ID: 1169777282

View in Genome Browser
Species Human (GRCh38)
Location 20:9269487-9269509
Sequence TCATTCCAACACAGTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169777280_1169777282 21 Left 1169777280 20:9269443-9269465 CCTGGAGCTGTCAGCCATAAGAG 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1169777282 20:9269487-9269509 TCATTCCAACACAGTGAGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 162
1169777281_1169777282 7 Left 1169777281 20:9269457-9269479 CCATAAGAGATAATATGTTCAAC 0: 1
1: 0
2: 1
3: 16
4: 151
Right 1169777282 20:9269487-9269509 TCATTCCAACACAGTGAGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169777282 Original CRISPR TCATTCCAACACAGTGAGCA AGG Intronic
902098309 1:13964830-13964852 TCAATCTACCACAGTGAGAAGGG + Intergenic
905858567 1:41330957-41330979 TCATTCCACCGGAGGGAGCAGGG + Intergenic
907733587 1:57090533-57090555 TCATTACAAGCCAGTGAGAAAGG + Intronic
909913296 1:81286739-81286761 TGATTTCAAGGCAGTGAGCAAGG + Intergenic
910156792 1:84228435-84228457 TCAGTACAACACTGTGAGGAAGG - Intronic
912167934 1:107062027-107062049 TCATGCTAACAGACTGAGCAGGG + Intergenic
912746995 1:112253285-112253307 TCATTTCAAAACAGTGACCCTGG + Intergenic
913001979 1:114589915-114589937 ACTTTCCAACAGAGTGACCATGG + Intronic
913234949 1:116772112-116772134 TCACTGCAACCCACTGAGCATGG - Intergenic
913448810 1:118978310-118978332 TCGTTCCAACAAAGTAAGGATGG + Intronic
913508689 1:119542810-119542832 TCCTTCCAACACTGTTAGCTTGG - Intergenic
915428322 1:155845437-155845459 TCATTTCAACAGAATCAGCAAGG + Intronic
916080323 1:161228172-161228194 CCATTCCCCCACAGTGATCATGG + Exonic
917037424 1:170763905-170763927 TTATTCAAACAGAGTCAGCATGG - Intergenic
918760160 1:188394125-188394147 TAATTCCAACAAAGTGAAAAAGG + Intergenic
921221168 1:212975037-212975059 TCAATCCTGTACAGTGAGCAGGG + Intronic
922991053 1:229911937-229911959 TTATGCCAACAGAGTGAGAAGGG - Intergenic
923468681 1:234270664-234270686 TCCATCCATCACAGTTAGCAGGG - Intronic
1065098018 10:22301587-22301609 TCATGCCAACAAAGCGAGCCAGG + Intergenic
1067102621 10:43343921-43343943 TCTTCCCAGCACCGTGAGCAGGG + Intergenic
1067299234 10:44994008-44994030 TCATTCAATCACATTGAGGAGGG + Exonic
1068862405 10:61860656-61860678 TCATTTCAACACAATGTGAAAGG - Intergenic
1072556956 10:96525732-96525754 TCATTCCTACAAAGTAACCAAGG + Intronic
1073765519 10:106678227-106678249 TCTTTCCAACACCGCAAGCAAGG - Intronic
1073813841 10:107183270-107183292 TTATTCCAAAACATTGAGGAGGG + Intergenic
1076245042 10:128940456-128940478 TCCTTCCAACACAGGAGGCAGGG + Intergenic
1076562229 10:131374709-131374731 TCATTCATACACAGTGATCTTGG - Intergenic
1078001744 11:7502242-7502264 TAATCACAACACAGTGAGGAAGG + Intronic
1078755365 11:14203928-14203950 TCATTCCAACAGGGAGAGCAGGG + Intronic
1078962070 11:16287874-16287896 TGACTCCAAAATAGTGAGCAGGG + Intronic
1079194670 11:18315089-18315111 TCATTCCAAAACAGGGAGTCTGG - Intronic
1080600998 11:33820488-33820510 TTCTTCCCACAGAGTGAGCAGGG + Intergenic
1083157280 11:60831688-60831710 TCATTTCAACTGAGTGAGGATGG + Intergenic
1083166587 11:60891902-60891924 TTATACAAACACACTGAGCAGGG + Intronic
1083570785 11:63761418-63761440 TCATCCCAAGGCAGTGTGCAGGG + Exonic
1084605231 11:70168366-70168388 CCTTTCAAACACAGTGATCAGGG - Intronic
1085667933 11:78432316-78432338 TCATTTCAATACAGTGATTAAGG + Intergenic
1085702723 11:78759393-78759415 TTATTCAATCCCAGTGAGCAGGG + Intronic
1086872064 11:92049624-92049646 TTCTTCCATCACAGAGAGCATGG - Intergenic
1087433634 11:98084872-98084894 TCATTACAGTAGAGTGAGCAAGG + Intergenic
1089880578 11:121769460-121769482 TCATTTACAAACAGTGAGCAGGG + Intergenic
1094494653 12:30981923-30981945 TGATTCCAAGACAGTGGACATGG - Intronic
1095119292 12:38396014-38396036 ACACTCCAACACATTCAGCAGGG + Intergenic
1099170101 12:79353760-79353782 TCATCCCAACACAGTGCCCCAGG + Intronic
1102124203 12:110467328-110467350 ACATTCAAATACAGTGAGAATGG - Intronic
1103051434 12:117783328-117783350 TCATGTCAACGCATTGAGCAAGG + Intronic
1103878945 12:124151102-124151124 TCCCTCAAACAAAGTGAGCAGGG - Intronic
1105274386 13:18906148-18906170 TCTCTGCAACACAGTGAGAAGGG - Intergenic
1105542515 13:21327358-21327380 TCATTGCAATACAGTGTGCTGGG + Intergenic
1107716630 13:43206014-43206036 TCATCCCAATTCAGTGATCATGG - Intergenic
1108461843 13:50674805-50674827 TCATTCCTACACTGGGAACATGG - Intronic
1108946335 13:56029573-56029595 TCACTCCAACAAAGTGAAAAAGG + Intergenic
1109602598 13:64651275-64651297 TCATTCCAAGATAGAAAGCATGG - Intergenic
1110739572 13:78978710-78978732 TCATTCCAATACAGTCCCCAGGG - Intergenic
1111932180 13:94523824-94523846 TCTTTCCAGCCCAGGGAGCAGGG - Intergenic
1114854104 14:26416705-26416727 ACATACACACACAGTGAGCAAGG + Intergenic
1115534697 14:34362201-34362223 CCTTTCCATCACAGTGAGCAGGG + Intronic
1117044001 14:51794324-51794346 TGGTTCCAACACAGTGAGTTAGG - Intergenic
1120583668 14:86285316-86285338 TCAATGCAACAGAGTGGGCAGGG - Intergenic
1120711813 14:87800283-87800305 TCATTCTCTCACAGTGAGCTGGG - Intergenic
1121422673 14:93826301-93826323 TCCTTTCTAGACAGTGAGCAGGG - Intergenic
1123813048 15:23948584-23948606 TGAGTCCAGCACAGTGAGGAAGG + Intergenic
1123927555 15:25132914-25132936 CCATTACAACACATTTAGCATGG - Intergenic
1125864236 15:43029416-43029438 TCATTACCAGACAATGAGCAAGG + Intronic
1127789068 15:62382132-62382154 TCATTTCCACAAAATGAGCATGG - Intergenic
1127857625 15:62965656-62965678 TCATAACATCCCAGTGAGCAAGG - Intergenic
1128527749 15:68423918-68423940 TCATTCCAACCCTGTGATCTTGG - Intronic
1129010061 15:72407754-72407776 TGATTCCAACAGAGAGATCAAGG + Exonic
1130958834 15:88646421-88646443 GCATTCACACACACTGAGCATGG - Intronic
1135648441 16:24184861-24184883 TATTTTCAAAACAGTGAGCATGG - Intronic
1136088301 16:27901225-27901247 TCATTTCAAAGCAGTGAGCAGGG + Intronic
1137900452 16:52262099-52262121 TGATTCCAACACAATGGGAAAGG + Intergenic
1140297821 16:73726216-73726238 TCCTTCCAACACAGTGGGGCTGG + Intergenic
1141033779 16:80611163-80611185 TCCTTCCAAGACAGAGAGCTGGG + Intronic
1144253938 17:13446973-13446995 TCATTCCTACTCATTCAGCAAGG + Intergenic
1153906441 18:9665778-9665800 TCATAACAACACAGAGAGGATGG + Intergenic
1155878480 18:31115225-31115247 ACATTCTAACACAGAGACCAAGG - Intergenic
1157272292 18:46285405-46285427 TCATGACCACACAGAGAGCATGG - Intergenic
1166116253 19:40656825-40656847 TCATTGCAACACAGGGAGGGTGG - Intergenic
1166800190 19:45451816-45451838 TCATATCTACACAGTCAGCAGGG - Intronic
925942738 2:8836368-8836390 TCATTCACACACAGTGTGAACGG - Intronic
927399420 2:22694107-22694129 TCATTCAAATATAGTCAGCAGGG - Intergenic
931988221 2:67761757-67761779 TCATACCAAGACAGGGAGGATGG - Intergenic
934905521 2:98198155-98198177 TAATTCCAACACAGAGCCCAGGG + Intronic
935047496 2:99495179-99495201 TCATTCCAAGAGAGGAAGCAAGG + Intergenic
935538140 2:104318351-104318373 TCATTCCAAGACAGTGAGCCAGG + Intergenic
936247184 2:110838577-110838599 TCATTCCTACAGAGAAAGCAGGG - Intronic
937185831 2:120041270-120041292 ACATTGCAACACAGTGAACGTGG - Intronic
940588994 2:155696824-155696846 ACATTCCAACACAAAGAACAGGG + Intergenic
942187825 2:173441048-173441070 TCACTCCAACACTGTCATCAAGG - Intergenic
943560945 2:189460897-189460919 TCATACCCACACAGTCAGTAAGG - Intronic
945367204 2:208969381-208969403 TCATTACAACAGAGTGATCAAGG + Intergenic
947286838 2:228526636-228526658 TCATTCCAGCACAGTGTTTAGGG - Intergenic
947906778 2:233770236-233770258 TGATTCCAACACTCTGAGCTGGG + Intronic
948324678 2:237104425-237104447 ACATTGCAATACAGGGAGCAGGG + Intergenic
1169777282 20:9269487-9269509 TCATTCCAACACAGTGAGCAAGG + Intronic
1170235217 20:14095942-14095964 CTATTCCTGCACAGTGAGCAAGG - Intronic
1170376916 20:15710156-15710178 TCATTTCACCACAGTTAGAATGG + Intronic
1172891172 20:38266430-38266452 TCATCCCACCCCAGTGAGCATGG + Intronic
1173627155 20:44481413-44481435 GCATTTCAACACAATGACCAGGG + Intronic
1174442813 20:50569442-50569464 CTATTCCAACAGAGTGAGGAGGG - Intronic
1176960193 21:15150731-15150753 TTATTGCAACAAAATGAGCAAGG - Intergenic
1177421476 21:20863543-20863565 TTATTTCAACACATTGAGAAAGG - Intergenic
1180608557 22:17080480-17080502 TCATTCCAGGACAGTGAGAGAGG - Intergenic
1181301134 22:21882139-21882161 TAATGCCAACACAGAGAGGAGGG - Intergenic
1182978552 22:34646446-34646468 TCCTGACAACACAGAGAGCAAGG - Intergenic
951754161 3:26071211-26071233 TGTTTCCATCACTGTGAGCAAGG + Intergenic
952151217 3:30594748-30594770 TGATACCACCACAGTGAGGAAGG + Intergenic
952338012 3:32421478-32421500 GCATTCCAACACACAGAGAAGGG - Intronic
952676102 3:36032090-36032112 TCATTCCAAAGCAGTGAGGGTGG + Intergenic
953143421 3:40250338-40250360 ACATTCCAACAGAGGGAGAAAGG - Intronic
953328270 3:42030925-42030947 TCATCCCAAATCATTGAGCATGG + Intronic
953330561 3:42049759-42049781 TCATTCCAAAAAAGTTAGGAGGG - Intronic
955087273 3:55715463-55715485 TCATTCCCACACACTGAACTTGG + Intronic
958668695 3:97174504-97174526 ACATTCCCACACAGTATGCAAGG + Intronic
960301897 3:116012674-116012696 TCATTCCAGCACAATAACCACGG - Intronic
961755863 3:129127052-129127074 TCAGTGCTGCACAGTGAGCAGGG + Intronic
969367931 4:6710303-6710325 CCATTCTAAAACAGTGAGCAGGG - Intergenic
971557568 4:28034162-28034184 TCATTTCAACTCAGTTAACATGG + Intergenic
972000146 4:34021326-34021348 TGATTCCATAACAGTGAACATGG - Intergenic
972062011 4:34887016-34887038 TCATCTCAAAACAGTCAGCATGG - Intergenic
972530036 4:39953438-39953460 TCATTCCAACACACTGGGAGTGG + Intronic
976461522 4:85318296-85318318 ACATTCCAACACAATGGGCCTGG - Intergenic
976628434 4:87211713-87211735 TCTTTCCAACTCAGTGATCTCGG - Intronic
983159360 4:164392448-164392470 TTATTACAAAACAGAGAGCACGG - Intergenic
985220567 4:187699223-187699245 TCATTCCATCACAGGGAGATGGG + Intergenic
986104451 5:4646249-4646271 TCTCACCCACACAGTGAGCATGG + Intergenic
986198805 5:5562199-5562221 TCATTCCTACCCAGTGGGCCTGG + Intergenic
988652425 5:33167083-33167105 TAATTCCCACACAGTCAGCAAGG + Intergenic
990621068 5:57558870-57558892 GCAGTTCTACACAGTGAGCATGG + Intergenic
993296652 5:86149509-86149531 TGATTCCACCTCAGTAAGCAAGG - Intergenic
993643600 5:90435909-90435931 TCATTGCAACCCAATGAGGATGG - Intergenic
998697941 5:144662333-144662355 TCCTTCCAAATCAGTGATCATGG - Intergenic
999266797 5:150271732-150271754 CCTTTCCAACACACTGACCATGG + Intronic
1000504282 5:162094714-162094736 TCAGTCCACCACAGTGAGTTAGG + Intronic
1003409498 6:5850463-5850485 TCATTGCAATACAGTGTGCTGGG - Intergenic
1008028648 6:46667848-46667870 TCATCCCACAACAGAGAGCAAGG + Intronic
1010629519 6:78181257-78181279 TCATAACAAAACAGTGAGCATGG + Intergenic
1011032350 6:82937513-82937535 TCTTTCCCACACACTGAGCATGG - Intronic
1011154559 6:84315483-84315505 TCATAACCACACAGTCAGCAGGG - Intergenic
1015287857 6:131506591-131506613 TCAGTCCAACACAATTGGCAGGG + Intergenic
1015564690 6:134556668-134556690 TCAAGCCAAAACAGTGAGCAGGG - Intergenic
1019025963 6:168963137-168963159 TCATTCCAACCCAGAGGGCCAGG + Intergenic
1019201028 6:170315378-170315400 TTATTCCAACAGAGTAGGCAGGG - Intronic
1019215538 6:170440570-170440592 TCCCTCCGTCACAGTGAGCACGG + Intergenic
1020685984 7:11295695-11295717 TCATGCCAACTCAGTGAAAAAGG - Intergenic
1020858444 7:13457945-13457967 TCTTTTCCACACAGTGTGCATGG + Intergenic
1022166896 7:27775650-27775672 TCATACCAACAAGGTGAGCCAGG - Intronic
1023528485 7:41129791-41129813 GCATTCCAACACATGGTGCAGGG + Intergenic
1026509758 7:71018274-71018296 TCATTCCAACACAGCGGGGCAGG + Intergenic
1028300014 7:89187020-89187042 ACATTCCAAGACAGTCATCAAGG - Intronic
1030156352 7:106459832-106459854 TCATTCCAACACACTTTGAATGG - Intergenic
1030594603 7:111522597-111522619 TCATTCCACCCCAGTTAGAATGG + Intronic
1032216131 7:129958758-129958780 TCATTCCAGCACAGGGCACAGGG - Intergenic
1037009090 8:13818862-13818884 TCATTCCAAAACAGAGAGATAGG + Intergenic
1037247462 8:16851896-16851918 ATATTCCCCCACAGTGAGCAAGG - Intergenic
1038587439 8:28802551-28802573 TCATTCCAGAACAGAGACCAAGG + Intronic
1039394137 8:37208641-37208663 TAATTCCAAGACACTGAGTATGG - Intergenic
1041237240 8:55816582-55816604 TCTTACCAATACAGAGAGCAGGG + Intronic
1043917735 8:85942201-85942223 TCATCTCAACCCAGTGAGAATGG - Intergenic
1044219864 8:89657472-89657494 TCATTTCACCACAGTTAGTATGG + Intergenic
1044315232 8:90743038-90743060 TCCGTCTAACACAGTCAGCAGGG + Intronic
1044480680 8:92683928-92683950 ACATTCCAACAAAATGTGCACGG + Intergenic
1046532592 8:115467346-115467368 TCTTTCCAACACAGTGTTCCTGG - Intronic
1048434211 8:134400707-134400729 TCCTTCCAACCCATTAAGCATGG + Intergenic
1049838777 8:144756508-144756530 TGATTCTAACACAGTGTACAGGG - Intergenic
1055560539 9:77517306-77517328 TCATTCAAAAATAGGGAGCAAGG + Intronic
1055934004 9:81588380-81588402 TCTTTCTAACACAGAAAGCAAGG - Intronic
1058456828 9:105145685-105145707 TCAATCAAACACAGTGTGAATGG + Intergenic
1058641365 9:107088764-107088786 TCATTACCACCCAGTGAGGATGG - Intergenic
1186055974 X:5650308-5650330 TGAGTCAAACACAGTGAGGAGGG - Intergenic
1186482686 X:9907997-9908019 TGCTTCCAGCACAGGGAGCATGG + Intronic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1201306468 Y:12554950-12554972 TGCTTCCAGCACAGGGAGCATGG + Intergenic