ID: 1169773388

View in Genome Browser
Species Human (GRCh38)
Location 20:9225753-9225775
Sequence ATCTGCTTCTATAAGAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 284}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169773385_1169773388 6 Left 1169773385 20:9225724-9225746 CCCTGCATTGGGCATGTTTGCTT 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1169773388 20:9225753-9225775 ATCTGCTTCTATAAGAGAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 284
1169773386_1169773388 5 Left 1169773386 20:9225725-9225747 CCTGCATTGGGCATGTTTGCTTT 0: 1
1: 0
2: 1
3: 8
4: 192
Right 1169773388 20:9225753-9225775 ATCTGCTTCTATAAGAGAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 284
1169773384_1169773388 7 Left 1169773384 20:9225723-9225745 CCCCTGCATTGGGCATGTTTGCT 0: 1
1: 0
2: 1
3: 23
4: 189
Right 1169773388 20:9225753-9225775 ATCTGCTTCTATAAGAGAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169773388 Original CRISPR ATCTGCTTCTATAAGAGAGA GGG Intronic
901509194 1:9707286-9707308 ATCTTCATCAACAAGAGAGAGGG + Intronic
902452709 1:16507825-16507847 ATCTGATTCTACAAGAGTAAGGG - Intergenic
902472769 1:16660489-16660511 ATCTGATTCTACAAGAGTAAGGG - Intergenic
902486035 1:16746954-16746976 ATCTGATTCTACAAGAGTAAGGG + Intronic
902499774 1:16902390-16902412 ATCTGATTCTAGAAGAGTAAGGG + Intronic
903680459 1:25093028-25093050 ATCTGCTTCTGCAAGAGTCAAGG - Intergenic
904283744 1:29439908-29439930 AGCTGCTGCAAAAAGAGAGATGG + Intergenic
904841538 1:33374956-33374978 AACTGCTGCTTTAAGGGAGAAGG + Intronic
905026439 1:34853254-34853276 ATCTGCCTCTAAAAGGGAGTGGG - Exonic
905316696 1:37086434-37086456 ATATGCTGGTATGAGAGAGAAGG - Intergenic
909824292 1:80107867-80107889 TTCTGGTTCTTTAATAGAGAAGG + Intergenic
910682163 1:89877947-89877969 CTCAGCTTCTATAAAAGGGAAGG - Intronic
910720276 1:90278628-90278650 ATCTGCTACCATAACTGAGATGG + Intergenic
911884811 1:103284597-103284619 ATGTGCTTCTATAAGCCAGCTGG + Intergenic
912958283 1:114171906-114171928 ATTTTATTCTCTAAGAGAGATGG + Intergenic
913743574 1:121876243-121876265 ACCTTCATCTAAAAGAGAGACGG - Intergenic
915192965 1:154167554-154167576 ATCTGATTCTACCAGAGTGATGG - Exonic
916567043 1:165990026-165990048 ATGTCCTTCTATAAGTGAGAGGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919029462 1:192221966-192221988 AACTGCCTCTATAAAAGTGATGG - Intergenic
920934043 1:210414649-210414671 ATTTGCCTCTCTAACAGAGAGGG + Intronic
923842546 1:237689259-237689281 ATTTGCTTGTATTAGAGACAGGG - Intronic
1063523619 10:6762983-6763005 AAATGCTTGTATCAGAGAGAAGG - Intergenic
1064396653 10:14987773-14987795 ATCTTTTTCTGAAAGAGAGAAGG - Intronic
1064399443 10:15009168-15009190 ATCTTTTTCTTCAAGAGAGAAGG - Intergenic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1065959104 10:30719747-30719769 ATCTGGTTCTATAAGCAGGAAGG - Intergenic
1066252104 10:33644326-33644348 ATGTGCTTCCATCAGAGAGCTGG + Intergenic
1068170895 10:53393224-53393246 CTCTGCTTCTTGAGGAGAGAGGG + Intergenic
1069793624 10:71039195-71039217 AGCTGCTTCTATAGAAGATAGGG + Intergenic
1071103860 10:82071446-82071468 ACCTGCTGATATCAGAGAGAAGG + Intronic
1071578102 10:86744952-86744974 AACTCTTTCTCTAAGAGAGAGGG - Intergenic
1071729656 10:88234823-88234845 ATCTGCTTTTAGAAGAGACCAGG + Intergenic
1071734874 10:88287155-88287177 ATTTGCTTTTTTAAAAGAGATGG + Intronic
1072313395 10:94178913-94178935 GTCTGCTTTTATAAAAGAGGGGG - Intronic
1077604658 11:3600942-3600964 ATCTTTTTCTTAAAGAGAGAAGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078847575 11:15134000-15134022 ATATGCCTCTCTAAAAGAGAAGG + Intronic
1079447948 11:20573472-20573494 ATCATTTTCTATAAGTGAGAAGG + Intergenic
1079841824 11:25411946-25411968 ATCTGTTTCTATAAGATCGAAGG + Intergenic
1079899135 11:26159527-26159549 ATCTGCTCGTAAAATAGAGAAGG + Intergenic
1080266365 11:30406076-30406098 TCCTCCTTCTACAAGAGAGATGG - Intronic
1081292792 11:41347460-41347482 ATGTGCTTCAAAAAGAAAGAAGG + Intronic
1081456919 11:43232852-43232874 ATCTACCACTATATGAGAGAGGG + Intergenic
1081729588 11:45360820-45360842 ATGTGCTTCCCTAAGAGAGATGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083083128 11:60114157-60114179 ATGTGATTCTATACTAGAGAGGG + Intergenic
1084336679 11:68461530-68461552 ATGGGCTTCTTTAAGAGGGAGGG - Intronic
1084573996 11:69977053-69977075 TTCTGCTTCTCTAAGCGTGAGGG + Intergenic
1084808077 11:71593098-71593120 ATCTTTTTCTTAAAGAGAGAAGG + Intronic
1084845189 11:71893113-71893135 ATCTTTTTCTTCAAGAGAGAAGG + Intronic
1085522233 11:77145608-77145630 ATCAGCTTGTATAAGAAATAGGG + Intronic
1087104965 11:94399672-94399694 ATCTGGTTGTGTATGAGAGATGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087998403 11:104841437-104841459 AGCTCCTTCCATAAGAGAAAAGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092087791 12:5778006-5778028 AACGGCTTCTATTAGACAGAAGG + Intronic
1092431815 12:8416077-8416099 ATCTTTTTCTGAAAGAGAGAAGG - Intergenic
1092434765 12:8438696-8438718 ATCTTTTTCTGAAAGAGAGAAGG - Intergenic
1093224065 12:16459962-16459984 TTCTGTTTCTACAAGACAGAAGG - Intronic
1093251314 12:16807600-16807622 ATCTGCTTAAATCAGAGTGATGG + Intergenic
1093725856 12:22507512-22507534 ATTTTATTCTTTAAGAGAGAAGG - Intronic
1094080560 12:26530065-26530087 ATCTAAATCCATAAGAGAGAAGG + Intronic
1094601122 12:31909700-31909722 TTCTTAGTCTATAAGAGAGAAGG + Intergenic
1095525289 12:43117918-43117940 TTCTGCTTCTATAAATTAGAAGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097910989 12:64969039-64969061 TTCTGTTTCTATGAGAAAGAAGG - Intergenic
1099134720 12:78881802-78881824 ATCAGCTTCTCAAAGAGAGCTGG - Intronic
1099957735 12:89367646-89367668 TTCTTCTTCTTTAAGAGACAGGG - Intergenic
1100228759 12:92586138-92586160 GTCTGCTTCTCTATGAGTGATGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102003025 12:109569938-109569960 ATTTGTTTCTAGAAGACAGAAGG - Intronic
1102146618 12:110659392-110659414 CTCTGCTTCCAGAAGAGGGACGG + Intronic
1102707958 12:114898630-114898652 ATCTGCATCAATAAGACAGATGG - Intergenic
1102718202 12:114992977-114992999 ATCTGTTTCTATGACATAGATGG - Intergenic
1103237788 12:119388117-119388139 GTCTGCTTCTCTCAGAGAGTTGG + Intronic
1103865513 12:124048954-124048976 TGCTACTTGTATAAGAGAGATGG - Intronic
1104863095 12:131935379-131935401 TTCTGCTGTTATTAGAGAGATGG + Intronic
1105733774 13:23246756-23246778 ATGGGCTTCTTTAAGAGAGACGG - Intronic
1109784911 13:67160782-67160804 ATCTGCCTCCATAAGACAAATGG - Intronic
1110065524 13:71100912-71100934 AACTTCCTCTTTAAGAGAGATGG - Intergenic
1110265071 13:73528547-73528569 ATCTTCATCTGTAAGAGAAAGGG - Intergenic
1111153606 13:84292892-84292914 ATCTCTTTCTAAAAGAAAGATGG + Intergenic
1111187414 13:84757011-84757033 ATGTGCTTCTAACAGATAGAAGG - Intergenic
1112308678 13:98298482-98298504 ATCTGCTTGTATGAAAGAGTTGG + Intronic
1112852936 13:103729183-103729205 ATCTGGTTTTGTAAGAGAGAAGG + Intergenic
1115415481 14:33127575-33127597 ACCTCCTTCTATAAGGGAGCAGG - Intronic
1116639563 14:47443815-47443837 TTCGGCATCCATAAGAGAGAGGG + Intronic
1117039505 14:51756652-51756674 ATCTTTTTCTTAAAGAGAGAAGG + Intergenic
1117382877 14:55183001-55183023 CTCTGCTGCTAAAAGAGATAAGG - Intronic
1118018773 14:61689628-61689650 ATTTGTTTCTTTAAGAGACAGGG + Intergenic
1118952230 14:70445437-70445459 ATATGGTTCTGTAAGAAAGAGGG - Intergenic
1128446365 15:67764864-67764886 CTCTGCTTGTATAAGGGAGAAGG - Intronic
1129477954 15:75799446-75799468 ATCTCCTTCTATTGAAGAGAAGG + Intergenic
1129483906 15:75850332-75850354 ATCTGATTTTTTAAGGGAGAGGG - Intronic
1130276908 15:82483910-82483932 ATCTGATTTTTTAAGGGAGAGGG + Intergenic
1130469273 15:84211271-84211293 ATCTGATTTTTTAAGGGAGAGGG + Intergenic
1130474373 15:84250964-84250986 ATCTGATTTTTTAAGGGAGAGGG - Intergenic
1130476763 15:84325815-84325837 ATCTGATTTTTTAAGGGAGAGGG + Intergenic
1130481787 15:84365026-84365048 ATCTGATTTTTTAAGGGAGAGGG - Intergenic
1130495002 15:84462315-84462337 ATCTGATTTTTTAAGGGAGAGGG - Intergenic
1130508253 15:84567063-84567085 ATCTGATTTTTTAAGGGAGAGGG + Intergenic
1130591566 15:85215890-85215912 ATCTGATTTTTTAAGGGAGAGGG + Intergenic
1131217151 15:90547704-90547726 ATCTTCTTCTCTGAGAGCGAGGG + Intronic
1133516918 16:6518453-6518475 ATGTGCTTCTATTATACAGATGG + Intronic
1137314482 16:47302129-47302151 ACCTGCTACTAAAACAGAGAGGG + Intronic
1139204371 16:65013016-65013038 ATCTCCTTCTATAAAATAGGAGG + Intronic
1139312100 16:66036161-66036183 TTCTACTACTAGAAGAGAGAAGG - Intergenic
1139448958 16:67015231-67015253 TTCTGGTTCTTTAAGAGACATGG - Intergenic
1140527362 16:75634131-75634153 TTCTGCTTCTTTAAGGGAAAAGG + Intronic
1141846665 16:86614068-86614090 ATCTGCATGTATGAGAGAGATGG + Intergenic
1142008091 16:87699833-87699855 ATGTGCTTCTACAAGTGAAAAGG - Intronic
1145394455 17:22483794-22483816 ATCTGCTTCTAAAAGGCAAATGG - Intergenic
1145795070 17:27650783-27650805 CTCTGCTGCTAGAAGAGGGAGGG + Intergenic
1147004202 17:37388655-37388677 ATCTGTGTCTAAAGGAGAGAGGG - Exonic
1151012759 17:70519741-70519763 ATATGCTCCTATAATAGAGCAGG + Intergenic
1151076984 17:71285242-71285264 ATCTGTTTTCATAAGAAAGATGG - Intergenic
1151290088 17:73143526-73143548 AGCTGATTATATAAAAGAGAGGG + Intergenic
1152328719 17:79658125-79658147 ATTTGCTACTATAAAAGGGAAGG + Intergenic
1153053254 18:920437-920459 ATCTGCACCTACAAGTGAGATGG - Intergenic
1153053284 18:920758-920780 TTGTGCTTCAATTAGAGAGAAGG + Intergenic
1153237066 18:2998323-2998345 AGCTACTTCAACAAGAGAGAAGG + Intronic
1154941098 18:21113519-21113541 ATCTTCTGCCATAAGATAGATGG + Intergenic
1154941100 18:21113557-21113579 ATCTTCTGCCATAAGATAGATGG + Intergenic
1157925787 18:51764863-51764885 GTCTCCTTCTATGAGAAAGATGG - Intergenic
1159064872 18:63558739-63558761 ATCTGCTTCTATAGGCCACAGGG + Intronic
1160328723 18:77973272-77973294 ATCTGCTTCTATTAGCGATTTGG + Intergenic
1161059677 19:2208639-2208661 CTCTGCTTCTGGAAGAGGGAGGG - Intronic
1164625309 19:29723914-29723936 CTCTGCTTTCATAACAGAGAAGG - Intergenic
1164641936 19:29832617-29832639 ATTTTCTTTTTTAAGAGAGAGGG + Intergenic
1165989684 19:39803010-39803032 ATCTGCTTATATAAGAAAGCTGG + Intergenic
1202705161 1_KI270713v1_random:17309-17331 ATCTGATTCTACAAGAGTAAGGG - Intergenic
925036930 2:694523-694545 ATATGCTTCTATAAGTTATATGG - Intergenic
925784618 2:7419453-7419475 ATGGGCTTTTATAAGAGATATGG - Intergenic
929282501 2:40096439-40096461 ATCTCCTTGAATAAGAGAAATGG + Intergenic
929305684 2:40358856-40358878 ATATGCTTCTACAAGACTGAAGG + Intronic
929731811 2:44502769-44502791 AGCTGATTTTAGAAGAGAGAAGG + Intronic
933666492 2:84969503-84969525 ATCTCTTTCTACAAGAGAAATGG + Intergenic
936413564 2:112282616-112282638 ATATGCTTAGATAAGAGAGTGGG - Intronic
937009421 2:118548913-118548935 ATCTGCTTCTGTAGGACGGAGGG - Intergenic
937508293 2:122561992-122562014 ATCCTCTTGTGTAAGAGAGATGG + Intergenic
938705652 2:133922898-133922920 ATGTGCTTCTATAAGAGCTTTGG + Intergenic
938956424 2:136302868-136302890 ATCAGCTTTTATTAAAGAGACGG - Intergenic
939081759 2:137671176-137671198 ATCTGCATATATTAGGGAGATGG + Intronic
939210352 2:139166863-139166885 ATGTGCTTCTATACGGGGGATGG - Intergenic
940154469 2:150639567-150639589 CTCTCCATCTATAAGAGAGTGGG - Intergenic
940782554 2:157948470-157948492 ACATACTACTATAAGAGAGAAGG - Intronic
940870179 2:158853272-158853294 ATCTTTTTCTTAAAGAGAGAAGG + Intronic
940872888 2:158874331-158874353 ATCTTTTTCTTAAAGAGAGAAGG + Intergenic
941393709 2:164948197-164948219 CTCAGCTTCTATAAGACAGTAGG - Intronic
942055491 2:172178510-172178532 ATCTGCCTCTGTCAAAGAGATGG - Intergenic
942142650 2:172993436-172993458 ATCTGTTCCTAGAATAGAGAAGG - Intronic
942544419 2:177047966-177047988 TTCTCTTTCTAAAAGAGAGAAGG - Intergenic
942554009 2:177152421-177152443 ATCTACTTCTACAGGAGAAAAGG + Intergenic
942745383 2:179225929-179225951 ATTTGCTTCAATAATGGAGAAGG + Intronic
944051618 2:195476407-195476429 TCCTGCTTCCAGAAGAGAGAAGG - Intergenic
948154845 2:235772967-235772989 ATCTGCTTCCAAAACACAGAGGG - Intronic
1169773388 20:9225753-9225775 ATCTGCTTCTATAAGAGAGAGGG + Intronic
1170205376 20:13792319-13792341 ATTGGCTTCTCTAATAGAGAAGG + Intronic
1170388858 20:15850562-15850584 ATCTCCTTCTATGTGAGAAATGG - Intronic
1171969650 20:31555961-31555983 ACCTCCTTCTTTAAGAGACAGGG - Intronic
1174708107 20:52677452-52677474 ATCTGCTGCCATAACAGTGAGGG - Intergenic
1175355751 20:58366120-58366142 GTCTGCTTCAATCACAGAGACGG - Exonic
1177233457 21:18353784-18353806 ATCAGATTCTATAAGAAAGGTGG + Exonic
1178252632 21:31019220-31019242 ATCTGCTTCTGTCTGAGAAATGG - Intergenic
1181083060 22:20426625-20426647 TTATCCTTCTTTAAGAGAGAAGG + Intronic
1182005540 22:26956490-26956512 GTCGGCTTCTGTAAGTGAGAGGG - Intergenic
1182265737 22:29113825-29113847 TGCAGCTTCTATAAGAGGGAGGG - Intronic
1183002896 22:34876431-34876453 TTCTTCTTCTGTAGGAGAGATGG - Intergenic
949839204 3:8301934-8301956 AAATACTTCTAAAAGAGAGAAGG + Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951464494 3:22987582-22987604 ATCTTGTTCTTTAAGACAGAGGG + Intergenic
952729866 3:36627445-36627467 AGGTGCTTCTGTAAGACAGATGG + Intergenic
956101665 3:65774647-65774669 ATCTGCTTGCCTAAGAGAAATGG + Intronic
956358610 3:68420898-68420920 AGTTTCTTCTTTAAGAGAGAGGG - Intronic
956651456 3:71508370-71508392 ATCTGCTTCTGTCACAGTGAGGG - Intronic
957075505 3:75599950-75599972 ATCTTTTTCTTAAAGAGAGAAGG - Intergenic
957361987 3:79173003-79173025 ATCTGCCTCTATAACACTGAAGG + Intronic
957412636 3:79860855-79860877 TTCTGGCTCTATAAAAGAGAGGG - Intergenic
958161788 3:89826108-89826130 ATTTGCTTCTTCAAGAAAGAGGG + Intergenic
960003939 3:112762709-112762731 ATCTTCTGCAATATGAGAGAAGG - Intronic
960078299 3:113513648-113513670 ATCTGATTCACTAAGAGATAAGG - Intronic
960333052 3:116386475-116386497 CTCTCTTTCTCTAAGAGAGATGG + Intronic
960338589 3:116447259-116447281 ATTTGCTTACATAAGAGGGATGG - Intronic
960729217 3:120706761-120706783 ATATGCCACTATAAGAGAGTGGG + Intronic
961275679 3:125724185-125724207 ATCTTTTTCTTAAAGAGAGAAGG + Intergenic
961278593 3:125746780-125746802 ATCTTTTTCTTAAAGAGAGAAGG + Intergenic
961494878 3:127284300-127284322 AGCTGCTTCAGTAAAAGAGAAGG + Intergenic
961875807 3:130022853-130022875 ATCTTTTTCTTAAAGAGAGAAGG - Intergenic
962766421 3:138567910-138567932 ATCTCATTCTATTATAGAGAAGG - Intronic
963834657 3:150046024-150046046 ATCTGATTTTAAAAGACAGAAGG + Intronic
964439981 3:156698214-156698236 TTGCACTTCTATAAGAGAGATGG - Intronic
964740845 3:159964409-159964431 ATTTGCTTCCATAAAAGAAAAGG + Intergenic
964909672 3:161764660-161764682 GTCTGCTTCTATAATTGGGAGGG - Intergenic
965613188 3:170566061-170566083 TTCCTCTTCTATAAGACAGAAGG - Intronic
966062196 3:175771666-175771688 GTCTCCTTGTAAAAGAGAGATGG - Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
969023799 4:4157776-4157798 ATCTTTTTCTTAAAGAGAGAAGG - Intergenic
969069191 4:4519569-4519591 ATTTGGTTCTATTAGGGAGAAGG - Intronic
969644447 4:8419126-8419148 ATCTGGTTCTTTAAGAGATAAGG - Intronic
969730023 4:8949294-8949316 ATCTTTTTCTTCAAGAGAGAAGG + Intergenic
969786188 4:9458924-9458946 ATCTTTTTCTTAAAGAGAGAAGG + Intergenic
969789627 4:9483408-9483430 ATCTTTTTCTTCAAGAGAGAAGG + Intergenic
975244946 4:72109555-72109577 ATCTGCTTCTTGAAGTGAGCAGG - Intronic
976528067 4:86116469-86116491 ATCTGGTTTTATATGTGAGATGG + Intronic
977499978 4:97826008-97826030 ATCAGATTCTATAATAGATAAGG + Intronic
980157861 4:129128634-129128656 ATCTTCTTCTATGGAAGAGAGGG - Intergenic
982648790 4:158059605-158059627 ATTTGCTTCTCTATGAGACAAGG - Intergenic
984009513 4:174354134-174354156 ATCTCATTCTATAAAACAGAAGG - Intergenic
987017951 5:13839138-13839160 CTCTGCCTCTATAAGACTGAAGG + Intronic
987086610 5:14475400-14475422 ATCTGCTTCTGCAGAAGAGAAGG - Intronic
987777370 5:22385604-22385626 TTCTGCCTCTATAAGACAGTAGG + Intronic
988419958 5:30993333-30993355 ATCTGCTCTAATTAGAGAGATGG + Intergenic
988555060 5:32229347-32229369 ACTTGCTTCTATAATTGAGATGG + Exonic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989609323 5:43276374-43276396 ATCTGGTTCTTTAAAAGTGATGG - Intronic
990213315 5:53504068-53504090 ATCAGCTACTATTAGAGAGGTGG - Intergenic
990255194 5:53961094-53961116 AACTGCTTCTATATGAAACAAGG + Intronic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993296701 5:86149856-86149878 ATCTGTTGCTAAAAGAGAGAAGG + Intergenic
995222407 5:109664865-109664887 ATATGCATCTAAAAGACAGAAGG - Intergenic
995286588 5:110395950-110395972 ATCTGATAATATAAGATAGAAGG + Intronic
996941792 5:129015870-129015892 ATTTTCTTCTAACAGAGAGAAGG + Exonic
998919287 5:147050066-147050088 ATGTGCTTGAGTAAGAGAGAGGG + Intronic
999092422 5:148948377-148948399 ATCTCCTTTTGTAACAGAGAAGG - Intronic
1001179291 5:169503658-169503680 TTCTCCATCTATATGAGAGAAGG + Intergenic
1004010480 6:11681291-11681313 ATCTGCTTCCAGAACAGAGGAGG + Intergenic
1004591883 6:17059768-17059790 ATTTGCTTCTCAAAGATAGAGGG - Intergenic
1004792645 6:19044482-19044504 AGATGCTTCTATAGCAGAGAAGG - Intergenic
1007178181 6:39910514-39910536 CTCAGCTTCTGTAAGAGGGATGG + Intronic
1008455333 6:51704366-51704388 ATTTTCTTCTATAAGATAAAGGG + Intronic
1009467017 6:63983873-63983895 ATCTGCTTCAAGAAGAAAAAAGG + Intronic
1010127427 6:72449311-72449333 ATCTGCAGGTATAAGAGAGAGGG - Intergenic
1010151641 6:72739658-72739680 ATCTGTTTCTGTATCAGAGAAGG + Intronic
1015598717 6:134891871-134891893 TTCTGCTTCTAGAAGCTAGATGG - Intergenic
1016480082 6:144471194-144471216 GTCTGCGTGTATTAGAGAGAGGG + Intronic
1016567474 6:145472362-145472384 CTCTGCTTGTCTCAGAGAGAAGG - Intergenic
1018590556 6:165416280-165416302 ATCTGCATATGTAAAAGAGAAGG + Exonic
1018916833 6:168138075-168138097 ATCTGCTTCTCTAAAAGACATGG + Intergenic
1020979541 7:15050888-15050910 ATGTGCCTCGATAAGAAAGATGG - Intergenic
1020981381 7:15073313-15073335 ATATTCTTCTATAAAATAGAGGG + Intergenic
1021736608 7:23645447-23645469 AGATACTTCTATAAGAGAAAGGG - Intergenic
1021813626 7:24426959-24426981 CTCTGGATCAATAAGAGAGATGG + Intergenic
1021915533 7:25428396-25428418 TTTGGCTTCTATAGGAGAGATGG + Intergenic
1022621473 7:31988685-31988707 ATTTGTTTTTATAAGAGACAGGG - Intronic
1022764885 7:33401060-33401082 ATATCCTGCTATAAGAGATATGG - Intronic
1023165029 7:37335390-37335412 AGCAGCTTCTATAAAACAGAGGG + Intronic
1023620121 7:42062666-42062688 AATTGCTTGGATAAGAGAGAAGG + Intronic
1023824845 7:44002133-44002155 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1024695467 7:51852091-51852113 ATCTGGATGTATAACAGAGAAGG - Intergenic
1026088394 7:67280907-67280929 TTGTGCTTCTAGAAGAGACAGGG - Intergenic
1027117996 7:75496212-75496234 TTGTGCTTCTAGAAGAGACAGGG - Intergenic
1027273809 7:76539248-76539270 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1027327256 7:77058302-77058324 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1028343887 7:89756824-89756846 ATCTACTTCTTTAAGATAAAGGG - Intergenic
1029130999 7:98330833-98330855 ATCTGCTTGCTTAACAGAGAGGG - Intronic
1029719507 7:102353834-102353856 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1029753108 7:102555438-102555460 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1029771059 7:102654521-102654543 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1029789815 7:102830485-102830507 ATCTGGTTCTATTAGTGAGCTGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1032992539 7:137409912-137409934 ATATGTTTGTATGAGAGAGAGGG - Intronic
1033056298 7:138058079-138058101 ATGTCTTTATATAAGAGAGAGGG - Intronic
1033707461 7:143902912-143902934 ATGTGCTTCTATAAGAGGCGGGG + Intergenic
1033770816 7:144549609-144549631 AACTCCTTCTATTAGAAAGAAGG - Intronic
1033851350 7:145499370-145499392 ATCTTGTTCTATAAGATAAAGGG - Intergenic
1033881431 7:145888153-145888175 GTTTCCTTCTATAATAGAGATGG + Intergenic
1036100341 8:5775351-5775373 ATCTGCTTCTCCCAGAGATACGG - Intergenic
1036832775 8:12034915-12034937 ATCTTTTTCTGAAAGAGAGAAGG - Intergenic
1036902950 8:12685438-12685460 ATCTTTTTCTAAAAGAGAGAAGG - Intergenic
1036921770 8:12862714-12862736 ATCTGCTTCTCAAAGAGAGGGGG + Intergenic
1040074023 8:43211467-43211489 ATGTGCTTCTATAATACAAAAGG - Intergenic
1040838416 8:51757343-51757365 ATCAGCTTCTGTAAGACAGCAGG + Intronic
1043435165 8:80231087-80231109 ATCTGCCTTTATAGGAGAGAGGG + Intronic
1045409584 8:101903823-101903845 CTCAGCTTCTAAAAGACAGAAGG + Intronic
1045751214 8:105486126-105486148 TCCTACTTCTATAAGTGAGAAGG + Intronic
1045788511 8:105954845-105954867 ATTGACTTCTATAAGAGAGTAGG - Intergenic
1045791593 8:105990201-105990223 GCCTGCTGCAATAAGAGAGAGGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051033253 9:12709277-12709299 ATATGCTTGTATTAGAAAGAAGG - Exonic
1054962582 9:70985271-70985293 ATTTTCTTCTTAAAGAGAGATGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056632211 9:88303270-88303292 AACTGCTGCTATAAAACAGAAGG - Intergenic
1057091175 9:92259358-92259380 ATCTGCTGCTTGCAGAGAGAGGG + Intronic
1058956821 9:109956761-109956783 ATCTGATTATATTAAAGAGATGG - Intronic
1059308215 9:113371067-113371089 ATCAGCTGCTCTAAGAGAAAAGG - Exonic
1060263760 9:122097353-122097375 ATCTGCTTCTTCAAGAGGGCAGG + Intergenic
1186926045 X:14334701-14334723 ATCTGGAGCTATAAGAGAGCAGG - Intergenic
1189092246 X:38096897-38096919 ATCTACCTCCAAAAGAGAGATGG + Intronic
1189225855 X:39412644-39412666 ATCTGTTTTTAAAAGATAGAAGG + Intergenic
1190844382 X:54178050-54178072 ATCTGCTTCTTTAAGAATAATGG + Intronic
1191121761 X:56913469-56913491 ATCTGCTTCCATAAAAGGGAAGG - Intergenic
1195895918 X:109746115-109746137 TTTTGCTTCTATAAGACAGTTGG - Intergenic
1195980921 X:110577619-110577641 TTCTGCCTTTATAAGTGAGATGG - Intergenic
1198531892 X:137556004-137556026 ACCTCCTTCTAGAAGAAAGAAGG - Intergenic
1199160059 X:144598039-144598061 ATAAGCTACTATTAGAGAGAGGG - Intergenic
1200486862 Y:3779824-3779846 TTCTGCTGCTATCAGATAGAAGG - Intergenic
1201062655 Y:10061244-10061266 ATCTGCTGCAATAACAAAGAAGG + Intergenic
1201702397 Y:16898735-16898757 TTCAGCTTCTTTAAGAGATATGG - Intergenic
1201943416 Y:19483773-19483795 CTCTGCTTCTCTAACAGAGGAGG + Intergenic
1202376619 Y:24243906-24243928 ATCTGATTTTTTAAGGGAGAGGG + Intergenic
1202494161 Y:25426213-25426235 ATCTGATTTTTTAAGGGAGAGGG - Intergenic