ID: 1169768866

View in Genome Browser
Species Human (GRCh38)
Location 20:9179598-9179620
Sequence CGAATACAGCAGATTTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169768864_1169768866 16 Left 1169768864 20:9179559-9179581 CCACTAGTTTGTGAATTTTATTA 0: 1
1: 0
2: 1
3: 31
4: 501
Right 1169768866 20:9179598-9179620 CGAATACAGCAGATTTACCCAGG 0: 1
1: 0
2: 0
3: 5
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169768866 Original CRISPR CGAATACAGCAGATTTACCC AGG Intronic
908217603 1:61970338-61970360 CGAATATAACAGATGTACTCAGG - Intronic
912077735 1:105897871-105897893 CAAATACAACAAAATTACCCAGG + Intergenic
1072810207 10:98455745-98455767 TCAATACAGCAGATTTCCCTGGG + Intergenic
1078195973 11:9137487-9137509 CAAACACACCTGATTTACCCAGG + Intronic
1082181757 11:49128276-49128298 AGTATACAGGAGATTTTCCCAGG + Intergenic
1085786561 11:79456752-79456774 GGAAGACAGCATATTTTCCCAGG - Intergenic
1086683738 11:89706583-89706605 AGTATACAGGAGATTTTCCCAGG - Intergenic
1088671372 11:112144685-112144707 CCAATACAGCAGGCTTACACAGG - Intronic
1091500247 12:1010037-1010059 CAAATTCTGCAGATTTAGCCTGG - Intronic
1096112130 12:49035084-49035106 TGAATAGAGCTGATTCACCCAGG - Intronic
1097159600 12:57037018-57037040 CTCATACAGAAGATTTACCGAGG - Exonic
1106872306 13:34034990-34035012 GGCATACAGCTAATTTACCCGGG - Intergenic
1123131950 14:105994371-105994393 CGAATACTGTAGGTTCACCCAGG - Intergenic
1130980909 15:88811366-88811388 GGAATACAGCAGCTGCACCCAGG + Intronic
1140077915 16:71719375-71719397 AAAATACAGAAGAATTACCCGGG + Intronic
1149454906 17:56780070-56780092 AGAATTCAGCAGATTTTCCCCGG + Intergenic
1149921445 17:60663675-60663697 GGAATTCAGCAGTTTTATCCTGG + Exonic
1158761574 18:60395290-60395312 AGAATACAGGAGATTTATCCTGG - Intergenic
1165845563 19:38815893-38815915 GGAATACAGCAGGTTGACCTTGG + Exonic
932451583 2:71813998-71814020 GGAATCCAGCAGATGTTCCCTGG - Intergenic
935828427 2:106974435-106974457 TGAAGACAGCAGCTTCACCCAGG - Intergenic
941277231 2:163504837-163504859 AGAAAACAGGAGATTTACTCAGG + Intergenic
941508078 2:166372746-166372768 AGAATAAAGCATATTAACCCTGG - Intronic
1169768866 20:9179598-9179620 CGAATACAGCAGATTTACCCAGG + Intronic
1173719939 20:45248234-45248256 AGAAAACAGCAGATTTACACAGG + Intergenic
1184737407 22:46407469-46407491 AAAATACAGCAAATTTAGCCAGG + Intronic
951838640 3:27009415-27009437 GCTATACAGCAGATATACCCAGG - Intergenic
952869633 3:37886781-37886803 AGAATATATCAGATTTACCTGGG + Intronic
957174195 3:76784482-76784504 CCAATACAGCAGAGTTAAGCTGG + Intronic
959855314 3:111147981-111148003 CAAATACAGCACATTAATCCAGG - Intronic
961528979 3:127528082-127528104 TGAAGCCAGCAGATGTACCCTGG + Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
972205061 4:36761858-36761880 CGACCACAGTAGATTTCCCCAGG + Intergenic
972915163 4:43868162-43868184 CAAATACATCAAATTTTCCCTGG + Intergenic
973530776 4:51835015-51835037 AGAATACAGGAGATTTGCCTTGG + Intergenic
977322446 4:95535027-95535049 CGAATACAGCAAATGTACAGTGG + Intronic
989403644 5:41036496-41036518 CGAATACAGTAAATATACCATGG + Intronic
991137456 5:63198805-63198827 AGAATACAGCAGATCTTACCTGG - Intergenic
991280882 5:64911588-64911610 TAAATTCAGCAGATTTTCCCAGG - Intronic
996299860 5:121968282-121968304 CGGATACAGCAGAAATACACTGG + Intronic
1000879831 5:166684659-166684681 CTAACACAACAGATTTTCCCTGG + Intergenic
1006992437 6:38226954-38226976 CAAAGACAGCAGGTTTACTCTGG + Intronic
1010233118 6:73553069-73553091 CAAATACATCAGAATTACCCAGG + Intergenic
1014621727 6:123675147-123675169 TGCATACAGCAGAGGTACCCTGG + Intergenic
1027281292 7:76611236-76611258 GGATGACAGCAGATCTACCCTGG + Intronic
1031298866 7:120039374-120039396 AGCATACAGCAGATGGACCCTGG + Intergenic
1033448286 7:141440646-141440668 CCAAGAAAGCAGATTTACCTGGG - Intronic
1036026634 8:4916029-4916051 AGAATACACTAGATTTGCCCTGG + Intronic
1037915875 8:22773304-22773326 TGATTACAGCATATTTAACCTGG + Intronic
1040683724 8:49844586-49844608 TGAAGACAGCAGACTTACTCTGG - Intergenic
1041335438 8:56776956-56776978 AGAAAACAGCAGAATGACCCAGG + Intergenic
1044055838 8:87568953-87568975 CTAATACAGTAGATTGACACTGG + Intronic
1048586252 8:135776884-135776906 CAAAGACAGCTGCTTTACCCAGG - Intergenic
1050170699 9:2813238-2813260 TGAAAACAGCAGATTTACACAGG - Intronic
1057255693 9:93545319-93545341 TGAAAACAGTGGATTTACCCTGG + Intronic
1191673336 X:63769632-63769654 TGAATACAGCAGAGGGACCCTGG - Intronic
1192329941 X:70167153-70167175 CCACCACAGCACATTTACCCAGG - Intergenic