ID: 1169769696

View in Genome Browser
Species Human (GRCh38)
Location 20:9187360-9187382
Sequence ACATTTGCACACCCCTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169769692_1169769696 23 Left 1169769692 20:9187314-9187336 CCGTGCTCTCTCTTCAAGAAACA 0: 1
1: 0
2: 4
3: 47
4: 364
Right 1169769696 20:9187360-9187382 ACATTTGCACACCCCTGCTGAGG 0: 1
1: 0
2: 0
3: 18
4: 149
1169769693_1169769696 0 Left 1169769693 20:9187337-9187359 CCAGCACCACTTCCTGCTCTAAA 0: 1
1: 0
2: 0
3: 18
4: 236
Right 1169769696 20:9187360-9187382 ACATTTGCACACCCCTGCTGAGG 0: 1
1: 0
2: 0
3: 18
4: 149
1169769690_1169769696 30 Left 1169769690 20:9187307-9187329 CCCACTGCCGTGCTCTCTCTTCA 0: 1
1: 0
2: 0
3: 16
4: 196
Right 1169769696 20:9187360-9187382 ACATTTGCACACCCCTGCTGAGG 0: 1
1: 0
2: 0
3: 18
4: 149
1169769694_1169769696 -6 Left 1169769694 20:9187343-9187365 CCACTTCCTGCTCTAAAACATTT 0: 1
1: 1
2: 6
3: 33
4: 405
Right 1169769696 20:9187360-9187382 ACATTTGCACACCCCTGCTGAGG 0: 1
1: 0
2: 0
3: 18
4: 149
1169769691_1169769696 29 Left 1169769691 20:9187308-9187330 CCACTGCCGTGCTCTCTCTTCAA 0: 1
1: 0
2: 0
3: 19
4: 212
Right 1169769696 20:9187360-9187382 ACATTTGCACACCCCTGCTGAGG 0: 1
1: 0
2: 0
3: 18
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169769696 Original CRISPR ACATTTGCACACCCCTGCTG AGG Intronic
901205459 1:7492394-7492416 TCATGTGCACACCCCAGCTGAGG - Intronic
901810145 1:11762749-11762771 GCATTTACAAGCCCCTGCTGGGG + Intronic
906072329 1:43026113-43026135 CCATGTGCACCCCACTGCTGAGG - Intergenic
907260095 1:53211516-53211538 GCATTTCCCCACCCCTGCTTAGG - Intronic
908784572 1:67722343-67722365 ACATTTGCAGTCGCCAGCTGGGG + Intronic
912184419 1:107257741-107257763 ACATTTGCTTACCCCTACTCTGG - Intronic
913691717 1:121285887-121285909 AAGATTGGACACCCCTGCTGTGG - Intronic
914145829 1:144994068-144994090 AAGATTGGACACCCCTGCTGTGG + Intronic
915900538 1:159843558-159843580 CCCTATGCCCACCCCTGCTGGGG + Intronic
916489573 1:165289611-165289633 ACATTCACACATCACTGCTGAGG + Intronic
918148302 1:181777124-181777146 ACATTTGCTAATCCCTGCTTTGG + Intronic
920479047 1:206304396-206304418 AAGATTGGACACCCCTGCTGTGG - Intronic
922617761 1:226973248-226973270 ACACTCCCGCACCCCTGCTGAGG - Intronic
922621339 1:226990678-226990700 ACCTCTGCTCACCCCTGCTCTGG + Exonic
1064227441 10:13499913-13499935 ACGTTTGAACTCCTCTGCTGAGG - Exonic
1069863192 10:71483934-71483956 ACATTTTTACATCCTTGCTGCGG + Intronic
1073073522 10:100809378-100809400 ACATCTGCACACCCCTGTTCAGG - Intronic
1074959067 10:118422837-118422859 CCCTTTGCCCACCGCTGCTGAGG + Intergenic
1075640449 10:124060568-124060590 ACCTTTGCACACTCCTGGTGGGG - Intronic
1077434167 11:2530514-2530536 ACATGTACACACACCTGCAGAGG - Intronic
1080269944 11:30440495-30440517 ACATTTGCTGACCCCTGTTCTGG + Intronic
1085315630 11:75543235-75543257 ACAGTAGCACATGCCTGCTGGGG - Intergenic
1086236301 11:84635191-84635213 ACATGGGCACACCCAAGCTGTGG - Intronic
1087664870 11:101032511-101032533 ACATTTGCACAAACCTGATGGGG - Exonic
1089227821 11:116940762-116940784 CCACTTGCACACTCCTGGTGGGG + Intronic
1099402451 12:82216447-82216469 ACATTGTAACACCCCTTCTGGGG + Intergenic
1100013793 12:89984480-89984502 ACATTTCCTCACCCCACCTGAGG - Intergenic
1100748556 12:97672303-97672325 ACATTTCCACACTCCTACTGAGG - Intergenic
1101113330 12:101507217-101507239 ACAATTTCACTGCCCTGCTGGGG + Intergenic
1108127148 13:47256851-47256873 CCATTTCCACACCCCTGAAGAGG + Intergenic
1111033722 13:82641904-82641926 ACAATTGCACATCCCTGTTCAGG + Intergenic
1113861104 13:113487968-113487990 AGATTTGCACATTCCTGGTGTGG - Intronic
1116050727 14:39800536-39800558 ACATTGTCTCACCCCTGATGAGG + Intergenic
1118431749 14:65726406-65726428 ACAGTTCCACATCCCTGGTGGGG + Intronic
1118630211 14:67695616-67695638 ACATTTGCACAGACCTGATTTGG + Exonic
1124734185 15:32228629-32228651 ATATTTGAACTCCCTTGCTGTGG + Intergenic
1127402472 15:58603400-58603422 ACATTTCCAAACACCTGCTGGGG + Intronic
1133213839 16:4278621-4278643 TCATTTGCACAGCCCTGGAGAGG + Intergenic
1136403001 16:30028677-30028699 ACATTTGGACGCCCCTGATGGGG - Intronic
1141059302 16:80850834-80850856 ACAATTGCTGAACCCTGCTGTGG - Intergenic
1141699113 16:85634373-85634395 ACATCCGGACACCCCTGCAGTGG - Intronic
1143005299 17:3828303-3828325 ACATCTGCTCAGCTCTGCTGTGG - Intronic
1143349744 17:6278873-6278895 ACCCTTGCACACCCCTGGGGGGG + Intergenic
1143619056 17:8070791-8070813 GGATGTGCAGACCCCTGCTGAGG - Intergenic
1146117423 17:30153757-30153779 AAATTTGCTGACCCCTGCTCTGG + Intronic
1148891550 17:50811228-50811250 ATATTTTCTCTCCCCTGCTGTGG + Intergenic
1149645228 17:58235999-58236021 CCATCTGCACACCCCTCCAGAGG + Intronic
1150322965 17:64231903-64231925 AGATGTGCTCACACCTGCTGTGG - Intronic
1151075636 17:71269159-71269181 ACATTTGCAGAAACCTGGTGTGG - Intergenic
1151420943 17:73997118-73997140 ACATTTGCTGACCCCTGCTTTGG - Intergenic
1152749915 17:82057904-82057926 ACTTTTGCACACGCGTGCTGAGG + Exonic
1152861626 17:82699482-82699504 ACATGTGCAGACACCTGCAGAGG - Intergenic
1152861630 17:82699570-82699592 ACATGTGCAGACACCTGCAGAGG - Intergenic
1152876144 17:82787266-82787288 ACAATTGCTCACTCTTGCTGAGG - Intronic
1152892938 17:82892717-82892739 ACCTTTGAAAAACCCTGCTGTGG + Intronic
1155885844 18:31207120-31207142 ACATCTCCACCCTCCTGCTGCGG + Intergenic
1156451078 18:37266803-37266825 ACAGTTGCCCACCCTGGCTGGGG + Intronic
1157015916 18:43712718-43712740 ACCTTTTCTCACCCCTCCTGAGG + Intergenic
1162041020 19:7971188-7971210 ACCTCTGCACACAGCTGCTGGGG - Intronic
1163685466 19:18709618-18709640 ACCTGCGGACACCCCTGCTGAGG + Intronic
1163766753 19:19167600-19167622 ACATTTGCTCACCCCAACTTGGG - Intronic
1164596115 19:29531375-29531397 ACATTGTCACACCCCTACAGTGG + Intronic
924959557 2:21822-21844 ACATTTGAACTCCTCCGCTGTGG + Intergenic
927417864 2:22897664-22897686 ACATTTTCACTCCCCTGCCAAGG + Intergenic
928312579 2:30222956-30222978 ACATTTCCACACGCTTGGTGAGG - Intergenic
931710018 2:64980855-64980877 AAAATTGCACAACTCTGCTGTGG + Intergenic
933377951 2:81504515-81504537 ACAGTTCCACAGCCCTGATGTGG - Intergenic
934323360 2:91985608-91985630 ACATTGGCCCAGCCCTGCTCTGG + Intergenic
938123093 2:128647265-128647287 ACATATGCACAGCCATGCTGAGG - Intergenic
938697367 2:133846618-133846640 ACAGTTTCGCACCCTTGCTGGGG - Intergenic
939100107 2:137886309-137886331 ACTTTAGCTCACCCCTGCTAGGG - Intergenic
940101169 2:150040494-150040516 ATATTTGCACACCCTTTTTGGGG - Intergenic
942370131 2:175275209-175275231 GCAGTTGCACAGCCCAGCTGAGG - Intergenic
944131731 2:196354232-196354254 ACATTGTAACACCCCTTCTGAGG + Intronic
944298812 2:198098912-198098934 AACTTTACACACCCCTGCTCTGG + Intronic
946058017 2:216918366-216918388 ACATCTTCACACCCATCCTGGGG + Intergenic
946134890 2:217637413-217637435 ACATCTGGACACCCCTAATGAGG + Intronic
947150109 2:227106976-227106998 ACATTTGCAAACTCAGGCTGTGG - Intronic
1169316495 20:4595106-4595128 ACATTTGCCCAGCCCTGCCCTGG + Intergenic
1169769696 20:9187360-9187382 ACATTTGCACACCCCTGCTGAGG + Intronic
1170153692 20:13250645-13250667 ACATTTGGGAACCCCTGCTGTGG + Intronic
1171070228 20:22061545-22061567 CTATTTGCACACCTTTGCTGGGG + Intergenic
1173900732 20:46586791-46586813 ACATTTGCTGACCCCTGGTCTGG - Intronic
1175775060 20:61647918-61647940 TCATGAGCACACCCCTGCAGGGG + Intronic
1176092390 20:63325054-63325076 AGCTCTGCAGACCCCTGCTGTGG + Intronic
1176159318 20:63640542-63640564 ACATCTGCAAAGCCCTGGTGGGG + Exonic
1177530012 21:22346396-22346418 ACATTTGGAGGCCCATGCTGAGG - Intergenic
1180550103 22:16531479-16531501 ACATTGGCCCAGCCCTGCTCTGG + Intergenic
1181236237 22:21449237-21449259 ACACTCGCACACACCTGATGTGG - Exonic
1181354570 22:22290342-22290364 ACATTGGCCCAGCCCTGCTCTGG - Intergenic
1181778821 22:25178490-25178512 ACATCTGCAAAGCCCTGGTGGGG + Intronic
1182032376 22:27169442-27169464 ACATGTTCACACCTTTGCTGGGG + Intergenic
1182351469 22:29702424-29702446 ACCCTGGCACACCCCTGCTGTGG + Intergenic
1183369697 22:37425515-37425537 ACATTTACACACTCTGGCTGGGG + Intronic
950418960 3:12885548-12885570 CCAGCTGCAGACCCCTGCTGGGG - Intergenic
952543598 3:34395391-34395413 ACATCTACACACTCCTCCTGAGG - Intergenic
952801126 3:37292852-37292874 GCATTTGGAGACCACTGCTGTGG + Intronic
953357862 3:42269551-42269573 ACGTATGCAAACCACTGCTGGGG + Intergenic
954169307 3:48787866-48787888 ACATTTCCACAGCCCTCCTTAGG - Intronic
956862892 3:73341702-73341724 AAATTTGCATACCCCAGATGAGG + Intergenic
963008458 3:140748319-140748341 CCACTTGCCCACTCCTGCTGAGG - Intergenic
965792850 3:172408292-172408314 CCATGTGCCCACCCTTGCTGAGG + Intergenic
968451388 4:677615-677637 AGATTTGCACAACGCTGCTGTGG - Intronic
968653342 4:1768503-1768525 ACATCTGCCCAGCCCTGCAGGGG + Intergenic
970432274 4:16000167-16000189 ACATTTGGAAACTACTGCTGAGG + Intronic
973901420 4:55476672-55476694 AAATTTGGAGATCCCTGCTGTGG + Intronic
978200622 4:106020312-106020334 ACATGGCCACACTCCTGCTGTGG - Intergenic
979881136 4:125961768-125961790 ACATTGTAACACCCCTTCTGGGG + Intergenic
983448976 4:167887739-167887761 ACATTGTGACACCCATGCTGGGG - Intergenic
984573890 4:181425120-181425142 ACATTTGCACACCTCTAGGGAGG + Intergenic
988869229 5:35370488-35370510 ACATTTTCCCCTCCCTGCTGAGG + Intergenic
990204199 5:53411396-53411418 ACATTTTCACACCACTTCTTGGG - Intergenic
994838767 5:104893612-104893634 ACATTTGCATCCCCCGCCTGTGG - Intergenic
999052041 5:148533400-148533422 ACATTTGCACATGGCTGCAGTGG - Intronic
999640605 5:153668810-153668832 ACATTTGAAGGCCCCTGCTCTGG + Intronic
1005212225 6:23479916-23479938 ACACTTGTACAACCTTGCTGTGG + Intergenic
1011781796 6:90797737-90797759 ACATTTGCAGCTCTCTGCTGAGG + Intergenic
1012990866 6:105924550-105924572 ACATTTGCACACTGTTGGTGGGG - Intergenic
1014103850 6:117541273-117541295 ACATTAGCACATCCATGCAGTGG + Intronic
1015828216 6:137338385-137338407 ACATTTACACAGCTATGCTGTGG - Intergenic
1016706721 6:147117279-147117301 ACATTTGCAAACCCCTTTTATGG + Intergenic
1017081031 6:150669131-150669153 ACATTTGCACAGCCCCACTGTGG + Intronic
1017450360 6:154549164-154549186 CCATTTTCCCACCCCTTCTGGGG + Intergenic
1018041290 6:159924721-159924743 TGATTTGCACTCCCCTGCTGGGG + Intergenic
1021837895 7:24698478-24698500 ACAGTAACACACCCCTGCTTGGG - Exonic
1021950987 7:25774436-25774458 AAAATTGCAAACCCCTTCTGTGG - Intergenic
1024059512 7:45687357-45687379 ACACAGGTACACCCCTGCTGTGG - Intronic
1024965949 7:55021979-55022001 ACATTTGCACACACCTGATTTGG - Intronic
1027171571 7:75876680-75876702 ACATTTTCACAACCCTTGTGAGG - Intronic
1027441770 7:78226857-78226879 ACATTTGCACAACAAGGCTGAGG + Intronic
1028817921 7:95168916-95168938 ACTCTTACACACCACTGCTGGGG + Intronic
1029438680 7:100575870-100575892 CCATGTGCCCTCCCCTGCTGTGG - Exonic
1032898201 7:136275998-136276020 ACATGTGCACAACCCCTCTGAGG - Intergenic
1035564786 8:634503-634525 ACGTCTGCACACCCATGCTCAGG + Intronic
1035849378 8:2900104-2900126 ACAAATGCACCCCTCTGCTGAGG + Intergenic
1035927511 8:3744220-3744242 CCTGTTGCACACACCTGCTGCGG - Intronic
1036700702 8:11011986-11012008 ACATGTGGACACCCCACCTGTGG - Intronic
1037813417 8:22099572-22099594 TCACTTGCCCATCCCTGCTGAGG - Intronic
1041313454 8:56539100-56539122 ACATTTGCAATCTCATGCTGGGG + Intergenic
1041769169 8:61454400-61454422 CCATTTGCAAACTCCAGCTGAGG - Intronic
1042693688 8:71532044-71532066 ACATTTCCAAACCTCTGCTAGGG + Intronic
1043310268 8:78850331-78850353 ACATATGCACACATCTACTGCGG + Intergenic
1045063158 8:98425550-98425572 ACATTTGCAGAGGCCTGCAGGGG + Intronic
1048121577 8:131587683-131587705 ACACTTGTACATCCCAGCTGGGG - Intergenic
1049251628 8:141592267-141592289 ACATGCGCACACCCAGGCTGAGG - Intergenic
1049474392 8:142790054-142790076 ACATCATCACACCCCTGCTGTGG - Intergenic
1055964382 9:81851160-81851182 ACATTTGAACAACACTGCTTGGG + Intergenic
1056852971 9:90099755-90099777 AAGATTGCACACCCCTGCTTTGG + Intergenic
1060108905 9:120892514-120892536 ACACTGGCACACCATTGCTGAGG - Intronic
1060403917 9:123363608-123363630 TCATTTGAACACTCCTGATGTGG + Intronic
1060733232 9:126050775-126050797 CCATCTCCACACCCCTTCTGTGG - Intergenic
1060782893 9:126426201-126426223 ACATTTGCCAACCCCTGGTTAGG + Intronic
1061216956 9:129227169-129227191 ACATTTCCACAGCTCTGCAGAGG - Intergenic
1061574763 9:131499250-131499272 ACAGGTGCACAGCCATGCTGTGG + Exonic
1061946184 9:133909248-133909270 ACATCTTCACCCCCCTTCTGAGG - Intronic
1062257997 9:135639477-135639499 CTATTTGCACAGCCCTGCAGTGG - Exonic
1062323302 9:136001045-136001067 ACAGGTGCAGGCCCCTGCTGGGG + Intergenic
1062540030 9:137037484-137037506 AAAATTGTTCACCCCTGCTGGGG - Exonic
1203442030 Un_GL000219v1:17960-17982 ACACTTGCACACTGTTGCTGAGG + Intergenic
1203512838 Un_KI270741v1:136869-136891 ACACTTGCACACTGTTGCTGAGG + Intergenic
1186382593 X:9076740-9076762 ACATTTGCAAACCCATGGTGAGG - Intronic
1189090290 X:38075087-38075109 TCATTTGCAGACCCCAGCTCAGG + Intronic
1189351319 X:40277942-40277964 ACACTTACACAGCCCTGCAGAGG - Intergenic
1193573249 X:83171441-83171463 ACATTTACACACTACTGGTGGGG - Intergenic
1194281547 X:91959906-91959928 ACACTTGCACACTGCTGTTGGGG - Intronic
1197777561 X:130129168-130129190 CTCTTTGCACACACCTGCTGTGG - Intergenic
1200599140 Y:5184561-5184583 ACACTTGCACACTGCTGTTGGGG - Intronic
1201190771 Y:11440596-11440618 ACATTGGCCCAGCCCTGCTCTGG + Intergenic