGG + Intronic
1101656568 12:106726374-106726396 TTTTATTGAAGGGAATGAGGTGG - Intronic
1102069260 12:110003773-110003795 TTTGATTGAGGAGGCTGAGGTGG + Intronic
1105048191 12:133024665-133024687 ATTCATTGAAGGGGGTCAGGAGG - Exonic
1106430965 13:29680235-29680257 TTTTTTGGCAGGGGCTGGGGGGG + Intergenic
1106510267 13:30407034-30407056 TTTCTTATAATGGGCTGTGGTGG - Intergenic
1106670129 13:31896477-31896499 TTCCCGTGGAGGGGCTGAGGAGG + Intergenic
1107200693 13:37713518-37713540 TTTCTTTGAAGGGACTATGTTGG - Intronic
1107931501 13:45311351-45311373 TTTTTTTTGAGGGGCGGAGGTGG + Intergenic
1108558568 13:51620715-51620737 TTTCTTTGATGTAGCTGAGCCGG + Intronic
1109940037 13:69349697-69349719 CTTCTTTGAAGGAGAAGAGGTGG + Intergenic
1110169076 13:72478929-72478951 TTTCTTAGAAGAGTTTGAGGAGG - Intergenic
1112216510 13:97435449-97435471 TTTTTTGGAAGGGGTTAAGGCGG - Intronic
1112478071 13:99750195-99750217 ATCCTTTGAGGGGGCTGAGGGGG - Intronic
1112903876 13:104392967-104392989 TTTGTGTGAATCGGCTGAGGCGG - Intergenic
1113353453 13:109553186-109553208 TAACTTTGAAGGGGGAGAGGTGG + Intergenic
1113366294 13:109679743-109679765 TTTTTTTGAAGGGGCGGGGGAGG + Intergenic
1114139382 14:19893850-19893872 TGTCTGTGTGGGGGCTGAGGGGG + Intergenic
1114141993 14:19922746-19922768 TTTCTTTGAAGTGACGGAAGAGG - Intergenic
1114315003 14:21501704-21501726 TCTCTTGGAAGGGAATGAGGTGG - Intronic
1114659471 14:24335226-24335248 CTTCCCTGAAGGGGCTGAAGCGG - Intronic
1114769813 14:25416159-25416181 TTTCTTGTAAGGGGTAGAGGTGG - Intergenic
1115251835 14:31356867-31356889 TATCTTTGATGGGTCTAAGGTGG - Intronic
1115401561 14:32967157-32967179 TTTCATTGAGTAGGCTGAGGAGG - Intronic
1116085557 14:40232878-40232900 TTTCTCTGAACAGGCTGAGTAGG + Intergenic
1116639115 14:47438364-47438386 TTTCTTTGAAGGTGGTGGGATGG - Intronic
1116824022 14:49653763-49653785 GTTCTATGAAGAGGCTGAGATGG - Intronic
1117494009 14:56283733-56283755 TTTATTTAAAGAGGCTGAGCTGG - Intronic
1117907280 14:60603458-60603480 TTTCTCTAATGGGGCAGAGGGGG + Intergenic
1118190001 14:63571642-63571664 TTCCGTTGAAGGGGAAGAGGGGG + Intergenic
1118492153 14:66271772-66271794 TTCCTTAGAAGGGGGTGAGTTGG - Intergenic
1119581257 14:75783569-75783591 TTTCTTTATTGGGGCTGGGGAGG - Intronic
1120133163 14:80831283-80831305 TATCTTTTAAGGGGTTGAGCGGG - Exonic
1120262830 14:82209245-82209267 TTAAGTTGAATGGGCTGAGGAGG + Intergenic
1120793424 14:88606622-88606644 CTACTTGGTAGGGGCTGAGGTGG + Intronic
1120950493 14:90036802-90036824 TTTTTTTTAAGGGGCGGGGGAGG - Intronic
1121162152 14:91753741-91753763 TTTCTTTGAAGGGCTTTTGGTGG - Intronic
1121544621 14:94754376-94754398 TTTCTCTGAAGGTGCTCAGGAGG - Intergenic
1123818902 15:24006477-24006499 TTTCCCTGAAGGGTCTGTGGGGG + Intergenic
1124225509 15:27890163-27890185 TTTTTTTAAAAGGGCAGAGGTGG + Intronic
1125331009 15:38581789-38581811 TTTCTTTGGAGGAGGAGAGGCGG - Intergenic
1125861194 15:43002324-43002346 GTTACTTGAGGGGGCTGAGGTGG - Intronic
1127448274 15:59088362-59088384 TTTCTTTGAAGATGTTTAGGAGG + Intronic
1128234559 15:66058935-66058957 TCCCAGTGAAGGGGCTGAGGTGG - Intronic
1130551382 15:84891870-84891892 TTTGTTTGTACGAGCTGAGGTGG + Intronic
1130879021 15:88039050-88039072 TTTTCTTGAAGCTGCTGAGGTGG + Intronic
1130969247 15:88719104-88719126 TTTCTTTGGGGTGGGTGAGGTGG + Intergenic
1131641304 15:94296998-94297020 TCTCCTTGAAGGAGCTGGGGTGG + Intronic
1132245966 15:100296557-100296579 TTTGTTTGGAGGGGGTGAGGGGG + Intronic
1132251536 15:100339289-100339311 TATCTGTGAAGGCGCCGAGGTGG - Intronic
1133416789 16:5613119-5613141 TTTCTTTGAGGGGCCTCAGTTGG + Intergenic
1133922579 16:10166819-10166841 TTACATTGAGGAGGCTGAGGAGG - Intronic
1137006052 16:35275193-35275215 TTTCTTTTAAGGGTTTTAGGAGG + Intergenic
1137375467 16:47948273-47948295 TTTTTTTGAGGGGGGTGGGGTGG + Intergenic
1137625139 16:49903015-49903037 TTTGTGTGAAGGGGTTGAGGGGG + Intergenic
1138522630 16:57579604-57579626 ACTCTCTGAGGGGGCTGAGGTGG + Intronic
1140168520 16:72579633-72579655 CTACTTGGAAGTGGCTGAGGTGG - Intergenic
1140266189 16:73423162-73423184 ATTTTTTGCAGGGGCTGGGGAGG + Intergenic
1140700226 16:77574752-77574774 TTTTTTGGCAGGGGCTGAGGGGG + Intergenic
1140701992 16:77589462-77589484 CTTCTTTGATGGGGCAGAGCCGG + Intergenic
1140712273 16:77689460-77689482 TTTCTTTTAGGCAGCTGAGGTGG - Intergenic
1140932416 16:79640161-79640183 ATTCTTTGTTGGGGGTGAGGGGG - Intergenic
1141207816 16:81947019-81947041 TTTCTGTGAAGTGTCTGCGGAGG - Intronic
1142181448 16:88672840-88672862 TTTCTGGGAAGGAGCTGGGGTGG + Intergenic
1143120043 17:4600703-4600725 TTTTATGGAAGGGGCTGAGTCGG + Intronic
1143159999 17:4863394-4863416 TTTATTTGAAATGGCTGAAGGGG + Intronic
1145790046 17:27620891-27620913 TTTCCTCGAAGGGGCTGGGCAGG - Intronic
1146120408 17:30188974-30188996 TTTTTTTGAGGGGGGTGTGGAGG + Intergenic
1146728224 17:35172811-35172833 TTTCTTGGAGAAGGCTGAGGTGG - Intronic
1147473150 17:40683428-40683450 TTTCTTTGAAAGGTCAAAGGAGG - Intergenic
1147595698 17:41715769-41715791 CTTCTTGGACGGGTCTGAGGAGG - Exonic
1148067076 17:44879555-44879577 TTTCATTGATGCTGCTGAGGGGG - Exonic
1148145463 17:45361827-45361849 TTTCTTTGAAGGGGCTTCTGGGG - Intergenic
1148376711 17:47154672-47154694 CTTTTTTGAAGGGGCTCCGGTGG + Exonic
1148392217 17:47280726-47280748 GTTGCTTGAGGGGGCTGAGGAGG + Intronic
1148581421 17:48746782-48746804 TTTCTTTGGAGGGACTGATGAGG + Intergenic
1148645781 17:49219191-49219213 TAACTTTGATCGGGCTGAGGAGG - Intronic
1148869930 17:50651610-50651632 ATACTTTGGCGGGGCTGAGGCGG + Intronic
1150160928 17:62897195-62897217 TCTCTTTGCAGTGGCAGAGGTGG + Intergenic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1151130884 17:71894937-71894959 TTCCTTTGCAGGGGAAGAGGGGG - Intergenic
1151144331 17:72026958-72026980 TTTCTTTGAAGGGGAAAAAGAGG + Intergenic
1151472035 17:74324635-74324657 TCTCTTTCGAGAGGCTGAGGTGG + Intergenic
1151537516 17:74747350-74747372 TTTCTTTGAAGTGAGTGGGGGGG + Intergenic
1153544474 18:6191991-6192013 TTTTTTTGAGGGGGGGGAGGAGG - Intronic
1153769475 18:8403678-8403700 TTTCTTTGAGGGGGCTAAGTGGG - Intronic
1153934356 18:9907751-9907773 TTACGTTGAGTGGGCTGAGGAGG + Intergenic
1154315728 18:13301820-13301842 TTTCTCTGCAGGGTCTGAGGTGG + Intronic
1155046526 18:22108386-22108408 TTTTTTTGTAGGGGGTGGGGAGG + Intergenic
1155744057 18:29328659-29328681 GTTTTTTGAAGAAGCTGAGGCGG + Intergenic
1156117644 18:33805405-33805427 TTTCTTTGTAGGGGGTCAGAAGG + Intergenic
1157046696 18:44108660-44108682 TTACATTGAATAGGCTGAGGAGG - Intergenic
1157638706 18:49189308-49189330 TTTTTTAAAAGGGGTTGAGGTGG + Intronic
1157675018 18:49562280-49562302 TTTCTTGGGAGGGGGTGTGGCGG + Exonic
1157798421 18:50597947-50597969 TCTCTTTGAAGAAGCTGAGCTGG + Intronic
1157992139 18:52510104-52510126 TTTTTTTGAAGGGGATGCAGGGG - Intronic
1158541691 18:58362129-58362151 TCTCCTGGCAGGGGCTGAGGAGG - Intronic
1161683624 19:5692651-5692673 GTCCTTTCAAGGGGCTGTGGTGG - Intronic
1162041483 19:7973558-7973580 TTGGTTTGAGGAGGCTGAGGAGG - Intronic
1164472778 19:28550000-28550022 TTTCTTCTAAGTGGCTCAGGAGG + Intergenic
1165221566 19:34320831-34320853 CTACTTGGAAGAGGCTGAGGTGG - Intronic
1165272628 19:34723898-34723920 TTTCTTTTAAGGGTTTTAGGAGG - Intergenic
1166774083 19:45302096-45302118 GTTCTTTGAAGGAACTGATGTGG + Intronic
1168365563 19:55784050-55784072 TTTATCAGAAGTGGCTGAGGAGG + Intergenic
925281004 2:2684615-2684637 ATTCTTTGAGGTGGCTGATGAGG - Intergenic
925462092 2:4072437-4072459 TTTCTCTTGGGGGGCTGAGGAGG + Intergenic
926063897 2:9822094-9822116 ACTCTTTGAAGGAGTTGAGGTGG - Intergenic
926300826 2:11600947-11600969 TCTCGTTGTAGGGGCTGATGAGG - Exonic
927291419 2:21408494-21408516 TGTCTTGGGAGGGGCTGTGGTGG + Intergenic
928087241 2:28353369-28353391 TTTTTTTGGAGGGGGTGCGGGGG + Intergenic
929003884 2:37376714-37376736 TGTGTTCCAAGGGGCTGAGGTGG + Intergenic
929494091 2:42424421-42424443 TTTTTTTAAAGGGACGGAGGGGG - Intronic
929878984 2:45820400-45820422 TTTATTTGGAGGGGGAGAGGGGG + Intronic
930086557 2:47501775-47501797 GGTCTTTGAAGGGGTGGAGGTGG + Intronic
932262202 2:70336395-70336417 TTTTTTTGAAGGGTCTAAGAAGG + Intergenic
932496068 2:72146349-72146371 TTTCTTTGCGGGGGGTGGGGGGG + Intronic
932510419 2:72282063-72282085 TTTGTTGGCAGGGGGTGAGGAGG - Intronic
932629729 2:73329433-73329455 TTTTATGGAAGGGGCTCAGGGGG + Intergenic
933286333 2:80388275-80388297 TATCTTTGAGGGGAATGAGGAGG + Intronic
933361256 2:81288261-81288283 TTTCTTGGAAGAGTTTGAGGAGG + Intergenic
935107195 2:100055529-100055551 TTTAGTTGGAGGGGCTGAGGAGG + Intronic
935365102 2:102280626-102280648 TCTCTTAGAAGAGGCTGAGCTGG + Intergenic
935837769 2:107074161-107074183 TTTCTTTGGAGGTGCTGGGCAGG + Intergenic
938003175 2:127762921-127762943 TTTTTTTGAAGAGCCTGAGACGG + Intronic
938595637 2:132784599-132784621 TTTCTTTAAAAGGTCTGAAGAGG - Exonic
939570289 2:143832606-143832628 TTTCTAAGAACTGGCTGAGGAGG + Intergenic
941159982 2:162024873-162024895 TTTCTTTGCAGTGGCTCAGGAGG - Exonic
941985892 2:171511427-171511449 TTGCTTTGAAGTGGAGGAGGGGG + Intergenic
942735231 2:179102995-179103017 TTTCTGTGATGAGGTTGAGGGGG - Exonic
946402663 2:219476789-219476811 GATCTTGGGAGGGGCTGAGGAGG + Intronic
947548544 2:231029647-231029669 TTTTGTTGAAGGGACTGGGGAGG - Intergenic
1169098784 20:2927638-2927660 TTTCTTTGACGGGGGTGCAGGGG + Intronic
1169765049 20:9139912-9139934 TTTCTTTGAAGGGGCTGAGGTGG + Intronic
1170331963 20:15222966-15222988 TTTCTTTGAAAGAGGTGTGGGGG - Intronic
1171811490 20:29747113-29747135 CTTTTTTGAAGGGGCTCCGGTGG - Intergenic
1171867043 20:30493907-30493929 CTTTTTTGAAGGGGCTCCGGTGG - Intergenic
1171994303 20:31720359-31720381 ATCCATTGAAGGAGCTGAGGTGG - Intronic
1172011343 20:31847809-31847831 TGTCTTTGAAGAAACTGAGGCGG - Intronic
1172640719 20:36438932-36438954 TTTAAGTGAAGGGGCTGAGCTGG + Intronic
1175176921 20:57117890-57117912 TTGCTTTGATGGGGCGGGGGTGG - Intergenic
1176254865 20:64146639-64146661 CTTCTCTCAAGGGTCTGAGGAGG + Intergenic
1176553499 21:8242065-8242087 CTTTTTTGAAGGGGCTCCGGTGG + Intergenic
1176572421 21:8425089-8425111 CTTTTTTGAAGGGGCTCCGGTGG + Intergenic
1176580330 21:8469649-8469671 CTTTTTTGAAGGGGCTCCGGTGG + Intergenic
1177022306 21:15877179-15877201 TTTCTGTGAAGGGCCAGACGAGG - Intronic
1178253132 21:31023728-31023750 TGGCTTTGCAGGGGCTCAGGAGG - Intergenic
1178522465 21:33297921-33297943 TTTATTTGAAGGAACTGTGGAGG + Intergenic
1179287142 21:39987174-39987196 TTCTTTTGAGGGGGGTGAGGGGG - Intergenic
1182090191 22:27589393-27589415 TTTATTTGAAGGGGCAGAAATGG - Intergenic
1182262441 22:29084014-29084036 TTTCCGGGAAGGGGGTGAGGAGG + Intronic
1182568141 22:31214795-31214817 TTTTTTTGTAGGGGGTGGGGAGG + Intronic
1183199108 22:36373580-36373602 TGTGATTGAAGGGGCTGAGGAGG - Intronic
1183583763 22:38740384-38740406 GCTCTGTGAAGGAGCTGAGGCGG - Exonic
1183959358 22:41402038-41402060 TGTCCTTGAAGGAGCTGGGGTGG - Intergenic
1184940864 22:47763917-47763939 TTTTTTTGAAGGTGGAGAGGCGG + Intergenic
1203258497 22_KI270733v1_random:159093-159115 CTTTTTTGAAGGGGCTCCGGTGG + Intergenic
950395539 3:12731289-12731311 TGTCTCTGAGGGGCCTGAGGAGG - Intergenic
951231436 3:20184226-20184248 TTTCTATAAAGTGCCTGAGGAGG - Intronic
951467422 3:23017311-23017333 TTTCTTTTATGGGGATGAGAGGG + Intergenic
951845049 3:27076477-27076499 GCACTTTGCAGGGGCTGAGGCGG - Intergenic
952227432 3:31392735-31392757 CCTTTTTGAAGGTGCTGAGGTGG - Intergenic
952930139 3:38353637-38353659 TTACCTTTAAGAGGCTGAGGTGG + Intronic
953284511 3:41593782-41593804 GAACTTTGAGGGGGCTGAGGTGG + Intronic
953474386 3:43193577-43193599 TTTTTTTGTAGGGGGTGAGGTGG + Intergenic
954419767 3:50412601-50412623 TTTTTTTGCAGGGGGTGGGGAGG + Intronic
955758618 3:62253128-62253150 TTTCTTTTAATGATCTGAGGTGG + Intronic
956397365 3:68840318-68840340 GTTATATGGAGGGGCTGAGGTGG - Intronic
957193038 3:77035198-77035220 TTACTAAGATGGGGCTGAGGGGG + Intronic
957922395 3:86762639-86762661 TTTCTTTGGTGGGGTTGGGGGGG - Intergenic
959024557 3:101225774-101225796 TTGCTTTGGAGGGGGAGAGGAGG - Exonic
960015898 3:112887478-112887500 TTGCATTGAATAGGCTGAGGAGG + Intergenic
960568310 3:119158337-119158359 TTTGTTTGTAGTGGGTGAGGTGG + Intronic
960631581 3:119737408-119737430 TTTCTTTGAAGGAAGCGAGGGGG - Exonic
960783296 3:121344441-121344463 TTTTTTTGTAAGGGCTTAGGGGG - Intronic
961933911 3:130563240-130563262 TGCCTTTGAAGGTGCTCAGGTGG - Exonic
962244907 3:133784353-133784375 TTTCTTTTAAAAGGCTGGGGGGG - Intronic
963135688 3:141901385-141901407 TTTCTTTTAGGGGGAAGAGGTGG + Intronic
963893101 3:150657914-150657936 TATCATTGAACTGGCTGAGGTGG + Intergenic
964424586 3:156538150-156538172 TTTTTTTGAAGGGGGTGGTGTGG + Exonic
965982528 3:174710987-174711009 TTTCTTTGATGTGGCTGTGTTGG - Intronic
966047838 3:175574514-175574536 TTTCTTTCAAAGGGCTGGTGAGG + Intronic
966596480 3:181728502-181728524 TTGGTGTGAAGGTGCTGAGGGGG - Intergenic
967340834 3:188395799-188395821 CTACTTTGGAGAGGCTGAGGTGG + Intronic
968242763 3:197106418-197106440 TTTCATTGAGGGGGGTGGGGGGG - Intronic
969249562 4:5958116-5958138 TCTTTGGGAAGGGGCTGAGGAGG - Exonic
969518331 4:7661255-7661277 TTTCCTTGAGTGAGCTGAGGGGG - Intronic
969518337 4:7661293-7661315 TTTCCTTGAGTGAGCTGAGGGGG - Intronic
969521183 4:7678575-7678597 TTTCCTGGAAGAGGCTGAGCAGG + Intronic
969524791 4:7698866-7698888 TTTCTTGGGGTGGGCTGAGGAGG + Intronic
970458340 4:16247603-16247625 CTTCTCTGAAGGAGTTGAGGTGG + Intergenic
973759888 4:54105913-54105935 TTTCTTTGAGGGAGATGGGGAGG + Intronic
975763430 4:77641037-77641059 TTCCTTTGAAGGGGATGATCTGG - Intergenic
976009244 4:80467496-80467518 TTTCTTTGAAAAGATTGAGGAGG - Intronic
976412729 4:84735310-84735332 CTTCCTTGAAGGGGCTTTGGGGG - Intronic
977561656 4:98539127-98539149 TTTTTTTGGTGGGGGTGAGGGGG - Intronic
978243574 4:106546015-106546037 TCACTTTGAATAGGCTGAGGGGG + Intergenic
979832907 4:125322533-125322555 TGTCTTTGAGGGGCCTGGGGAGG - Intronic
980055722 4:128077502-128077524 TTTTTTTGCAGGGGCGGGGGCGG - Intronic
982306330 4:153935070-153935092 CTTCTCTTAAGAGGCTGAGGTGG - Intergenic
982748565 4:159131847-159131869 TTTCTTTGTAGGGCCATAGGTGG + Intronic
984748674 4:183250433-183250455 TGTCCTTGAAGGTGCTGAGGTGG + Intronic
986205363 5:5620030-5620052 TTTCTGTAATGGGGCTAAGGAGG - Intergenic
986652714 5:9980182-9980204 TGTCTTTGAAGGGTGAGAGGTGG + Intergenic
987586928 5:19867126-19867148 TTTCTTTGCAGGAGGTGAGTGGG - Intronic
988610655 5:32721530-32721552 TTACTTGGGAGGTGCTGAGGTGG + Intronic
993314332 5:86380818-86380840 TTACTTGGGAGGGGCTGAGGTGG - Intergenic
995136035 5:108680923-108680945 ATTCTTTAAAGATGCTGAGGTGG + Intergenic
995622261 5:114039388-114039410 TGTCTTTGTAGGGGATGAGAGGG + Intergenic
996679599 5:126217134-126217156 CTACTTGGCAGGGGCTGAGGTGG + Intergenic
997244461 5:132335165-132335187 TTTCTGTGAAGGGGATGACTGGG - Intronic
997284980 5:132671522-132671544 GCACTTTGCAGGGGCTGAGGTGG + Intergenic
998975074 5:147636421-147636443 TTTCTTTGAAGGAGCTGGCAGGG - Intronic
999338049 5:150741050-150741072 TTTCTTTTAAATGGCTGAGGTGG + Intronic
1001070296 5:168579535-168579557 TTTGTTTGGAGCGGCTGCGGGGG - Exonic
1001934708 5:175695821-175695843 AGTCTTCGAAGGGGCTGAGGAGG + Intergenic
1003457778 6:6299801-6299823 TTTCTTTGGAGGAGGAGAGGCGG + Intronic
1005108367 6:22250535-22250557 GATTTTTGAAGGGGATGAGGGGG - Intergenic
1005667859 6:28076477-28076499 TTTCAATGAAGGGTCTGGGGAGG + Intergenic
1005823443 6:29616739-29616761 TTACTTGGGAGGGGCTGAGGTGG + Intronic
1006139585 6:31920392-31920414 TTTCAATGAAAGGGCAGAGGAGG + Intronic
1007721005 6:43885467-43885489 TTGCTTTGGAGGGTCTGAGCTGG + Intergenic
1007917174 6:45572197-45572219 TTACTTTAAAGTGGTTGAGGGGG - Intronic
1007986461 6:46211972-46211994 CTACCTTGGAGGGGCTGAGGTGG + Intergenic
1008155205 6:48005562-48005584 TTGCTATGAAGGTGGTGAGGTGG - Intronic
1009682979 6:66922886-66922908 TTTCTTTCAAGGATCTGGGGAGG + Intergenic
1011496542 6:87942291-87942313 TGTCTTCGAATGGGCTAAGGAGG + Intergenic
1011538516 6:88404463-88404485 TGTAGTTGAAGGGACTGAGGTGG - Intergenic
1012763164 6:103329722-103329744 TTTCTCTGAAGAATCTGAGGAGG + Intergenic
1012982616 6:105846235-105846257 TCACTTTGAGGAGGCTGAGGAGG + Intergenic
1013343139 6:109235123-109235145 TTTCTTTGTAGGGGGAGAGTAGG - Intergenic
1017155014 6:151315082-151315104 TTTCCTTGAAGGGACTGAGGTGG + Intronic
1017536631 6:155353573-155353595 TCTCTGAGAAGGGTCTGAGGTGG - Intergenic
1017770737 6:157642571-157642593 TTTCTTAGCAGGGGTTGTGGGGG + Intronic
1018307505 6:162473017-162473039 TTTCTTTGAAGGACCTGAGTAGG - Intronic
1019556825 7:1636035-1636057 TTCCTTTGAAGGGACTGGGATGG + Intergenic
1021334034 7:19376205-19376227 TTTCTTTCAAAGGGCAGTGGTGG - Intergenic
1022359438 7:29644228-29644250 TTTCTTTTAAGGGTTTTAGGAGG + Intergenic
1022849123 7:34241767-34241789 TTTATATGAAGGGGCTAGGGAGG + Intergenic
1023861305 7:44218995-44219017 TCTCTTGGGAGGGGCTGTGGGGG - Exonic
1025810789 7:64874288-64874310 TCTCATTGTGGGGGCTGAGGTGG + Intronic
1026581015 7:71617296-71617318 TTTTTTTGCAGGGGCGGGGGGGG + Intronic
1026645712 7:72166435-72166457 GCACTTTGAGGGGGCTGAGGTGG - Intronic
1026786398 7:73304311-73304333 TTGCTGTGAACTGGCTGAGGAGG - Exonic
1027145591 7:75691920-75691942 TTTCTTTGCAGGGGGTGGGGAGG + Intronic
1029592945 7:101519421-101519443 TTTTGTTGGAGAGGCTGAGGTGG - Intronic
1030460817 7:109833862-109833884 TATTTTTGGAGGGGCTAAGGCGG + Intergenic
1031789449 7:126082549-126082571 TTGCTTTGAGTGGGCTGAGAAGG - Intergenic
1032485352 7:132282987-132283009 TTACTTGGGGGGGGCTGAGGTGG - Intronic
1032504338 7:132424347-132424369 TATGGCTGAAGGGGCTGAGGAGG + Intronic
1033307678 7:140237151-140237173 GTTCTTTGAAGTTGCTGACGAGG + Intergenic
1036598613 8:10238732-10238754 TTTTTATGTAGGGGGTGAGGTGG - Intronic
1036953441 8:13162778-13162800 CTTTTTTGAGGGGGCTGGGGAGG - Intronic
1037132257 8:15421229-15421251 TTACTTTGAATGAGATGAGGGGG - Intronic
1037908830 8:22731307-22731329 TCACATTGAATGGGCTGAGGAGG - Intronic
1038515746 8:28186456-28186478 TGTCTTCCAAGGGGCTGAAGTGG - Intronic
1038648589 8:29381890-29381912 TTTCTTTCAAGGGGCAGCTGGGG + Intergenic
1040109241 8:43559183-43559205 TTTCTTTCAAGGGTTTTAGGAGG + Intergenic
1041176717 8:55204251-55204273 TTTATTTTAGGAGGCTGAGGTGG - Intronic
1041191221 8:55356859-55356881 TTACATTGAATAGGCTGAGGAGG - Intronic
1041602097 8:59731138-59731160 TCACTTTGAATAGGCTGAGGAGG - Intergenic
1042225396 8:66511143-66511165 CTTCCTTGAAGGGGATGGGGTGG + Intronic
1044590113 8:93906233-93906255 TGTGTTTGAAGGGGTGGAGGAGG - Intronic
1044709730 8:95044966-95044988 TTTCTTTTTAGGGGATGAGGTGG + Intronic
1044977546 8:97680317-97680339 GCACTTTGGAGGGGCTGAGGTGG - Intronic
1046757809 8:117989645-117989667 TTTCTTTTGAGTGGCTGAGTGGG - Intronic
1046892775 8:119441263-119441285 TTACTCTGATGAGGCTGAGGCGG - Intergenic
1046946254 8:119976853-119976875 TTTCTTTGCAGGGTGTGCGGGGG - Intronic
1047594489 8:126364673-126364695 TTTTTTTGCAGGGACTGGGGAGG - Intergenic
1047745974 8:127845223-127845245 CTTCATTGTGGGGGCTGAGGTGG + Intergenic
1047866587 8:129030688-129030710 TTTCTGTGAAGTTGTTGAGGGGG - Intergenic
1048589568 8:135808761-135808783 CTTCCTAGAAGGGGCTGAGTGGG - Intergenic
1048881120 8:138873335-138873357 TTTCTTTGGCGGGGGTGGGGTGG + Intronic
1050436441 9:5615364-5615386 CTTTTTTGAAGGGGGTGAGGAGG - Intergenic
1050464747 9:5910443-5910465 TTTGTTTGAAGTGGGAGAGGTGG - Exonic
1051274008 9:15381736-15381758 TTTCCTTCAAGTGGCTCAGGAGG - Intergenic
1051760927 9:20463266-20463288 TCTCTTTCAAGGGGGTGGGGGGG + Intronic
1053225610 9:36353318-36353340 ATCCTTTGCAGAGGCTGAGGAGG + Exonic
1054148471 9:61581607-61581629 TTTCTTTGAAGGAGCTTTGCTGG + Intergenic
1055479158 9:76692983-76693005 TTTTTTTGGAGGGGGGGAGGGGG - Intronic
1055930815 9:81558149-81558171 TTTCTTCAAAGGGGCAGAGAGGG + Intergenic
1055973139 9:81931162-81931184 TTTCGTTGTTGGGGCAGAGGTGG - Intergenic
1055974892 9:81946254-81946276 TTTCGTTGTTGGGGCAGAGGTGG - Intergenic
1056153615 9:83813851-83813873 GTACTTTGGAAGGGCTGAGGTGG + Intronic
1056356875 9:85809250-85809272 GTACTTTGGAAGGGCTGAGGTGG - Intergenic
1058142084 9:101367595-101367617 TTACTTAGCAGGGGCTGAGGAGG - Intronic
1058870541 9:109198109-109198131 TTTCTATGAAGGATATGAGGTGG + Intronic
1059242630 9:112820332-112820354 TTTTTTTGTAGCGGATGAGGGGG - Intronic
1059809653 9:117841563-117841585 TTTCCTTGAAGGGGATCTGGGGG - Intergenic
1061246110 9:129401950-129401972 TCTCTTGGATGGGGGTGAGGTGG - Intergenic
1061276712 9:129572904-129572926 TTACTGTGGAGGGGCGGAGGTGG - Intergenic
1203474692 Un_GL000220v1:141109-141131 CTTTTTTGAAGGGGCTCCGGTGG + Intergenic
1203362116 Un_KI270442v1:224979-225001 CTTTTTTGAAGGGGCTCTGGTGG - Intergenic
1185577804 X:1187540-1187562 TTTTTTTGTAGGGGTAGAGGTGG + Exonic
1185857049 X:3545271-3545293 CTACTTAGGAGGGGCTGAGGTGG + Intergenic
1186321783 X:8435371-8435393 TTTATTTAAAGGGGCTGAAATGG + Intergenic
1186806207 X:13142865-13142887 TTTTTTTGAAAGGGCTGATCCGG + Intergenic
1187292368 X:17967366-17967388 TTTCTTTCAAGGGTCTCAGATGG + Intergenic
1187415872 X:19092881-19092903 TTTCTTTGCAGGGAGTGAGGAGG - Intronic
1187923025 X:24224438-24224460 TTTTTTTGCAGGGGCGGGGGAGG + Intergenic
1189169876 X:38898606-38898628 TTTGTTTGGAGTGGCTGTGGTGG - Intergenic
1189375548 X:40463836-40463858 TTCCTCTGAAGGTGCTAAGGAGG + Intergenic
1190240463 X:48654251-48654273 TTTCTTTTAAGCAGCTGAAGAGG - Intergenic
1192372911 X:70529849-70529871 TTTCCTTGAAGGAGGTAAGGTGG + Exonic
1192487800 X:71545285-71545307 TTTTTTTTAAGGGGTTGGGGTGG - Intronic
1193730497 X:85096847-85096869 TTTTTTTGAGGGGGCTGGGGTGG - Intronic
1194978166 X:100413378-100413400 TGTCTCTAAAGAGGCTGAGGAGG - Intergenic
1195034812 X:100962708-100962730 TTACCTTGGAGGGGCAGAGGTGG - Intergenic
1195159696 X:102158959-102158981 TTACTTTCATGGGGCTGGGGAGG + Intergenic
1196214645 X:113036109-113036131 TGTCTTTGCAGGGGGTGAGGTGG + Intergenic
1196346468 X:114665721-114665743 TTTCATTGAGTGGGCTGAGGAGG + Intronic
1196361991 X:114872373-114872395 TTTCTTTGAAGGGGGAGATAAGG + Intronic
1198423026 X:136486976-136486998 TTTCTTTTAAGGGGCTGTTTAGG - Intergenic
1198444131 X:136694395-136694417 TGTCTTTGAAGGGCCAGAGAAGG - Intronic
1199223407 X:145343392-145343414 ATATTTTGGAGGGGCTGAGGTGG - Intergenic
1199590854 X:149467312-149467334 TATTTTTGATGGGGCTGGGGAGG - Intergenic
1199615685 X:149652964-149652986 ATTGTTAGAAGGGGCTGAGCTGG + Intergenic
1200323560 X:155215237-155215259 TTTTTTGGAAGGCACTGAGGTGG + Intronic
1200698363 Y:6381167-6381189 TCTCCTTGTAGGGGCTGTGGTGG - Intergenic
1200914207 Y:8557040-8557062 TCTCATTGTGGGGGCTGAGGTGG + Intergenic
1200932165 Y:8706887-8706909 TTTCCTTGTGGGGGCTGAAGTGG - Intergenic
1201035751 Y:9783532-9783554 TCTCCTTGTAGGGGCTGTGGTGG + Intergenic
1201283383 Y:12359847-12359869 TTTCTTTTAAGGGTTTGAGGAGG + Intergenic
1201389274 Y:13479769-13479791 TTTCCTTGCAGCCGCTGAGGAGG - Exonic
1201643029 Y:16199320-16199342 TTTCTTTTAAGGGTTTTAGGAGG - Intergenic
1201659786 Y:16386001-16386023 TTTCTTTTAAGGGTTTTAGGAGG + Intergenic
1202337299 Y:23825642-23825664 TTTCTTTTAAGGGTTTGAGGAGG - Intergenic
1202360663 Y:24106545-24106567 GCACTTTGAGGGGGCTGAGGTGG - Intergenic
1202510115 Y:25563573-25563595 GCACTTTGAGGGGGCTGAGGTGG + Intergenic
1202533467 Y:25844429-25844451 TTTCTTTTAAGGGTTTGAGGAGG + Intergenic