ID: 1169771693

View in Genome Browser
Species Human (GRCh38)
Location 20:9208161-9208183
Sequence CCCTGGGACCCTTCCTCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169771693_1169771697 -8 Left 1169771693 20:9208161-9208183 CCTTAAGAGGAAGGGTCCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 166
Right 1169771697 20:9208176-9208198 TCCCAGGGCCAGTGCATCAGGGG 0: 1
1: 0
2: 0
3: 20
4: 242
1169771693_1169771695 -10 Left 1169771693 20:9208161-9208183 CCTTAAGAGGAAGGGTCCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 166
Right 1169771695 20:9208174-9208196 GGTCCCAGGGCCAGTGCATCAGG 0: 1
1: 0
2: 2
3: 21
4: 207
1169771693_1169771696 -9 Left 1169771693 20:9208161-9208183 CCTTAAGAGGAAGGGTCCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 166
Right 1169771696 20:9208175-9208197 GTCCCAGGGCCAGTGCATCAGGG 0: 1
1: 0
2: 0
3: 22
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169771693 Original CRISPR CCCTGGGACCCTTCCTCTTA AGG (reversed) Intronic
900395936 1:2453265-2453287 CCCTGGGGCCCTTCCCCGTGTGG + Intronic
901733874 1:11299757-11299779 CCCTGAGACCCTGTCTCTGATGG - Intergenic
903807669 1:26017126-26017148 TGCTGGGTCCCTTCCTCTGAGGG + Intergenic
904418997 1:30379452-30379474 CCCTGGGCCTCTTCCTCATGTGG - Intergenic
904753246 1:32754104-32754126 CGCTGGGGGCCTTCCTCTTGTGG - Intronic
911674811 1:100647187-100647209 TGCTGGGACCCTTCCTCATCAGG - Intergenic
912738044 1:112167611-112167633 CTCTGGGGCCCTTCCTTTAATGG + Intergenic
913489369 1:119364537-119364559 CCCTCAGTCCCTTCCTCATATGG - Intergenic
913499802 1:119461874-119461896 CCCTAGGCCCCTCCCTCTTCAGG + Intergenic
913510623 1:119558600-119558622 CCCTAGGCCCCTCCCTCTTCAGG + Intergenic
913514837 1:119596013-119596035 CCCTAGGCCCCTCCCTCTTCAGG + Intergenic
915194884 1:154182342-154182364 CCAGGGGCCCTTTCCTCTTACGG - Intronic
915612637 1:157006836-157006858 CACTGGGGCCCTTCATCTTCTGG - Intronic
915801875 1:158802144-158802166 CCCAGGGACACTGCCTCTTCTGG + Intergenic
918703660 1:187636039-187636061 TCCTGGGTCCCTTCCTCCAAAGG - Intergenic
921414675 1:214871852-214871874 ACCTGGGCCCCTCCCTCTTCAGG - Intergenic
923565524 1:235073441-235073463 CCCTGGGCCTCTTCCACTTTTGG + Intergenic
923671604 1:236046420-236046442 GCATGGGACGCTTCCTCTTACGG - Intronic
924135144 1:240957954-240957976 CCCAGTGACCCTTCTTCTCACGG + Intronic
1062834767 10:628528-628550 CCCTGGGAGCCTCGCTCTGATGG + Intronic
1066434518 10:35384758-35384780 CCCTGGGACCCTTTCAGTTTAGG + Intronic
1066518815 10:36193782-36193804 ACCTGGGCACCTTACTCTTAAGG - Intergenic
1069776036 10:70927735-70927757 CCCTGGGCCACTTCCTGTTCTGG + Intergenic
1071514899 10:86290934-86290956 CCCTGGGCCGCTTCCTCTCCAGG - Intronic
1073471418 10:103724812-103724834 CCCTGGAACCCTGGGTCTTAGGG + Intronic
1073836871 10:107454221-107454243 CCCTGGGAGTCTGCCTTTTATGG - Intergenic
1078143345 11:8707245-8707267 CCCTGACACCCTTCCTCTTTGGG - Intronic
1078541696 11:12218260-12218282 CCCTGGGCCCCTGCCTCTGCTGG + Intronic
1078931762 11:15918086-15918108 CCCTAGGACCTTCCCTCTTCTGG - Intergenic
1079489202 11:20968758-20968780 CCCTGGCTCCTTTCCTCTTGTGG + Intronic
1081613418 11:44576990-44577012 CTCTGGGATCCTTCATCCTAAGG - Intronic
1081693846 11:45095669-45095691 CCCTGGGACATGTCCTCTTGGGG + Intergenic
1083163146 11:60867817-60867839 AGCTGGGACCCTTCCCCTGAAGG + Intronic
1083276462 11:61599797-61599819 CCCTGGGATCCCTCCTCTGAGGG + Intergenic
1084443729 11:69191232-69191254 CTCTCGGACCCTTCCTCAGAAGG + Intergenic
1085273143 11:75282107-75282129 CCCTGGGGCCCTTGGTCTGATGG - Intronic
1086332488 11:85768000-85768022 CCCTGGGTGTCTTGCTCTTAAGG - Intronic
1088613870 11:111603209-111603231 CCATGGGGCCCTTCCTCGTCGGG - Intronic
1089789112 11:120929717-120929739 GCATGGGGCCCTTCCTCTTCTGG + Intronic
1089947096 11:122487204-122487226 CCCTAGGACCGTTCCCTTTAGGG - Intergenic
1089982488 11:122783865-122783887 CCCTAGCACCCTTCCTTTGAGGG + Intronic
1090666311 11:128917033-128917055 CCCTGGGTCACTTCCTTTTTTGG + Exonic
1090938683 11:131368625-131368647 CCCAGGGCCCCTTCCTCTCAAGG + Intergenic
1091134561 11:133177065-133177087 CCCTTGGACCATTGCTCTGAAGG - Intronic
1091297132 11:134481942-134481964 CCCTGGGGCCCTGCCTCTTCAGG + Intergenic
1094540033 12:31355611-31355633 CCCTTGGTCACTTCCTGTTAGGG - Intergenic
1097316920 12:58181430-58181452 CCCTCAGACGCTTTCTCTTAAGG + Intergenic
1102978990 12:117226889-117226911 CCCAGGATCCCTTCCTCTGAAGG + Intronic
1103455274 12:121060406-121060428 GCCTGAGAACCTTCCTCTCAAGG - Intergenic
1103724463 12:122990851-122990873 CTCTGGGCCCCTTCCTCTCACGG - Intronic
1104309056 12:127637273-127637295 CCCTGCAACCCTCCCTCTTGTGG + Intergenic
1104723251 12:131058310-131058332 CCCTGGGTCACATCCTCTTGAGG - Intronic
1106388144 13:29307908-29307930 CCCTAGGCCCCTCCCTCTTCAGG - Intronic
1107913080 13:45123858-45123880 CCCTAGGCCCCTCCCTCTTCAGG + Intronic
1112805129 13:103156458-103156480 CTCTGTGAACCTTCCTTTTAAGG + Intergenic
1113879561 13:113616318-113616340 CACTGGGACCCTTCCAGTCACGG + Intronic
1114449869 14:22818461-22818483 CCCTGAGACCCTGGGTCTTAGGG + Intronic
1116639565 14:47443823-47443845 GCCTTGGACCCTCTCTCTTATGG - Intronic
1119776702 14:77253501-77253523 CCCTGGGCTCCCTCCTCTAATGG + Intronic
1121565880 14:94908752-94908774 CCCTGGGTCCCTTCCTCACAAGG + Intergenic
1121803500 14:96795083-96795105 CCCTGGCACCCTTGATCTGATGG - Intergenic
1121822889 14:96985751-96985773 CCTTGAGACCCTTCATCTTCTGG + Intergenic
1128751547 15:70153936-70153958 CCGTGGCTTCCTTCCTCTTAGGG + Intergenic
1128800672 15:70494876-70494898 ACCTGGGTCCCTTCCTCCCAGGG - Intergenic
1130841251 15:87703302-87703324 CCCCCCGACCCTTCCTCTTCAGG + Intergenic
1132709554 16:1260301-1260323 TCCTGGGGCGCTTCCTCTAAGGG - Intergenic
1133743307 16:8668028-8668050 TCCTGGGTCCCTTCCTCCTGTGG - Intergenic
1136133423 16:28239531-28239553 CCCTAGGCCCCTCCCTCTTCAGG + Intergenic
1138505690 16:57477180-57477202 CCCTGGGACCCTGCCTGCCAAGG - Intronic
1139309003 16:66012537-66012559 CCCTCAGACCCTTCCACTTGGGG - Intergenic
1142485424 17:244579-244601 TCCTGGGACCCTGCCTCCGAGGG - Intronic
1144721689 17:17475618-17475640 CCCTGGCCACCTTGCTCTTAAGG + Intergenic
1146218443 17:30997692-30997714 CTCTGGGATCCATGCTCTTAAGG - Intronic
1146748383 17:35352747-35352769 CCCTGGGACCATTCGGCTTCAGG + Exonic
1152918168 17:83052460-83052482 CCCGGGTACCCCTCCTCCTAGGG - Intergenic
1153054174 18:929224-929246 CCCTGAGCCCCTTCATGTTAGGG - Intergenic
1153414906 18:4835901-4835923 CCCTGGGAACCATTCTCTTAAGG - Intergenic
1153618492 18:6954887-6954909 CCCTGGGACCCTTCTGCCAAGGG - Intronic
1154197943 18:12279776-12279798 TGCTGGGACCCTTCCCCTAAGGG - Intergenic
1155190314 18:23423647-23423669 ACCTGGTACACTTCCTTTTAGGG - Intronic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1159983433 18:74813602-74813624 CACTGGAGCCCTTCATCTTAGGG + Intronic
1163542720 19:17920840-17920862 CCATGGCATCCTTCCTCTTAGGG + Intergenic
1166969990 19:46559774-46559796 CCCTAGGCCCCTCCCTCTTCGGG - Intronic
928595786 2:32857676-32857698 CCCTGGGACCGATCCTGTCAGGG - Intergenic
929001971 2:37355944-37355966 CCCTCGGGCTCCTCCTCTTAGGG - Intronic
929487764 2:42370132-42370154 CCCTGGGGACCATCCCCTTACGG - Intronic
930267474 2:49216815-49216837 CTCTGGGACTCATCCTCTAATGG + Intergenic
934121665 2:88846083-88846105 CCCTGGGACTCTCCCTCATAAGG + Intergenic
938370014 2:130762906-130762928 CCCTGGGAACCTTGCTCTCCAGG - Exonic
941367437 2:164624434-164624456 CCCTGGCCCCTTTCCTCTGAGGG + Intergenic
942763526 2:179427814-179427836 CCTTTGGGCCCTTCCTCTTTGGG + Intergenic
946229508 2:218282744-218282766 CCCTGGATCCCTTCCTCCTCGGG - Intronic
1169136841 20:3202925-3202947 TCCTCGCACCCTTCCTGTTATGG - Intronic
1169771693 20:9208161-9208183 CCCTGGGACCCTTCCTCTTAAGG - Intronic
1170169388 20:13393807-13393829 CCCTAGGCCCCTCCCTCTTCAGG - Intronic
1170609417 20:17900135-17900157 CCCTGGGACCCCTCCAATTCTGG - Intergenic
1172092151 20:32440862-32440884 GCCTGGGTCCCCTCCTCTCAGGG - Intergenic
1172210617 20:33195568-33195590 CCCTGGGGAACTTCCTCTTTGGG + Intergenic
1173168623 20:40704329-40704351 CCTTGGGAGCCTTTGTCTTAGGG - Intergenic
1174045096 20:47727627-47727649 CCCGTGGCCACTTCCTCTTACGG + Intronic
1174216424 20:48920120-48920142 CCCTGGGCCCCTTCCCCCAAGGG - Intergenic
1176027408 20:62993183-62993205 CCCTGCGGCCCTTCCTCCAAAGG - Intergenic
1177627083 21:23675553-23675575 CACTGGGACTTTTCCTCTTTCGG - Intergenic
1178158238 21:29880006-29880028 CCCTGGGGGCCTTCATATTATGG + Intronic
1178185802 21:30218731-30218753 CCCTGGGCCACTTCCTAGTAGGG - Intergenic
1178826916 21:36024905-36024927 TCCTGGGACCCCTCCACTCAGGG + Intergenic
1179246312 21:39637065-39637087 CCCTGGGACATTTACTATTAGGG + Intronic
1179894715 21:44355074-44355096 CCCTGGGACTCTCTCTCTTGGGG - Intronic
1182120458 22:27783068-27783090 CCCTTGTTCCCTTCCTCTTGTGG - Intronic
1184333768 22:43841483-43841505 CCCTGGGGGCCCTCCTCTGAGGG - Intronic
1184781992 22:46654246-46654268 CCTGGGGACCCTTCCTCCGAGGG - Intronic
950243495 3:11393390-11393412 CCCTCCCTCCCTTCCTCTTATGG - Intronic
950733623 3:14986049-14986071 CTGTGAGAACCTTCCTCTTAGGG + Intronic
954314921 3:49795831-49795853 CCCTGGGCCCCCTCCTGTCAGGG + Intronic
954318090 3:49812191-49812213 TCCAGGGACCCATCCTCTGAGGG + Exonic
954328690 3:49877580-49877602 CCCTGGCCCCCTGCCTCCTAAGG - Intergenic
955636070 3:61030883-61030905 ACATGGGACCCTTGCTGTTATGG - Intronic
961786861 3:129352660-129352682 CCCTTCCACCCTTCCTCTCAGGG + Intergenic
962385640 3:134930146-134930168 CCAAGGGACTCTTCCTTTTATGG + Intronic
970591502 4:17564162-17564184 CCCTGGATGCCTTCCTTTTATGG + Intergenic
971234662 4:24830022-24830044 CCATGGGATCTTTCCTCTTCTGG - Intronic
971677739 4:29655710-29655732 CCCAGGGACTCTGCCTCTTCTGG - Intergenic
976628113 4:87208221-87208243 TCCTGGGCCCCTCCCTCTTCAGG - Intronic
991130501 5:63117542-63117564 CCATGGGCCCCTTACTCTCAAGG - Intergenic
992275244 5:75109765-75109787 CCCTGTGACCCTGCCTATGAGGG + Intronic
999264401 5:150256941-150256963 CCCTGGGGCCCCTCCTTTTGTGG - Intronic
999977836 5:156929514-156929536 CTCTGTGACCCCTTCTCTTAAGG - Intronic
1000300237 5:159950339-159950361 CCCTAGGCCCCTCCCTCTTCAGG + Intronic
1000565149 5:162837214-162837236 CTCTGGGACTCTTCCTATTATGG + Intergenic
1001797511 5:174514443-174514465 CCCTAGGCCCCTCCCTCTTCAGG - Intergenic
1001804852 5:174574840-174574862 CCCTGTGACACTTCCTCTCCTGG - Intergenic
1002691331 5:181052875-181052897 CCCTGGGACCCTCCCGCCTGCGG + Intronic
1003082485 6:3032624-3032646 GCCTGAGACCCATCCTCTTTGGG - Intergenic
1004025061 6:11810288-11810310 CCCTGGGTCCCTTCCTCAGAGGG + Intergenic
1005041093 6:21601212-21601234 TCCTGGCACCCCTCCTATTAAGG + Intergenic
1005496301 6:26391039-26391061 CCCCAGGACCCTTTCTCTTTTGG + Intronic
1005501036 6:26429433-26429455 CACACGGACCCTTCCTCTTTAGG + Intergenic
1006453367 6:34118225-34118247 CCCTTAGCCCCTTCCTGTTATGG - Intronic
1007583018 6:42970366-42970388 CCAAGGGACCCTTCCCCCTAGGG - Intronic
1008413710 6:51214587-51214609 ACTTGGGACCCTTCCTCGGAGGG + Intergenic
1009858247 6:69291962-69291984 CTCTGTGACCCTTCATCTTCAGG - Intronic
1011592524 6:88984017-88984039 GCCGAGAACCCTTCCTCTTATGG + Intergenic
1011649391 6:89491857-89491879 CTCTGTGACCCTTCATCTTCAGG - Intronic
1016062588 6:139646049-139646071 CCCTGTGACTCTTTCTCTTCTGG + Intergenic
1016639536 6:146333253-146333275 CTCTGAGACCCTTCCTCATATGG + Intronic
1019371520 7:664374-664396 CCCTGGCACCCTCCATCTGAAGG + Intronic
1020787552 7:12590305-12590327 CCCTGGGAGTGTTCCTCTGAGGG + Intronic
1021407195 7:20285230-20285252 CCCTAGGTCACTTCCTTTTATGG + Intergenic
1023054570 7:36281153-36281175 CCCGGGGCCCCTTCCACTTGCGG - Exonic
1023904678 7:44513732-44513754 CCCTGGGACCCTTCCTGCCCTGG - Intronic
1024601848 7:50988914-50988936 TCCTGGGACCCTGCCTTTTAGGG - Intergenic
1024821389 7:53334755-53334777 AGCTGGGACCCTTCCCCTCAGGG - Intergenic
1026735542 7:72946378-72946400 CCCTGGGGCCCTTTCCCTTCTGG + Intronic
1026785880 7:73301308-73301330 CCCTGGGGCCCTTTCCCTTCTGG + Intergenic
1027108184 7:75418630-75418652 CCCTGGGGCCCTTTCCCTTCTGG - Exonic
1029426058 7:100494502-100494524 CCCTGGGCCCCTTCTTCTCTCGG - Exonic
1034552874 7:151832523-151832545 CCCTAGGCTCCTTCCTCTGAGGG - Intronic
1036287253 8:7454166-7454188 CCTTGGGACCCTTGAACTTAGGG - Intronic
1036334228 8:7857359-7857381 CCTTGGGACCCTTGAACTTAGGG + Intronic
1036618221 8:10404793-10404815 CACTGGGACCCTTCCATTTTTGG + Intronic
1038493942 8:27988840-27988862 GCCTGGGACCCATCCTCATGGGG - Intronic
1041975373 8:63793605-63793627 CCCTGGGACCCTGTGTCTTCCGG - Intergenic
1042944898 8:74144970-74144992 CCCTGGGTTCCTTTCTCTTCTGG + Intergenic
1044971574 8:97625035-97625057 CCCAGGGCCCCTTCCTCTCTCGG + Intergenic
1045860480 8:106810889-106810911 CTCTGGCACCCTTCCTCCCAGGG - Intergenic
1048521381 8:135158556-135158578 CCCTGCATCCCTTCTTCTTATGG + Intergenic
1049439523 8:142602795-142602817 CCCTGGGAGCTTTGCTTTTAAGG + Intergenic
1050565225 9:6875250-6875272 GCCATAGACCCTTCCTCTTAGGG + Intronic
1050993789 9:12187375-12187397 CTCTGGGTCCCTTCCTATGACGG + Intergenic
1051127911 9:13824884-13824906 TCTTGGGAGCCTTCATCTTATGG + Intergenic
1059344201 9:113617025-113617047 CCCTGGGGCCCTTCACCTTGTGG - Intergenic
1059453686 9:114386803-114386825 GCCAGGGACCCTTCCCTTTATGG + Intronic
1060103200 9:120857635-120857657 CGCTGGGACCCTTCCTCCTGAGG - Exonic
1060396240 9:123318922-123318944 CCCTGGGACCCTTCCATTAATGG - Intergenic
1060552631 9:124492802-124492824 CCCTGGGAGCCCTGCTCTTGGGG - Intronic
1060793181 9:126499226-126499248 CCCGGGGACCCTGCCACTGATGG - Intronic
1061058760 9:128239853-128239875 CCGTGGGACCCTTCCCCTCAGGG - Intronic
1186348230 X:8716606-8716628 CCCTGTAACCCCTCCTCTTGTGG + Intronic
1187746893 X:22419095-22419117 CCCTGGAACCCATCCTCTGTGGG + Intergenic
1190793872 X:53723597-53723619 CCTTGGGAAGCTTCCACTTATGG - Intergenic
1193380622 X:80812344-80812366 CCCTGGCACCCTCCCTCTTGTGG - Intergenic
1193612135 X:83645127-83645149 CCCTGGATCCCTGCCTCATATGG + Intergenic
1199080286 X:143569174-143569196 CCCTGGGATACTTCCTTTTTAGG - Intergenic
1200021747 X:153217589-153217611 CTCTGGGATCCTTCGTCTTCAGG + Intergenic