ID: 1169780341

View in Genome Browser
Species Human (GRCh38)
Location 20:9302509-9302531
Sequence CACAGCCACCAGTTTCAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169780338_1169780341 6 Left 1169780338 20:9302480-9302502 CCACAGATAGCACAAAGAACAGC 0: 1
1: 0
2: 2
3: 13
4: 192
Right 1169780341 20:9302509-9302531 CACAGCCACCAGTTTCAAATTGG 0: 1
1: 0
2: 0
3: 8
4: 151
1169780335_1169780341 25 Left 1169780335 20:9302461-9302483 CCAGGCCCTAGGAAGTTTTCCAC 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1169780341 20:9302509-9302531 CACAGCCACCAGTTTCAAATTGG 0: 1
1: 0
2: 0
3: 8
4: 151
1169780337_1169780341 19 Left 1169780337 20:9302467-9302489 CCTAGGAAGTTTTCCACAGATAG 0: 1
1: 0
2: 0
3: 17
4: 209
Right 1169780341 20:9302509-9302531 CACAGCCACCAGTTTCAAATTGG 0: 1
1: 0
2: 0
3: 8
4: 151
1169780336_1169780341 20 Left 1169780336 20:9302466-9302488 CCCTAGGAAGTTTTCCACAGATA 0: 1
1: 0
2: 0
3: 14
4: 158
Right 1169780341 20:9302509-9302531 CACAGCCACCAGTTTCAAATTGG 0: 1
1: 0
2: 0
3: 8
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169780341 Original CRISPR CACAGCCACCAGTTTCAAAT TGG Intronic
902708097 1:18220429-18220451 CAGAGGCACCTGTTTCTAATGGG - Intronic
903513864 1:23896806-23896828 CACAGCCATCAGTTCCACCTGGG - Intronic
903983512 1:27207177-27207199 CACAGCCAACAGTTTCCCTTGGG + Intergenic
904210491 1:28883990-28884012 CACTCCCACCAGCTTCAGATGGG - Intergenic
906134364 1:43485874-43485896 CCCAGCCCCCATTTTAAAATTGG + Intergenic
907311450 1:53541298-53541320 GACAGCCCACAGTTTTAAATTGG + Intronic
909305009 1:74062824-74062846 CACACCCACCACCTTCAAGTAGG - Intronic
912441925 1:109705758-109705780 CCCAGGCCCCAGTATCAAATGGG + Intronic
915472736 1:156135540-156135562 AACAGCCTCCATTTTCGAATGGG - Intronic
915657177 1:157370845-157370867 CACTGCCACCAGGTGCAACTTGG + Intergenic
915671820 1:157495544-157495566 CACCGCCACCAGGTGCAACTTGG - Intergenic
918230856 1:182530126-182530148 CACAGCCCCCATTTTCAATCTGG - Intronic
920305645 1:205016555-205016577 CACAGCCACCACTTTGCAAGTGG + Exonic
921552114 1:216549918-216549940 CACTGCCAGCAGTTTCTGATGGG + Intronic
923060115 1:230464120-230464142 CAAAGACTCCATTTTCAAATGGG + Intergenic
1066521829 10:36228701-36228723 AACAGCCACCTCTTTCATATTGG - Intergenic
1067008940 10:42691582-42691604 CACAGCCACCAGCTTCAGTGAGG + Intergenic
1068326042 10:55488150-55488172 CCCACCCACCATTTTAAAATTGG + Intronic
1068686889 10:59879776-59879798 CAAAGCCCCAAGTTTCCAATAGG + Intronic
1069503013 10:68971197-68971219 CACAGTCACCACTATCTAATTGG + Intronic
1070617126 10:77977775-77977797 CACAGCCACCCTTTTTAGATGGG - Intronic
1074743062 10:116503386-116503408 CACAGGCATCAGTCTCAAAATGG - Intergenic
1076981231 11:205951-205973 CAAAGTCACCAGGCTCAAATCGG - Exonic
1078240367 11:9525774-9525796 CACAGCCCCCATTTTAAAGTGGG + Intronic
1082680284 11:56159568-56159590 CACAACCACCACTGTCAAATGGG + Exonic
1083569847 11:63753841-63753863 TACTGCCACCAGTTTCTTATAGG - Intronic
1086354013 11:85973667-85973689 CACAGAGACTAGATTCAAATTGG + Intronic
1087680979 11:101218160-101218182 CCCAGGCCCCAGTATCAAATGGG - Intergenic
1090118357 11:123998743-123998765 CACTGCCAACAGCTTCGAATGGG - Intergenic
1090391019 11:126387367-126387389 CACAGTCACCAGTTTGAAAAAGG + Intronic
1093675826 12:21939496-21939518 CCCAGACACCAGGTTCAATTGGG + Intronic
1096817038 12:54208360-54208382 CGCAGCCAACAGATTCAAGTGGG + Intergenic
1098788020 12:74783957-74783979 AGCGGCCACCATTTTCAAATAGG - Intergenic
1101759908 12:107649965-107649987 CAAAGCTCCCAGTTTCAATTAGG - Intronic
1105361369 13:19720346-19720368 CACAAGCAGCAGTTCCAAATTGG + Intronic
1108441458 13:50457325-50457347 CACAGGCACCAGATTCAGAAGGG - Intronic
1108621988 13:52194026-52194048 CACAGCGACCAGCTTGTAATCGG + Intergenic
1110167558 13:72461371-72461393 CACAGATACCAGTTTAAACTAGG - Intergenic
1111645000 13:91021627-91021649 CACAGCAAACAGTTTTAAACAGG - Intergenic
1112346720 13:98596289-98596311 CAGGGTCACCAGTCTCAAATGGG + Intergenic
1112705029 13:102059046-102059068 TACAGCCCCCAGTCTCAATTTGG - Intronic
1114824516 14:26060671-26060693 CAGAGCCACCAGTTGGAAATAGG + Intergenic
1115132629 14:30072407-30072429 CAAAGCAATCAGTTTCAAAATGG + Intronic
1116537393 14:46049602-46049624 GACAGTCAACAGTTTTAAATTGG - Intergenic
1116628818 14:47302364-47302386 GACAGCTACTAGCTTCAAATTGG + Intronic
1118704952 14:68471885-68471907 CACAGCCACCAGTTTCCTGAGGG + Intronic
1119021267 14:71118142-71118164 CTCAGCCACTGCTTTCAAATTGG + Intergenic
1119113213 14:71994985-71995007 CTCAGCCCCCAGTTCCACATAGG - Intronic
1121663992 14:95658184-95658206 CACAGCCCCCACTTTCAGCTGGG + Intergenic
1132149789 15:99451441-99451463 CACAGCCAAGAGGTTCAAACGGG - Intergenic
1133694880 16:8253331-8253353 CAAAGCCTTCAGCTTCAAATGGG + Intergenic
1136712393 16:32250244-32250266 CAGAGCCACCAGTTTCTGGTGGG + Intergenic
1136755522 16:32679185-32679207 CAGAGCCACCAGTTTCTGGTGGG - Intergenic
1136812591 16:33191185-33191207 CAGAGCCACCAGTTTCTGGTGGG + Intergenic
1136819067 16:33301265-33301287 CAGAGCCACCAGTTTCTGGTGGG + Intronic
1136825630 16:33357800-33357822 CAGAGCCACCAGTTTCTGGTGGG + Intergenic
1136830696 16:33456571-33456593 CAGAGCCACCAGTTTCTGGTGGG + Intergenic
1137469148 16:48739151-48739173 CACAGCCATCAGTTCAAAACAGG - Intergenic
1138159864 16:54743468-54743490 CACTGCCTCCATTTTCAGATGGG + Intergenic
1138412832 16:56853354-56853376 CACAGACACCATAATCAAATAGG + Intergenic
1140330858 16:74055545-74055567 CACTGCCAGCAGTTTGAATTGGG - Intergenic
1140875703 16:79150815-79150837 CATTGCCACCATTTACAAATCGG - Intronic
1202991168 16_KI270728v1_random:14155-14177 CAGAGCCACCAGTTTCTGGTGGG + Intergenic
1203057664 16_KI270728v1_random:939524-939546 CAGAGCCACCAGTTTCTGGTGGG - Intergenic
1143212101 17:5195999-5196021 CACAGCCAAGAGTTTACAATTGG - Intergenic
1144119514 17:12137079-12137101 CAGGGCCACCAGTATCAAACAGG - Intronic
1149062341 17:52437682-52437704 CACAGGCACCAGAATCAAATAGG - Intergenic
1150264815 17:63825414-63825436 TAGAGCCATCAGTGTCAAATGGG + Exonic
1150319361 17:64199032-64199054 CAATCCCAGCAGTTTCAAATGGG - Intronic
1156405604 18:36779623-36779645 CACATCCAACAGTTTGAAAAGGG + Intronic
1164127647 19:22333187-22333209 CACAGCCAACAGTTGGAATTGGG - Intergenic
1164171853 19:22732206-22732228 CACAGCCAACAGTTGGAATTGGG + Intergenic
925259145 2:2515062-2515084 CACAGCCACCATTTTCACTGTGG + Intergenic
925862804 2:8196598-8196620 CACTTCCACCATTTTCAAAATGG - Intergenic
930339051 2:50088792-50088814 CTCAGCTACCAGATTCAAATTGG + Intronic
930373568 2:50536044-50536066 CAAAGCCCCCTGTTTTAAATTGG + Intronic
930876436 2:56223410-56223432 CACAGCCACCAGGTTGAATTTGG + Intronic
930918899 2:56726852-56726874 CCCAGCCACCACTCTCAAGTAGG + Intergenic
933264544 2:80168291-80168313 CAAAACCACTAGTTTGAAATAGG + Intronic
935080640 2:99790054-99790076 CACAGGCAGGAGTTTCACATGGG - Intronic
935416184 2:102821735-102821757 CTCAGCCTCCATTTTTAAATAGG - Intronic
944520645 2:200563168-200563190 CACAGCCTCCAGTTTTGAATGGG - Intronic
946129581 2:217595781-217595803 ATCAGCCGCCAGTATCAAATCGG + Intronic
947206197 2:227663376-227663398 CACAATCACCAGCTTCAAGTGGG + Intergenic
947349928 2:229232929-229232951 CACATCCTCCAGTCTCAACTCGG - Intronic
948309905 2:236977300-236977322 CACAGTCAAGAGTTTCAAAAGGG + Intergenic
1169716779 20:8628391-8628413 GAAAGCCACGAGATTCAAATGGG - Exonic
1169780341 20:9302509-9302531 CACAGCCACCAGTTTCAAATTGG + Intronic
1170430998 20:16276645-16276667 CAGAGCCACATGCTTCAAATGGG + Intronic
1172218041 20:33250412-33250434 CAAAACCACCAGTTTTGAATGGG - Intergenic
1173165755 20:40686196-40686218 CAGCGCCAGCAATTTCAAATGGG + Exonic
1173378572 20:42513940-42513962 TATAGCCACCAGTATCAAAATGG - Intronic
1174288577 20:49490299-49490321 CACAGCCACAAGTCTCTGATGGG + Intergenic
1182305495 22:29365095-29365117 CACAGCCTCCATTTGCAAAACGG - Intronic
1184666606 22:45992611-45992633 CACAGCCATCGGCTTCAAACCGG + Intergenic
949869282 3:8574100-8574122 CACAGCCACCAGTGGCAGCTGGG + Intergenic
952835287 3:37596935-37596957 CAAAGACACCAGTTCCAACTAGG + Intronic
955623875 3:60895778-60895800 CACAGGAACCAGCTTGAAATGGG - Intronic
956011100 3:64832419-64832441 CCCATCCCCCAGTCTCAAATGGG + Intergenic
959404500 3:105943551-105943573 CAAATCCACCATTTTCTAATTGG + Intergenic
961169737 3:124788570-124788592 CAGAGCCACCTGTTCCAAAATGG + Intronic
961379811 3:126489597-126489619 CACAGCCACCCTGTTCAGATAGG + Intronic
964262404 3:154854183-154854205 CAAAGCCAAAAGTGTCAAATGGG - Intergenic
967129836 3:186460241-186460263 CACCACCACCAGTTTCCATTTGG + Intergenic
971259778 4:25045569-25045591 CACAGCCACCACTGGCTAATGGG + Intergenic
971378330 4:26073532-26073554 CTCAGCCACCAGGGTCCAATTGG - Intergenic
974436642 4:61865326-61865348 CACCCCCACAAGCTTCAAATTGG - Intronic
976087975 4:81425678-81425700 CAAGGCCAACAGTTTCCAATTGG - Intergenic
977770640 4:100854108-100854130 CAAAGCAACCAGTTTAAATTTGG - Intronic
978647465 4:110953921-110953943 CACAGCCCCAAGTTTTATATAGG - Intergenic
978879776 4:113687697-113687719 CCCAACCACCAGTTGAAAATGGG + Intronic
980456578 4:133051894-133051916 CACAGCCTCCATCTTCAAGTAGG - Intergenic
982425131 4:155249250-155249272 CACAGCCACCACTCACAATTAGG + Intergenic
982654222 4:158126664-158126686 CTCAGCCACTAGATACAAATTGG + Exonic
983129949 4:164005878-164005900 GACTGCTACCTGTTTCAAATGGG - Intronic
983749461 4:171247651-171247673 CACAGCCACCTGTATGGAATTGG - Intergenic
984705916 4:182847087-182847109 CACCACCACCAGTTTCACAAGGG - Intergenic
985860818 5:2469228-2469250 CACAGGCACCAAATTAAAATCGG + Intergenic
986521023 5:8618443-8618465 CAAAACCTCCAGTTTCAAAATGG - Intergenic
987495657 5:18641058-18641080 AAAAGCCACCGGTTTCAATTAGG + Intergenic
990020462 5:51119944-51119966 CACAGACAGCATATTCAAATTGG + Intergenic
991499419 5:67262005-67262027 CAGAGCCCACACTTTCAAATAGG - Intergenic
991602888 5:68371095-68371117 CACAGCAGCAAGTTTGAAATAGG + Intergenic
992398151 5:76386596-76386618 CACAGCCACCTGATGCCAATGGG - Intergenic
994243363 5:97449778-97449800 CACAGCCAACATTCACAAATAGG + Intergenic
994557418 5:101320878-101320900 CAAACCCACCATTTTCATATTGG + Intergenic
997164652 5:131646969-131646991 AACAGCCTCCAGCTTCTAATAGG + Intronic
999630909 5:153570396-153570418 CTCAGCCACCAACTTCAAAATGG + Intronic
1000435109 5:161198389-161198411 CACAGCCCCCAGGTTAAAAACGG - Intergenic
1006066775 6:31467702-31467724 CACAGCCAACCGTATCACATGGG - Intergenic
1008580383 6:52901695-52901717 AACTGCCAACAGTTTCACATAGG + Intronic
1010992320 6:82493325-82493347 CACAGACATCAGGCTCAAATTGG - Intergenic
1012474664 6:99606063-99606085 CAGAACCAACAGTTTCGAATGGG - Intergenic
1016256483 6:142111581-142111603 TCCACCCACCGGTTTCAAATAGG + Intergenic
1017205128 6:151796773-151796795 GACAACCACCAGTTTTAAAAAGG - Intronic
1020266576 7:6564543-6564565 CCCAGACACCCGTTTAAAATTGG + Intergenic
1020718280 7:11707145-11707167 CAAAGCAACCACTTTCAAGTAGG + Intronic
1022288789 7:28980833-28980855 CACAGCCAGCACTTCCACATAGG + Intergenic
1029253196 7:99251333-99251355 CACAGCAATCAGAATCAAATTGG + Intergenic
1031033956 7:116766851-116766873 CAAAGCCACCAGTTTAATTTTGG + Intronic
1031338171 7:120563850-120563872 CAAAGCCACCAGATTGAATTAGG + Intronic
1034346819 7:150390458-150390480 CACAGCCACCGGTCTCAGATTGG + Intronic
1034431983 7:151045692-151045714 CCCACCCAGCAGCTTCAAATTGG + Intronic
1034831530 7:154312323-154312345 CCCAGCCACCAGGATCAAAGGGG - Intronic
1037702257 8:21285806-21285828 GACAGCTACCAGCTTCAAGTAGG + Intergenic
1045066583 8:98452652-98452674 CCCAGCAACCAGGTTAAAATAGG + Intronic
1045138028 8:99245133-99245155 CACAGTCCTCAGTGTCAAATTGG + Intronic
1045364875 8:101466839-101466861 CACAGCCACCAGCCTCAACCCGG + Intergenic
1047434657 8:124826129-124826151 CAAAGGCACTATTTTCAAATAGG + Intergenic
1049082809 8:140456740-140456762 GACAGTCACCAGTTTAAACTGGG + Intronic
1051744498 9:20282217-20282239 CACTTCCAACAGTATCAAATAGG + Intergenic
1057795962 9:98158407-98158429 CACAGCCACTAGTATCATCTGGG + Intronic
1060059611 9:120447422-120447444 CAGAGCCAGCAGGTTCAAAGAGG + Intronic
1062081767 9:134627901-134627923 CAGACCCACCAGCTTCAAAGCGG + Intergenic
1186011506 X:5139172-5139194 CACAGCAAACAATTTAAAATAGG + Intergenic
1189206734 X:39246360-39246382 CTCAGCCATCAGTTCCAAAAAGG - Intergenic
1195029754 X:100914878-100914900 CACAGCCTTCAATTTCAAAGTGG + Exonic
1195370077 X:104165114-104165136 CACTTCCACAAGTTTTAAATTGG + Intergenic
1198692374 X:139298296-139298318 CAAAGCTTCCAGTCTCAAATTGG - Intergenic
1201475684 Y:14378365-14378387 CCCAGGCCCCAGTATCAAATGGG - Intergenic