ID: 1169777669

View in Genome Browser
Species Human (GRCh38)
Location 20:9273907-9273929
Sequence AAGAACAGGAGGAAGACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 484}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169777669 Original CRISPR AAGAACAGGAGGAAGACTGC TGG Intronic
900464011 1:2815242-2815264 GAGCACAGGAGGCAGATTGCAGG - Intergenic
900616045 1:3566137-3566159 AAGAACAGGACAGTGACTGCAGG - Intronic
900820488 1:4883092-4883114 AAAAACAGGAGGATGATTGGAGG + Intergenic
900914592 1:5627153-5627175 ATGACCAGGAGGAAGTTTGCAGG + Intergenic
901102032 1:6726404-6726426 AGGAACAGGAGGAGGCCTGTGGG - Intergenic
901439218 1:9267387-9267409 AAGAACAGATGGGAGAGTGCTGG - Exonic
901555002 1:10024741-10024763 AAGAAGATCAGGAAGATTGCTGG + Intergenic
901668085 1:10837844-10837866 AAGAAGAGGAAGAAGCCTGTGGG + Intergenic
903570023 1:24297489-24297511 AAGATCAGGAGGATGACAACAGG + Intergenic
904266205 1:29319794-29319816 TAGGTCAGGAGGAAGACTGGGGG + Intronic
904439335 1:30520080-30520102 AAGTAGAGGAGGAGGACTGAGGG - Intergenic
905419969 1:37834833-37834855 ACCAAGACGAGGAAGACTGCAGG + Intronic
905796321 1:40818498-40818520 ACGAACACGATGAAGTCTGCAGG - Exonic
906551604 1:46670365-46670387 ATGAAGAGGAGGAAGGCTGTAGG + Intronic
906566051 1:46801893-46801915 AGGAAGGGGAGGAAGACTGATGG + Intronic
906664067 1:47605671-47605693 AGGATCAGGAGGAAGATTGAAGG + Intergenic
907330130 1:53665291-53665313 AGGAACATGGGGAAGACTGGGGG + Intronic
907870340 1:58437360-58437382 AAGAAAAGGAGGGAGAAAGCCGG + Intronic
910420974 1:87063096-87063118 AAGAATAGGAGAAAGAAAGCAGG - Intronic
911054609 1:93699360-93699382 ATGAACAGGAAGAAGACTGTAGG - Intronic
911888879 1:103341572-103341594 ATGAAGAGGAGGAAGAAAGCAGG - Intergenic
911896513 1:103442363-103442385 AAGTACAGGAGGTAGTCTTCAGG - Intergenic
912063569 1:105705944-105705966 AAGAAGAGGAGGAAGAAGGAGGG + Intergenic
912109710 1:106326107-106326129 AGGATCAGGAGCCAGACTGCAGG + Intergenic
913258912 1:116981097-116981119 CAGAAAAGGAGTAAGACTGATGG - Intronic
913290149 1:117264241-117264263 AAGGAAAAGAGGAAGACTCCTGG + Intergenic
914904615 1:151733597-151733619 AGGAACAGGAGGGAAACTGCTGG + Intergenic
917577180 1:176335846-176335868 AAGAACAAAAGGAAGAATGAAGG - Intergenic
918033477 1:180841208-180841230 CAGAATGGGAGGAAGACTTCTGG + Intronic
918643552 1:186874650-186874672 AAGAACAGGTGTAGGATTGCAGG + Intronic
921072682 1:211675388-211675410 AAGATCCGGAGGAAGAGTGATGG - Exonic
921351655 1:214242336-214242358 AAGAGCAGGAGGAAGAAGGTGGG - Intergenic
921839703 1:219815497-219815519 GAGAATTGGAGGAAGACTACAGG - Intronic
921886716 1:220314460-220314482 AAGACCAGCTGGAAGCCTGCAGG + Intergenic
922609185 1:226911800-226911822 AAGAAGAAGAAGAAGACAGCTGG - Intronic
922772735 1:228196390-228196412 AAAAACAGGAAGTAGACTGATGG - Intergenic
923067968 1:230537668-230537690 AAGGTCAACAGGAAGACTGCAGG - Intergenic
923085805 1:230703015-230703037 AAGAAAAGGTGGGAGACTGGGGG + Exonic
924207896 1:241733028-241733050 AAGGACAAGAGAAAGACTTCTGG - Intronic
1063437983 10:6049970-6049992 AAGGACAGGAGGAGACCTGCTGG + Intronic
1064105615 10:12498555-12498577 AAGAAAAGGAGGAACACTTCAGG + Intronic
1064223309 10:13460176-13460198 AACAAAAGGAGGAAGTCAGCCGG + Intronic
1064357782 10:14635260-14635282 AAGAACAGGAGCAAGAAACCAGG + Intronic
1065013966 10:21444431-21444453 CGGAACAGGAGGAAGAGAGCGGG - Intergenic
1065589712 10:27252141-27252163 AAAAAAAGGAGGAAGAGTTCAGG - Intergenic
1067278162 10:44852309-44852331 GAGGAGAGGAGGAAGACAGCTGG + Intergenic
1067789844 10:49279545-49279567 AAGATGAGGAGGAAGAATGATGG + Intergenic
1068206594 10:53863000-53863022 AATAAAATGAGGAAGACTACAGG + Intronic
1068304198 10:55182736-55182758 GAAAACAGGAGGAAAACTGTGGG + Intronic
1068332716 10:55592328-55592350 AAGAACTGGAGGAAGAGAGAAGG + Intronic
1068631805 10:59305830-59305852 AGGGTGAGGAGGAAGACTGCTGG + Intronic
1069070294 10:63985161-63985183 AAGAACAGGAGCAAGAGAGAAGG - Intergenic
1069160348 10:65084596-65084618 AAGTACAGGAGGCAGGCTGGGGG - Intergenic
1070029039 10:72659208-72659230 AACAACAGAAGGAAAACAGCAGG - Intergenic
1070288626 10:75100630-75100652 AGGGAGAGAAGGAAGACTGCAGG - Intronic
1070438033 10:76412785-76412807 AGGGAAAGGAGGAAGATTGCAGG - Intronic
1070736869 10:78869055-78869077 ATGGAGAGGAGGAAGAATGCAGG - Intergenic
1070796565 10:79220269-79220291 AAGCAGAGGAGGAAGGCTGGAGG - Intronic
1071407193 10:85348666-85348688 AAGAAGAGCAGGAAGACAGCAGG + Intergenic
1072914194 10:99527107-99527129 AGGGAGAGGAGGAGGACTGCAGG + Intergenic
1074572995 10:114641783-114641805 GAGATCAGGAGGCAGACAGCAGG + Intronic
1074853290 10:117455732-117455754 AAGAACTGGAGGATGAGTTCAGG - Intergenic
1076413973 10:130271728-130271750 AACAGGAGGAGGAAGACAGCAGG - Intergenic
1076501836 10:130943331-130943353 AAGAACAGCTGGAAGACTACTGG + Intergenic
1077363735 11:2152948-2152970 ATGAACAGGAGGGAGGCTCCAGG + Intronic
1078200469 11:9177990-9178012 AAAACAAGGAAGAAGACTGCAGG + Intronic
1078500126 11:11865246-11865268 AAGAAAAGGAGAAAGAGGGCAGG - Intronic
1078522647 11:12075747-12075769 AACCATAAGAGGAAGACTGCTGG - Intergenic
1078582309 11:12547932-12547954 AAGAACAGTAAGGAGACTGTGGG - Intergenic
1079448114 11:20574695-20574717 AAGTACAGGAAGAAGGCTGAAGG - Intergenic
1079841468 11:25406002-25406024 AAGAAAAAGATGAAGACTGCAGG - Intergenic
1080595878 11:33774186-33774208 CAGGACAGGAGGAAGACTCAGGG + Intronic
1081036906 11:38159625-38159647 AAGAGCAGGAGCAAGAGGGCAGG - Intergenic
1081043362 11:38239449-38239471 AAGAAAAGAAAGAAAACTGCAGG - Intergenic
1082934560 11:58642891-58642913 AAGAAAGACAGGAAGACTGCAGG - Intronic
1083479377 11:62933882-62933904 AAGGAGAGGAGGAAGAGGGCTGG - Intergenic
1083489081 11:63001566-63001588 CAGAACAGCAGGAAGCCTGACGG - Intronic
1085056131 11:73405092-73405114 AGGAAGAGGAGGAAGACAGTGGG - Intronic
1085163880 11:74377955-74377977 AAAAAGAGGAGGAAGACAGTAGG + Intronic
1085212222 11:74791506-74791528 GAGGACAGGAGGAAGGCTGTGGG - Intronic
1085250607 11:75141170-75141192 GTGAACAGGAGGAAGGCTGCAGG + Intronic
1085258026 11:75187979-75188001 AAGAACAAATGGAACACTGCAGG + Intronic
1085499547 11:77007285-77007307 AAGGAGAGGAGGAAGAGAGCAGG - Intronic
1085512570 11:77095766-77095788 AAGAACAGGCCCAGGACTGCAGG + Intronic
1085847297 11:80080680-80080702 AAGGACAGGAGGAAGAAAGAAGG + Intergenic
1087796050 11:102455409-102455431 AAGAACAGGAGCAAGAACACAGG - Intronic
1087917266 11:103825402-103825424 GGGAACAGGAGGCAGACTGCTGG + Intergenic
1088318595 11:108532055-108532077 GAGAACAAATGGAAGACTGCAGG - Intronic
1088513928 11:110607350-110607372 ATAATCAGAAGGAAGACTGCAGG + Intronic
1088534188 11:110841845-110841867 AAGAAATGGAACAAGACTGCAGG - Intergenic
1088554096 11:111044017-111044039 AAGAGAAGGAGGAAGTCTGATGG - Intergenic
1088602241 11:111491177-111491199 AAGAACAGGGGGAAGATTAGTGG + Intronic
1088835787 11:113577098-113577120 CAGCACAGCAGGAAAACTGCAGG - Intergenic
1088897342 11:114088611-114088633 AGGAACAGGAGGATGCCTGATGG + Intronic
1088923760 11:114280703-114280725 AAGGACAGCAGGATGGCTGCAGG + Intronic
1089742136 11:120591825-120591847 AAGAAGAGGAGGAGGGATGCAGG - Intronic
1089759607 11:120713419-120713441 GAGAGCAGGAGGAAGACAGAGGG + Intronic
1089792155 11:120953092-120953114 AAGGACAGGAGAAGGACTGGGGG + Intronic
1089841792 11:121425047-121425069 AAGAACAGGAGCAAGAGAGAAGG - Intergenic
1090655165 11:128837672-128837694 AAGAACAGTGGGAAGTCTGATGG - Intronic
1090714780 11:129420795-129420817 AAGTACAGGAAGAACACTGTGGG + Intronic
1092534406 12:9374824-9374846 AAGGCCAGGAGGCAGGCTGCTGG - Intergenic
1092629312 12:10361342-10361364 AAGAACAGGAAGAAGAGGGCAGG + Intergenic
1092721704 12:11447602-11447624 GAGAACATGAGGAAGACCACTGG - Intronic
1092739847 12:11616893-11616915 CAGAACAGGAGGAAGATGGTGGG + Intergenic
1093767449 12:22981502-22981524 AAAAACAGGACTATGACTGCTGG + Intergenic
1093830498 12:23751009-23751031 AAGAACTAAAGAAAGACTGCTGG - Intronic
1095833502 12:46612551-46612573 AAGAAAAGGAGGAAGATGGAAGG - Intergenic
1096357470 12:50953219-50953241 AACAACAGGAGACAGACAGCAGG + Intergenic
1098528970 12:71519119-71519141 AATAACAGGAGGAGGATGGCAGG - Intronic
1100453060 12:94726297-94726319 AGTAAGAGGAGGAAAACTGCAGG - Intergenic
1100613795 12:96215070-96215092 AAGAAAAGGAGAAAAACTTCTGG - Intronic
1101600358 12:106204359-106204381 AAGAACAGGAGGCAGCGAGCTGG - Intergenic
1103103299 12:118199600-118199622 AGGAGCTAGAGGAAGACTGCTGG + Intronic
1103211363 12:119169239-119169261 GGGAGCAGGAGGAAGACTGGAGG - Intergenic
1103939214 12:124492853-124492875 AAGGGCAGGAGGAAGAGTTCTGG - Intronic
1104724482 12:131067366-131067388 AAGAACTGGAGAAAGAATACTGG + Intronic
1105029637 12:132873810-132873832 AAGAACAGGAGGATGAGTGATGG - Intronic
1105044699 12:132992774-132992796 AAGAACAGAAGAAAGACAGTCGG - Intronic
1107176468 13:37405269-37405291 AAGAAAAGGAGTATGACTACTGG + Intergenic
1107792693 13:44018122-44018144 AAGCACAGGAAGAAAACAGCAGG + Intergenic
1108168621 13:47718548-47718570 AAGAAAAGGGGGAAGAAAGCAGG + Intergenic
1108495747 13:51023495-51023517 AGGAACAGAAGGTAGAATGCTGG + Intergenic
1108950753 13:56088794-56088816 CAGAACAGGAGGAAGAGAGGGGG - Intergenic
1108975561 13:56439233-56439255 AAAAACAGGAGGATGGGTGCAGG - Intergenic
1109220915 13:59640021-59640043 CAGAGCAGGAGGAAGAGAGCAGG - Intergenic
1109856224 13:68131396-68131418 AGGAGCAGGAGGAAGAGTGGGGG + Intergenic
1110184334 13:72655894-72655916 GAGAACAGAAGGAAGAATGTAGG + Intergenic
1110186784 13:72684139-72684161 ATAAAAAGGAGGAAGATTGCTGG + Intergenic
1110297453 13:73884968-73884990 AAGAAGATTATGAAGACTGCCGG - Intronic
1111119211 13:83823849-83823871 AAGCACAGGAGGAGGGCTGAGGG + Intergenic
1111661090 13:91212661-91212683 AAGAAGAGGAGGGATACTGAAGG - Intergenic
1111956126 13:94760514-94760536 AAGAAGAAGAAGAAGACTTCTGG - Intergenic
1111962415 13:94825916-94825938 AAGAATAAGAGGGAGAGTGCTGG + Intergenic
1111982478 13:95031423-95031445 GAGAACAGAAGGTAGATTGCTGG - Intronic
1112257977 13:97852259-97852281 AAGAGCAGGACCAAGACAGCGGG + Intergenic
1112379657 13:98876776-98876798 AAGAACAGCAGGGTGTCTGCAGG + Intronic
1112384139 13:98922166-98922188 AATAACGGGAGGTTGACTGCTGG - Intronic
1112610806 13:100952931-100952953 GAGGGCAGCAGGAAGACTGCTGG - Intergenic
1113010946 13:105765047-105765069 AAGAAAAGGAGGAGGAAGGCAGG - Intergenic
1113110815 13:106821775-106821797 AAGAGCTTGAGGAAAACTGCAGG - Intergenic
1113627394 13:111856999-111857021 AGGAAGAGGAGAGAGACTGCAGG - Intergenic
1113970644 13:114185784-114185806 AAGCACAGGAGGGAGGCTGAGGG + Intergenic
1114195240 14:20470746-20470768 AAGGACAGGAAGAAGACCACAGG + Intronic
1115218653 14:31037217-31037239 AAGAACAGGAGGAAGATACAGGG - Intronic
1116766296 14:49074599-49074621 AAGAAAAGAAGGAAAACTACAGG + Intergenic
1117243914 14:53864351-53864373 AAGAACAGCAAAAACACTGCTGG + Intergenic
1117305012 14:54465429-54465451 AAGAACTGGAGTAAGATTTCTGG + Intergenic
1117615491 14:57529799-57529821 AAGGACAGGAGGGAACCTGCTGG + Intergenic
1119075475 14:71633873-71633895 AAGAAGAGGAGAAAGATGGCAGG + Intronic
1119871667 14:78023082-78023104 AAGAAAAGGAGGAAGAAAGGGGG + Intergenic
1120543108 14:85776097-85776119 AAGAACACCAGGAATACTGTAGG + Intergenic
1120966914 14:90175598-90175620 AAGAAGAGGAGGAAGATAGAGGG + Intronic
1124112982 15:26809529-26809551 AAGAGCAGCAGTAAGACTGACGG + Intronic
1124216233 15:27808960-27808982 AAGGACAGAAGGAAGACAACAGG - Intronic
1125258973 15:37800483-37800505 AAGCAAAGGAGAAAAACTGCTGG + Intergenic
1125931185 15:43601163-43601185 AAGAAAAAGAGGAAGCCTCCAGG + Intronic
1125944344 15:43700981-43701003 AAGAAAAAGAGGAAGCCTCCAGG + Intergenic
1127383369 15:58448391-58448413 AAGGAAAGGAGGAAGACTGTAGG - Intronic
1127473264 15:59309147-59309169 AAGAAGAGAAGGAAGATTGATGG + Intronic
1127566922 15:60198608-60198630 AAGAGAAGGAGGAAGAATTCAGG - Intergenic
1127939626 15:63681850-63681872 GAGAACAGAAGGAAGCCTACAGG + Intronic
1128756977 15:70189838-70189860 TGGTACAGGAGGAAGACTGCAGG - Intergenic
1128872167 15:71168028-71168050 AGGAACATGAGGACGACTTCTGG - Intronic
1129777974 15:78249459-78249481 AGTAACAGAAGGAAGAGTGCGGG - Intergenic
1129958117 15:79657848-79657870 GAGGACAAAAGGAAGACTGCAGG - Intergenic
1130709112 15:86261971-86261993 CAGAATAAGAGGAAGATTGCAGG - Intronic
1130930833 15:88426399-88426421 AAGAAAAGGAGGAGGAATGATGG + Intergenic
1131066369 15:89437176-89437198 AAGAAGGGGAGGAGGACTGGAGG - Intergenic
1132761318 16:1509842-1509864 AAGACCCGGACGAGGACTGCAGG + Exonic
1133460783 16:5984391-5984413 AAGCAAAGAAGGAAAACTGCAGG + Intergenic
1133530972 16:6654546-6654568 AAGAACAGGAGTCAGACTTATGG - Intronic
1133865252 16:9636269-9636291 AAGACCATGAGGAAGACAGAAGG - Intergenic
1134649626 16:15898293-15898315 CAGAACAGGAGGAAGTTTCCAGG - Intergenic
1135468918 16:22712095-22712117 AGGTGCAGGAGGAAGGCTGCAGG + Intergenic
1135938918 16:26804007-26804029 AAGAGGAGGAGGAAGAGTACAGG - Intergenic
1137421814 16:48341414-48341436 CAGAGCAGGAGCAAGAGTGCAGG + Intronic
1137699464 16:50486419-50486441 AAGAACAGGAGGAGGAGGGGAGG - Intergenic
1137821735 16:51452643-51452665 AAGGACAGGTGGAAGGCAGCTGG - Intergenic
1138045856 16:53724078-53724100 AAGATCAGGATGACAACTGCTGG - Intronic
1138085404 16:54129189-54129211 TAGGACAGAAAGAAGACTGCTGG + Intergenic
1138536557 16:57663445-57663467 ATGAAGATGAGGAAGCCTGCGGG - Exonic
1140633298 16:76880960-76880982 AATTATAGGAGGAAGACTGGAGG - Intergenic
1141107620 16:81246501-81246523 AAGAGCAGGTGGAAGAGTACAGG + Intronic
1141627340 16:85268305-85268327 ATTATCAGGAGGAGGACTGCGGG - Intergenic
1141897218 16:86965744-86965766 AAGAAAAGGAGGAAGACTTCAGG + Intergenic
1144060977 17:11583256-11583278 AAGCACAGGAGGAAGACTGAGGG - Intergenic
1144216176 17:13057564-13057586 AGGAGCAGGAGGAAGACTCGGGG + Intergenic
1144434171 17:15224233-15224255 AGGCACTGGAGGAAGACTCCTGG + Intergenic
1144839940 17:18179648-18179670 AAGAATAGATGGAAGACAGCAGG + Exonic
1144940133 17:18933198-18933220 AAGAACATGAAGATGAGTGCTGG + Intergenic
1147256916 17:39186957-39186979 AAGAGCAAGAGGGAAACTGCAGG + Intronic
1147355739 17:39894929-39894951 AACAAAAGGAGGAAGAAGGCAGG - Intergenic
1147506705 17:41025350-41025372 AAGAAAAGGAGGAAGAGTGATGG - Intergenic
1147588965 17:41669043-41669065 AGGGAGAGGAGGAAGACTGCGGG + Intergenic
1148199161 17:45737472-45737494 AAAAACAGGAGGAAGTCTTCAGG - Intergenic
1149380503 17:56088650-56088672 GAGAACAGGAGGAAGATAGGTGG - Intergenic
1149794258 17:59505081-59505103 AAGGACATGAGGAATACTCCAGG - Intergenic
1150422563 17:65051625-65051647 AAAAACAGGAGGTAGAGTGATGG + Intronic
1150743037 17:67795018-67795040 AAGAGAGGGAGGATGACTGCTGG - Intergenic
1150859481 17:68786431-68786453 AAGAACAGGAGGGAGAGAGCGGG - Intergenic
1152782827 17:82233788-82233810 GGGAACAGGACGCAGACTGCGGG - Exonic
1154168565 18:12034589-12034611 AAGAAGAGCAGAAAGACTGCAGG + Intergenic
1155215722 18:23641552-23641574 AAGCACAGGAGGGAGGCTGAGGG + Intronic
1156022191 18:32612469-32612491 AAGAGCAGGAGCAAGAATGTAGG + Intergenic
1156276501 18:35588527-35588549 AAGAAGAGGAGAAAGAGGGCAGG - Intronic
1156675246 18:39520235-39520257 AAGAATAGGCGGTAGCCTGCAGG + Intergenic
1156855093 18:41772699-41772721 AAGATAAGGAGGAGGACTACTGG - Intergenic
1156884537 18:42118979-42119001 AAGCCCAAGAGGAAGATTGCGGG - Intergenic
1157076181 18:44470289-44470311 AAGGACAGGATGAAGAGGGCAGG + Intergenic
1157095449 18:44682063-44682085 AAAAACAGGATGAAGAGTGAAGG - Intronic
1158118028 18:54018383-54018405 AAGAACAGGCAGAAAACTACTGG + Intergenic
1158372897 18:56829770-56829792 AGGCACAGGAGGAAGAAGGCAGG + Intronic
1158845024 18:61432737-61432759 AAGAACAGGAGGAAGGCGAGAGG - Intronic
1159619672 18:70622776-70622798 AAGATCACAAGGAAGCCTGCAGG + Intergenic
1160074437 18:75658783-75658805 AGGAGCAGGAGGAAGACTTCAGG + Intergenic
1160110797 18:76028074-76028096 AGGAGCAGGAGGGAGACTGTGGG + Intergenic
1160441651 18:78897964-78897986 AAGCTTAGAAGGAAGACTGCTGG - Intergenic
1160584887 18:79907768-79907790 CACAACTGGAGGAACACTGCTGG + Intronic
1161060145 19:2210705-2210727 AAGAAGGGGAGGAAGATGGCTGG + Exonic
1161548015 19:4894079-4894101 AAGAAGAAGAAGAAGACAGCCGG + Intronic
1162660739 19:12167036-12167058 AAGATGAGGAGGAAGAAGGCAGG + Intronic
1163221531 19:15924964-15924986 AGGACCAGGAGGATGATTGCAGG - Intronic
1163757022 19:19112280-19112302 AAGAACAGGAGGAGGACAGAAGG - Exonic
1164147481 19:22520852-22520874 AGGAACAGAAGGAAGATTGCTGG - Intronic
1164159123 19:22615263-22615285 AGGAACAGAAGGAAGACTGCTGG + Intergenic
1165453043 19:35896275-35896297 AGGAAGAGAAGGCAGACTGCTGG + Intronic
1166060038 19:40320430-40320452 AGGAACAGGAAGAAGGCTGGTGG - Exonic
1166211075 19:41306807-41306829 AAGAACAGGAGGTGGAAGGCTGG - Exonic
1166345586 19:42163286-42163308 AAGAACAGGAGGGAGTGTGTGGG + Intronic
1167314176 19:48754306-48754328 CAGCACAGCAGGATGACTGCGGG + Intronic
1167392038 19:49201895-49201917 AAGAAAGACAGGAAGACTGCCGG - Intronic
1168172571 19:54598345-54598367 ATGTACAGGAGGAAGACTTGAGG - Intronic
1168236892 19:55069196-55069218 AGGAGGAGGAGGGAGACTGCCGG - Intronic
1168294293 19:55371085-55371107 GAGAGCGGGAGGAAGACAGCAGG + Intergenic
924963002 2:50863-50885 AAGTACAGGAGGAAGGCTGGAGG + Intergenic
925099324 2:1231977-1231999 AAGAACAGGAAGCAGCCTTCAGG - Intronic
925303843 2:2835577-2835599 AGGAAGAGGAGGAAGACCGAAGG - Intergenic
925822731 2:7816238-7816260 AAGAGCAGGAGGAAGTGTGATGG + Intergenic
926875786 2:17477214-17477236 AAGAACAAGAGGAATAAAGCAGG + Intergenic
926957038 2:18312866-18312888 AAGATGAGGAGGAATACTTCTGG - Intronic
927550966 2:23998903-23998925 AAGAACTGGGGAAAGATTGCTGG - Intronic
927810302 2:26176612-26176634 CAGAACAGAATGAAAACTGCTGG - Intronic
928151341 2:28832621-28832643 ATGAATATGTGGAAGACTGCAGG - Intronic
928179755 2:29060403-29060425 AAAAAGAGGAGGAAGAGAGCAGG - Exonic
928318232 2:30262657-30262679 AAGAAAAGGAGGCAGACAGAAGG - Intronic
928371876 2:30745826-30745848 AAGAAAAGGAGAAGGAATGCAGG - Intronic
928408042 2:31030154-31030176 AAGCACAAGAGGAAAACTGTGGG + Intronic
928918783 2:36503556-36503578 AAGAACTGGAGGCAGGCTGATGG - Intronic
929432104 2:41895899-41895921 TAGATCAGGAGGATGAATGCAGG - Intergenic
929462578 2:42114176-42114198 AAGAAGAAGAAGAAGATTGCTGG + Intergenic
930911846 2:56638320-56638342 GAGACCAGGAGGAAGAAGGCTGG + Intergenic
932135267 2:69223350-69223372 GACAATGGGAGGAAGACTGCAGG - Intronic
932269182 2:70394295-70394317 AAGAAGAGGAGGAAGCCAGAGGG - Intergenic
932355076 2:71061688-71061710 GAGAACTGGAGGAATACTGCTGG + Intergenic
932644689 2:73488242-73488264 AAGCACAGGAGGGAGGTTGCAGG - Intronic
932796122 2:74697861-74697883 AAGAGAAGGGGGAAGACTGGGGG - Intergenic
933057235 2:77685774-77685796 AAGTGAAAGAGGAAGACTGCAGG + Intergenic
933373364 2:81446290-81446312 AAGAGCAGGAGAAAGAATGAAGG - Intergenic
933927374 2:87106974-87106996 AAGTGAAAGAGGAAGACTGCAGG + Intergenic
935103829 2:100021053-100021075 AGGATCAGGAGGAAGAGGGCAGG - Intronic
936718506 2:115219473-115219495 AAGAACAGTAGTAAGAGTGGAGG - Intronic
936720530 2:115247162-115247184 AAGAACAGGATAAAGAATGGAGG + Intronic
937216555 2:120316941-120316963 AAGAACAGGGAGAAGACAGCTGG - Intergenic
937291145 2:120782882-120782904 TAGAACAGGAGGTTGACTGCAGG + Intronic
937795101 2:126008038-126008060 AGGAACATGAGGAAGAGTGATGG - Intergenic
937926685 2:127173273-127173295 GAGAACATGAGGAAGCCAGCTGG - Intergenic
937938275 2:127264004-127264026 AAGAACTGGAACAAGACAGCCGG - Intronic
938142307 2:128805535-128805557 AAGACCAGGTGGAAGCCTCCAGG - Intergenic
939449125 2:142349602-142349624 ATGAACTGGTGGAAGACTGCAGG - Intergenic
939561471 2:143737458-143737480 TAGAACATGAGGATGAATGCTGG + Intronic
939676271 2:145076251-145076273 CAGCACAGCAGGGAGACTGCAGG + Intergenic
940305188 2:152217858-152217880 AAGAAGAGGAGAGAGACTGAGGG + Intergenic
941247746 2:163121886-163121908 AAAAACAGGCAGAAAACTGCAGG - Intergenic
942347007 2:175013987-175014009 AAGACCAGGAGGAAGATTCTTGG - Intergenic
942783675 2:179675631-179675653 AAGAGCAGGAGGAAAAGGGCAGG + Intronic
942865112 2:180664005-180664027 AAGAACAGGAGGAAACGTTCTGG - Intergenic
943177571 2:184496685-184496707 AAGAAAAGAAGGAAAATTGCAGG + Intergenic
943913532 2:193598621-193598643 AAGAAGAAGAAGAAAACTGCAGG + Intergenic
943960175 2:194254257-194254279 AAGCACAGGAGAAAGTCTGAGGG + Intergenic
944190160 2:196994484-196994506 AAGAAGAAGAAGAAGACTGTTGG - Intronic
944639780 2:201713108-201713130 AAGAAAAGGAGAAAGAATGAGGG - Intronic
945122240 2:206468929-206468951 CAGAACAGGAGGAAGAGAGATGG + Intronic
946394804 2:219437883-219437905 AACAACAGCAGGAGGACTTCAGG + Intronic
948417564 2:237824649-237824671 TAGAGCAAGAGGAAGAATGCGGG - Intronic
948715597 2:239859200-239859222 GAGAACTGCAGGAAGACTTCTGG + Intergenic
1169777669 20:9273907-9273929 AAGAACAGGAGGAAGACTGCTGG + Intronic
1171094201 20:22315889-22315911 ACGAACAGCAGGGAGACTGAGGG + Intergenic
1171177451 20:23063168-23063190 ATGGAAAGGAGGAAGACTGAAGG + Intergenic
1172947314 20:38699619-38699641 AAGAAGAAGAAGAAGACTTCAGG + Intergenic
1173288820 20:41696484-41696506 AAGAACAGAAGGAATATTGAGGG - Intergenic
1173600550 20:44292066-44292088 AAGAAGATCAGGTAGACTGCTGG + Intergenic
1174296607 20:49549849-49549871 AAGAGCAAGAGGGAGACTGAAGG + Intronic
1174352899 20:49981226-49981248 AGGAACAGAAGGAAGGCTGGGGG + Intergenic
1174496522 20:50948104-50948126 AGGTACAGGTGGAAGACTGCAGG + Intronic
1175306003 20:57975916-57975938 AAGGAAAGGAGGAAGCCAGCTGG + Intergenic
1175494222 20:59403053-59403075 AAGAGCAGGAGGGAGAGCGCCGG - Intergenic
1175534840 20:59702320-59702342 AAGAACAGGAAGGAGGCTGGAGG - Intronic
1175886703 20:62296009-62296031 AAGAACGGTAGGAAGGCTGATGG + Exonic
1176905029 21:14490329-14490351 AAAAACAGGAGGATGATTGATGG - Intronic
1177076847 21:16586671-16586693 TAGAACAGGAAGAAGTCAGCAGG + Intergenic
1178229616 21:30766569-30766591 ATGAATGGGAGGTAGACTGCTGG - Intergenic
1178357898 21:31923710-31923732 AAGAACAGAAGGAAGGATGGAGG - Intronic
1178958570 21:37044241-37044263 AGGAACAGGAGAAAGACAGGAGG - Intergenic
1179128338 21:38612054-38612076 ATAAATAGGAGGAAGAATGCGGG + Intronic
1179159136 21:38877420-38877442 AGGAACATCAGGAAGTCTGCTGG - Intergenic
1180027453 21:45175903-45175925 AAGAAAAGGAGGAAAACACCAGG + Exonic
1180413269 22:12636379-12636401 AAGAGCAGGAGGAAGAGAGAGGG + Intergenic
1180954375 22:19735094-19735116 GAGAACATGGGGAGGACTGCAGG - Intergenic
1181681193 22:24496851-24496873 GAGGACAGCAGGAAGTCTGCTGG + Intronic
1182015495 22:27036048-27036070 AAGAAGAAGAAGAAGAATGCAGG - Intergenic
1182476740 22:30580672-30580694 CAGCGCAGGAGGAAGACCGCAGG - Exonic
1183092926 22:35535763-35535785 AAGGAGGGGAGGAAGAATGCCGG + Intergenic
1183288501 22:36982916-36982938 AAGAACAAGAGGAAAAAGGCTGG - Intergenic
1183353540 22:37346459-37346481 AATAAGAGGAGGAAGACAGGAGG - Intergenic
1184116298 22:42424606-42424628 AAGAGCAGGAGGCAGACAGTTGG + Intronic
1184402973 22:44284639-44284661 AAGGACAGGAGCCAGACTGAGGG - Intronic
1184489204 22:44799503-44799525 AAGAACTGAAGGAAGGCTGCTGG + Intronic
1184821224 22:46910515-46910537 AGGCACAGGAGGTAGACTTCAGG - Intronic
950019433 3:9776687-9776709 AAGAGCAATAAGAAGACTGCAGG - Intronic
950548573 3:13653341-13653363 AAGAAAATGGGGAACACTGCAGG - Intergenic
950584523 3:13882791-13882813 AAGAGGAGGAGGAACAATGCAGG - Intergenic
950584563 3:13883047-13883069 AAGAAGAGGAGGAACACAGCAGG + Intergenic
950737819 3:15024893-15024915 CAGATGAGGAGGAAGCCTGCAGG - Intronic
952544877 3:34408153-34408175 AGGAAGAGGAGGAAGGCTGGTGG + Intergenic
953243804 3:41172766-41172788 GAGAAAAGGAGGAAGAAGGCAGG - Intergenic
953492092 3:43361228-43361250 CACAACAGAAGGAAGAATGCAGG - Intronic
953867437 3:46596361-46596383 GAGAAGAGGAGGAGGCCTGCAGG - Intronic
954048028 3:47949755-47949777 AAGCACTGGAGGAATACTACAGG + Intronic
954273234 3:49525524-49525546 CGGAACAGGAGGAAGGCTGGGGG + Intronic
954574579 3:51668780-51668802 AGGAACAGAAGGAAGACTGATGG + Intronic
954911111 3:54110769-54110791 CAGAAAAGGAGGAAGTCTGTGGG - Intergenic
955075155 3:55606812-55606834 AAGAGGAGGAGGGAGACAGCGGG - Intronic
957684924 3:83490505-83490527 AAGAACAGGAGGAAGAGAACTGG - Intergenic
957773897 3:84730362-84730384 TAGAACAGTAGGAAGACAGACGG - Intergenic
958971158 3:100611456-100611478 AACAACATGAGAAAGAGTGCAGG + Intronic
959087526 3:101867526-101867548 AAGAAAAGCAGGAAGATTGGAGG - Intergenic
959357101 3:105345478-105345500 AAGAACAGGAGCAAGAGAGAAGG + Intergenic
959404335 3:105941800-105941822 AAGAAGAGGAGAAATAATGCTGG - Intergenic
959426889 3:106201403-106201425 TGGAACAGGAGGAAGACAGTGGG - Intergenic
959525390 3:107371160-107371182 AAGAACTGGAGGAAGATGACAGG + Intergenic
960130382 3:114049603-114049625 GAGAAGAGGAGAAAGACTGAAGG + Intronic
960338418 3:116445852-116445874 AAGAACAGGAGAAAGAGTCCAGG + Intronic
960553303 3:119001012-119001034 AAGAACAGCAAAAACACTGCTGG - Intronic
961317816 3:126052483-126052505 GAGAGCAGGAGGAAGGCTGCTGG - Intronic
961396451 3:126595384-126595406 AAGAAGAGGAGAAAGGGTGCAGG + Intronic
961485052 3:127210441-127210463 AAGAACAGCAGGGACACTGGAGG + Intergenic
961908120 3:130283914-130283936 AAAAGCAGGTGGGAGACTGCTGG + Intergenic
962470605 3:135704756-135704778 AAGAAAGGGAGGAAGAATGGAGG - Intergenic
963428971 3:145171986-145172008 CAGAAGAGAAGGAAGACTGGAGG + Intergenic
963482312 3:145891591-145891613 AGGAACAGGAAGAACAGTGCTGG - Intergenic
963917180 3:150869509-150869531 AAGAAAAGCAGGATGACTGTCGG - Intergenic
964233313 3:154496087-154496109 AAGCAAAGGAGGAGGACTCCAGG - Intergenic
964284312 3:155101087-155101109 AAGAACGGGAGGAAGAGAGTGGG - Intronic
964404265 3:156332020-156332042 ATGAACTGAAGGAAGGCTGCAGG - Intronic
965049278 3:163623616-163623638 TACACCAGAAGGAAGACTGCTGG - Intergenic
965382697 3:168010311-168010333 AAGAAGAGGAGGAAGAAGACGGG - Exonic
965470173 3:169080580-169080602 TAAAACAGGAATAAGACTGCCGG + Intergenic
965870296 3:173256330-173256352 TAGCACAGGAGGAAGAGAGCTGG - Intergenic
966007029 3:175026930-175026952 AGGGACAGAGGGAAGACTGCAGG - Intronic
966237144 3:177714515-177714537 AAGAACAGGATGAAAAATACTGG + Intergenic
966263143 3:178003874-178003896 AAGAACAGGTGGAAGACAACAGG + Intergenic
969249010 4:5955030-5955052 GAGCTCAGGAGGAAGACAGCAGG - Intronic
970828987 4:20313316-20313338 AAGAGCAGGAGGAAGAGAGAGGG + Intronic
971036954 4:22704145-22704167 TAGAACAGAAGGAAAACAGCAGG - Intergenic
972059551 4:34852335-34852357 TAGAAAAAGAGGAAGACGGCCGG - Intergenic
973144396 4:46806177-46806199 AATAAAAGGAAGAAGATTGCAGG - Intronic
973726618 4:53783352-53783374 TGGAACAAGTGGAAGACTGCAGG + Intronic
973777389 4:54255991-54256013 AAGAAGAGGATGAGGCCTGCTGG + Intronic
974661120 4:64890035-64890057 AAAAACAAGAGGAGGAGTGCTGG - Intergenic
975061315 4:70005135-70005157 AGGAACAGTAGGAAGAGTGATGG - Intergenic
975555019 4:75654066-75654088 AAGCCCAGGAGAAAGCCTGCAGG + Exonic
975920744 4:79383341-79383363 AAGAACAGGGTGAACACTTCAGG + Intergenic
976378398 4:84371692-84371714 GAGATCAGGAGTCAGACTGCCGG + Intergenic
976749313 4:88438216-88438238 AAGAAAAGGAGAAAGAATTCAGG + Intronic
977383080 4:96302198-96302220 AAAAACATGAGGAACAGTGCTGG - Intergenic
977421092 4:96800748-96800770 AAGAACAGGAGGAAGAAAGAGGG - Intergenic
977925355 4:102694392-102694414 AAGAACATCAGGAAAACTACTGG - Intronic
979433239 4:120657833-120657855 AAGAAGATGAGGCAGAATGCAGG + Intergenic
979786573 4:124722348-124722370 GAGAGCAAGAGGAAGACTGAGGG - Intergenic
979967777 4:127096407-127096429 AAGAGCAGGAGCAAGGCTGGTGG + Intergenic
980753829 4:137129775-137129797 AAGAAAAGGAGGAAGAAAGAGGG - Intergenic
980977308 4:139623609-139623631 AAAGAGAGGAGGAAGACTGTGGG + Intergenic
981638897 4:146912748-146912770 AAGAACAGATGGGAGACTGGTGG + Intronic
981800588 4:148650819-148650841 AAAAACAGGAGGAAGCCAGGAGG + Intergenic
982678118 4:158399526-158399548 AAGAGCAGGAGGCAGGCTGAAGG - Intronic
982799810 4:159690992-159691014 AATAACAGAAGGAAAACTGAAGG + Intergenic
983037910 4:162890291-162890313 AGGAGCAGGAGGAAGACAGAAGG - Intergenic
983676690 4:170302842-170302864 GAGAACAGGAGGTAGGGTGCTGG + Intergenic
984436280 4:179714017-179714039 CAGAACAAGAGGAAGACAGAGGG - Intergenic
984685435 4:182662513-182662535 AGGAAAAGGAGGAAAACTGGAGG - Intronic
986273408 5:6253470-6253492 AATAACATGATGGAGACTGCTGG - Intergenic
986781760 5:11072892-11072914 AAGAGAAGGAGGCAGACAGCAGG - Intronic
987136755 5:14906936-14906958 CAGAGCAGGAGTAAGACAGCGGG - Intergenic
987236964 5:15952271-15952293 AAGAAAAGGAGGAAGATTGGAGG + Intergenic
987560979 5:19519678-19519700 AATAAGAGGAGCAAGCCTGCAGG - Intronic
987615071 5:20262944-20262966 AAGAAAAGAAGGAAGAATGGGGG + Intronic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
988645923 5:33095015-33095037 AAAAAGAGGAAGAAAACTGCAGG - Intergenic
989515970 5:42343755-42343777 AAGCATAGGAGGAAAACTTCAGG + Intergenic
989948354 5:50267008-50267030 AAGAATAGGAGGAATACAGAAGG + Intergenic
990310575 5:54534101-54534123 AAGAACAGGAGACAGGCTGAAGG - Intronic
991294628 5:65067341-65067363 AACCACAGGAGGATGGCTGCTGG - Intergenic
992522636 5:77571392-77571414 AAGAACAGGAGGAACATAGGAGG + Intronic
993338635 5:86693292-86693314 AAGATAAGGAGGAATTCTGCTGG + Intergenic
993486294 5:88490949-88490971 AAGAAAATGAGGAAGACTAATGG + Intergenic
993828493 5:92723553-92723575 AAGAGCAGGAGCAAGATGGCAGG + Intergenic
995026928 5:107434463-107434485 AATGAAAGGAGGAAGACTGCAGG - Intronic
995511795 5:112918043-112918065 GATAACAGGAGGCAGACTACTGG - Intronic
995569449 5:113463953-113463975 GAGAACAGCAAGAAGACTGTGGG + Intronic
996313718 5:122137550-122137572 AAGAACTGGAGGAAGATTCTAGG + Intronic
996481897 5:123985074-123985096 AAGAAAAAGAAGAAGACTTCAGG - Intergenic
996591689 5:125155136-125155158 AAGGACTGGAGCAAGACTACTGG + Intergenic
996772678 5:127101547-127101569 AACACCAGGAGGAAGAATTCAGG - Intergenic
997269990 5:132528304-132528326 AAGAACAGCAGGAAGACAGATGG - Intergenic
999114848 5:149153689-149153711 AGGAACAGTAGGAAGACGCCAGG + Intronic
999292705 5:150437215-150437237 AAGAAAAGAAGGAAGAAGGCAGG + Intergenic
1000486323 5:161848684-161848706 AAGAAAAGAAGAAAGACAGCGGG - Intronic
1001504693 5:172268769-172268791 AAGAAGAGGAGGAGGAGTTCTGG + Intronic
1001588389 5:172849005-172849027 CAGAACAGGAGTAAGGCAGCCGG + Intronic
1002160339 5:177311070-177311092 GAGAAGAGGAGGAAGCCAGCGGG + Intronic
1002406007 5:179032064-179032086 AAGAAGAGGAGGAAGGAAGCAGG - Intronic
1002439639 5:179257612-179257634 AAGAACAACAGGACGACCGCAGG + Intronic
1002770073 6:282855-282877 ATGAACAGGAGCAGGACTGTAGG - Intergenic
1003000378 6:2326100-2326122 TAGAACAGGAAGAAGAGAGCTGG - Intergenic
1003750934 6:9055035-9055057 GAGGACAGTAGGAAAACTGCTGG + Intergenic
1004184581 6:13411123-13411145 AAAAACAGAAGGAAGACTCCAGG + Intronic
1004263429 6:14128730-14128752 AAGAACAGAAGGAAGAATCAAGG - Intronic
1005068555 6:21842915-21842937 AAGAACTGGAGGAAGGCTCAGGG + Intergenic
1005454440 6:26005688-26005710 AAGCACTGGAGGAAGACTAGAGG + Intergenic
1005843272 6:29758493-29758515 ATGTACAGGAGGGTGACTGCAGG + Intergenic
1006442496 6:34061034-34061056 AGGAATAGGAGGAAGCCTCCTGG + Intronic
1007028465 6:38603127-38603149 AAGAACAGTAGGAAGGCAGGGGG + Intronic
1007113526 6:39327523-39327545 AAGATTAGGAGAAAAACTGCAGG + Intergenic
1009325058 6:62339023-62339045 AAGAGCAGGGGGAAGAGTGGAGG - Intergenic
1009466955 6:63982751-63982773 AATAACAGGAGGGGGATTGCAGG + Intronic
1009588583 6:65637796-65637818 AAGCACAGGAGGGAGGCTGGCGG + Intronic
1010359771 6:74979182-74979204 AAGGACAGGAGTCACACTGCTGG + Intergenic
1011854964 6:91678615-91678637 AGAAACAGGAGGAAGGCTCCTGG + Intergenic
1013419069 6:109949800-109949822 ATGGGCAGGAGGAGGACTGCAGG + Intergenic
1013478561 6:110531890-110531912 ATTAAAAGGAGGCAGACTGCAGG + Intergenic
1013967967 6:115978394-115978416 AAGAAAAGGACGATGACTCCAGG + Intronic
1015172482 6:130269046-130269068 AAGAAAAGGAGTAAAACTTCGGG - Intronic
1015689509 6:135905948-135905970 AAGAAGAGGAGGAAAATTACAGG - Intronic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1017742493 6:157419144-157419166 AACCTCAGGAGGAAGACAGCAGG - Intronic
1019436229 7:1023586-1023608 GAGAACATGACGAAGACTGTGGG + Intronic
1019843677 7:3475193-3475215 AAGAGCAGGAGGGAGAGTTCAGG - Intronic
1019922105 7:4169512-4169534 AAGAACTGGAGGATAACTGCAGG - Intronic
1020210444 7:6154456-6154478 GAGAGCAGGAGCAAGACTGAGGG + Exonic
1021730046 7:23587056-23587078 CTGAACAGGAGGAAGACTTTGGG - Intergenic
1021740195 7:23679218-23679240 CTGAACAGGAGGAAGACTTTGGG + Intergenic
1022071553 7:26920774-26920796 TTGAACTGGAGGAAGACTCCAGG - Intronic
1022375699 7:29808743-29808765 AAGAACAGGGGAAAGCCAGCTGG + Intronic
1022397740 7:30005740-30005762 AAAAACAGTTGGAAGACTCCGGG - Intergenic
1022712694 7:32866479-32866501 AAGAGCAGGAGGAAGAGAGTCGG + Intergenic
1022742933 7:33140318-33140340 AAGAAGAGGAGGAATCCGGCTGG - Intronic
1023364648 7:39451631-39451653 AGGAAGAAGAGGAAGCCTGCCGG - Exonic
1023387223 7:39671137-39671159 AAGAACAGGTGGAAGGCTACAGG - Intronic
1024194362 7:47044455-47044477 AAGAACAGAAGGCAAACTGTAGG - Intergenic
1026398117 7:69979629-69979651 AAGAGTATGAGGAAGACTACAGG + Intronic
1028380230 7:90191950-90191972 AGGAACTGGATGAAGACTGAAGG - Intronic
1029929509 7:104356205-104356227 AAGAACAGAACGCAGACTCCAGG + Intronic
1030277993 7:107740379-107740401 CAGAAAAGAAGGAAGGCTGCAGG + Intergenic
1030857385 7:114577624-114577646 GAGATCAGGAGGAAGTCTGGTGG - Intronic
1031491859 7:122399470-122399492 AAAAACAGCATGAGGACTGCTGG - Intronic
1032558350 7:132861231-132861253 GAAAACTGGAGGAAGACTGGTGG + Intronic
1033350830 7:140560530-140560552 AAGAACAGGAGGAGTACTTTGGG + Intronic
1033826670 7:145199551-145199573 AAGAGCGGGAGGAAGGGTGCAGG - Intergenic
1034420960 7:150990462-150990484 AAGCATAAGAGGAATACTGCGGG + Intergenic
1035451496 7:158980022-158980044 GAGCTCAGGAGGAAGCCTGCAGG + Intergenic
1035761065 8:2069244-2069266 AAAAACAAGAGAAAGTCTGCGGG - Intronic
1035924409 8:3711541-3711563 GAGAAGAGGAGGAAGACGCCAGG - Intronic
1036754789 8:11464993-11465015 AAGAACAGGAGCAAGTGCGCAGG + Intronic
1037703368 8:21295447-21295469 AAGAGAAGGAGGAAGAGTGGGGG - Intergenic
1038646882 8:29369415-29369437 ACTGACACGAGGAAGACTGCTGG + Intergenic
1040354957 8:46608450-46608472 AGGAACAGGAGGAAACCTCCCGG - Intergenic
1041777584 8:61540409-61540431 ATGAACAGGAGCAAGAGAGCTGG - Intronic
1042573360 8:70191602-70191624 AAGAAAAGGAGGAAGAGAGAGGG + Intronic
1042943348 8:74129895-74129917 AAGAACATGAGAAAGCATGCTGG + Intergenic
1043499544 8:80838818-80838840 AGGAACAGGAGGCAGAGTGGAGG + Intronic
1045242708 8:100416461-100416483 AAGTACAGGAGGCAGGCAGCTGG - Intergenic
1045791208 8:105986963-105986985 AAGAACAGGAGCAATAGGGCAGG - Intergenic
1047203745 8:122787025-122787047 AAGAACAGGAAGCAGACTGTGGG - Intronic
1047297703 8:123585976-123585998 AAGAGAAAGAGAAAGACTGCTGG - Intergenic
1047600938 8:126425398-126425420 AAGAACAGAAAGAAGATTCCAGG + Intergenic
1048761970 8:137805015-137805037 AGGAACAGAAGGAAGAATGGAGG + Intergenic
1049450281 8:142657601-142657623 AAGAGCAGGAGGAAGAAGGGAGG + Exonic
1050036490 9:1441265-1441287 CAGCACAGAAGGAAGAATGCAGG - Intergenic
1050259151 9:3822951-3822973 AAGAACACATGGAAGACTTCTGG - Intergenic
1050523235 9:6523518-6523540 AAGAAGAAAAGGAAGTCTGCAGG - Intergenic
1050957440 9:11682421-11682443 AAGAAAAAAAGGAAGACTGAGGG + Intergenic
1051141839 9:13987079-13987101 CAGCACAGGAGGAAGAACGCAGG + Intergenic
1052502004 9:29304026-29304048 TAGAGCAGGAGGAAGAGTGAAGG + Intergenic
1052865967 9:33464848-33464870 TAGAACAGGGGTCAGACTGCTGG - Intronic
1053234658 9:36442162-36442184 AAGAACAGGAAGTTGACAGCCGG - Intronic
1054910410 9:70450116-70450138 AAGACCAGTAGGAAAACTGGAGG + Intergenic
1055312595 9:74998647-74998669 AGAACCAGGAGGAAGACTGTGGG + Exonic
1055721880 9:79183704-79183726 AAGAACAAGAGCAAAGCTGCAGG + Intergenic
1056672821 9:88645931-88645953 AAGAAAAGGGGGAAGGCTACAGG + Intergenic
1057786337 9:98090435-98090457 AGGCACATGAGGAAGACTTCTGG + Intronic
1058816933 9:108693105-108693127 AAGAACATCAGGAAAACTGACGG + Intergenic
1059167368 9:112091187-112091209 AAGAAAAGAAGGTAGACTTCAGG + Intronic
1060215993 9:121738575-121738597 TGGAACAGGTGGATGACTGCAGG - Intronic
1060452518 9:123756536-123756558 GGGCACAGGAGGATGACTGCTGG - Intronic
1060603384 9:124893208-124893230 AAGGACAGGAGGAAGCTTTCTGG - Intronic
1061058727 9:128239750-128239772 ATGAACAAGAAGAAGACTTCAGG + Exonic
1061144702 9:128790848-128790870 CAGAACAGGAGGAAGAAGCCAGG - Intronic
1061211364 9:129195304-129195326 AAGAAGAGGAGGAAGAATCATGG + Intergenic
1061527744 9:131181274-131181296 GGGAACAAGAGGAAGAATGCTGG + Intronic
1185655866 X:1685107-1685129 AAGAAGAGAAGGCAGACGGCTGG - Intergenic
1185655957 X:1685822-1685844 AAGAAGAGAAGGCAGACGGCTGG + Intergenic
1185701245 X:2232053-2232075 AATAAAAGGAGGAAGACAGAGGG - Intronic
1186070969 X:5820244-5820266 AATAACAGGAGCATGGCTGCTGG - Intergenic
1186200810 X:7153402-7153424 GAGGACAGGAGGAAGACAGGAGG - Intergenic
1186470572 X:9818910-9818932 AAGAAGAGGAGGATGACTGGGGG - Intronic
1187082773 X:16008601-16008623 AAGAACAGGAAGAAGATCCCAGG - Intergenic
1188972743 X:36637533-36637555 TAATACAGGAGGAAGAGTGCTGG + Intergenic
1189207761 X:39256678-39256700 AAGAACATGCTGAACACTGCAGG - Intergenic
1189595732 X:42563629-42563651 AAGAGAAGGAGGAAGACAGCAGG + Intergenic
1191840749 X:65512228-65512250 GAGAACAGCAGGAAGCCTGCTGG + Intergenic
1191852761 X:65597979-65598001 AAGTTAAGGAGGAAGACAGCAGG - Intronic
1192344097 X:70287131-70287153 AAGAAAAGGAGGAACAGAGCAGG + Intronic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1195315816 X:103676777-103676799 AAGAACAAGCAGAAGACTCCTGG - Exonic
1196146290 X:112320978-112321000 AAACACTGGAGGAAGACTGAAGG + Intergenic
1197857402 X:130930771-130930793 AAGCTCAGGAGTATGACTGCTGG - Intergenic
1198420836 X:136469636-136469658 AAGAACAGGAGCCTGCCTGCAGG + Intergenic
1200184927 X:154175978-154176000 AGGAGCTGGAGGAAGGCTGCAGG - Intergenic
1200190580 X:154213116-154213138 AGGAGCTGGAGGAAGGCTGCAGG - Intergenic
1200196331 X:154250918-154250940 AGGAGCTGGAGGAAGGCTGCAGG - Intergenic
1200201986 X:154288036-154288058 AGGAGCTGGAGGAAGGCTGCAGG - Exonic
1201259166 Y:12141036-12141058 AAAAAAAGGTGGAAGACTGGAGG + Intergenic