ID: 1169780592

View in Genome Browser
Species Human (GRCh38)
Location 20:9306077-9306099
Sequence CCTTATATGGAGACAATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169780592_1169780600 28 Left 1169780592 20:9306077-9306099 CCCTCCATTGTCTCCATATAAGG 0: 1
1: 0
2: 3
3: 8
4: 129
Right 1169780600 20:9306128-9306150 TATCTCTAACTTTTTCACCCAGG 0: 1
1: 0
2: 0
3: 28
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169780592 Original CRISPR CCTTATATGGAGACAATGGA GGG (reversed) Intronic
902779027 1:18692802-18692824 CCATATATTGAGGCCATGGAGGG - Intronic
903968463 1:27103818-27103840 TGTTAAATAGAGACAATGGAAGG - Intronic
904446385 1:30576291-30576313 CCTTATCTAGAGAAAAAGGATGG - Intergenic
905196958 1:36287194-36287216 CCATATGTGGAGCCAGTGGATGG - Exonic
906760291 1:48371040-48371062 CCATATATGGCCACAATTGAGGG - Intronic
906782382 1:48584236-48584258 TCTTGAATGTAGACAATGGAAGG - Intronic
909771154 1:79423391-79423413 CTTTATATGGAAATAATGCACGG + Intergenic
914003295 1:143710760-143710782 GCTTATCAGGAGAGAATGGAAGG - Intergenic
915968392 1:160332659-160332681 ACTTTTATGGAGACAAAGGCAGG + Intronic
919424912 1:197417818-197417840 CTGAAGATGGAGACAATGGAAGG + Intronic
919807954 1:201391890-201391912 CCTGATTTGCAGACAATGCAGGG - Intronic
920822427 1:209393443-209393465 GGTTATTTGCAGACAATGGAGGG + Intergenic
922064911 1:222127147-222127169 CCTCATAAGGTGACATTGGAGGG - Intergenic
922170127 1:223147124-223147146 GTTTATATGGAGACAATGGGGGG + Intergenic
1063771810 10:9212278-9212300 CGGTATGTGGAGTCAATGGATGG - Intergenic
1064968222 10:21036675-21036697 GCTTATATGGAGTAAAAGGAGGG - Intronic
1065607384 10:27432160-27432182 CTTTATATGGAGATTATGTATGG + Intergenic
1068884092 10:62080578-62080600 CCAAATATGGAGCCAATAGAAGG - Intronic
1069158388 10:65056889-65056911 TCTTATCTGGAGATCATGGATGG + Intergenic
1072818799 10:98536032-98536054 TCTTATATGCAGACAAAAGATGG + Intronic
1076032669 10:127172765-127172787 CCTTAAATCAAGACAAAGGATGG - Intronic
1076509216 10:131000127-131000149 CCTCAAAGAGAGACAATGGAAGG - Intergenic
1080569555 11:33543442-33543464 GCTTGTATGGAGAGTATGGAAGG - Exonic
1081279882 11:41196051-41196073 GCTTATTTGGACACAATAGAAGG + Intronic
1081500953 11:43666162-43666184 CCAGATATTGAGAAAATGGAGGG - Intronic
1082773902 11:57231078-57231100 CCTGTCGTGGAGACAATGGAAGG - Intergenic
1084633769 11:70375911-70375933 TCTAATGTGGAGTCAATGGATGG - Intronic
1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG + Intergenic
1089020621 11:115210486-115210508 AATTATTTGGAGACAAGGGAGGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1096770428 12:53932909-53932931 CCTAAAAGGGAGATAATGGAAGG - Intergenic
1097743958 12:63278629-63278651 CCTCATTTGGAGACAGTGAAAGG + Intergenic
1098921386 12:76305347-76305369 CCTTGTAAGTTGACAATGGATGG + Intergenic
1100039373 12:90295306-90295328 CTTTAGAAGCAGACAATGGAAGG - Intergenic
1101290680 12:103364995-103365017 CCTAATATGAAAACAAGGGAAGG + Intronic
1103434605 12:120915151-120915173 GCTTTTGTGGAGAAAATGGAGGG - Intergenic
1104559054 12:129827428-129827450 GCTTATATGAGGACCATGGAAGG - Intronic
1105941765 13:25153951-25153973 TCTTAGATGCAGACAAGGGAAGG + Intergenic
1108385102 13:49892523-49892545 CCTTCTTTGGATAAAATGGATGG + Intergenic
1108590519 13:51908673-51908695 CCTTCTTTGGATAAAATGGATGG - Intergenic
1110285645 13:73747219-73747241 CCTTACATGCACACAATTGAGGG + Intronic
1110414626 13:75238394-75238416 CCTTCTTTGGATAAAATGGATGG - Intergenic
1110851682 13:80253091-80253113 ACTTATATGGAGACAATGTTCGG - Intergenic
1116519244 14:45830372-45830394 CCTTATATCCAGAAAATAGAGGG + Intergenic
1117834430 14:59787629-59787651 CCTCATAGGGAGAAAATGGTGGG + Intronic
1122801975 14:104235603-104235625 CCTTAAGTGGAGACATTGAATGG + Intergenic
1128162672 15:65434568-65434590 GCTTATCTGGAGACAAATGACGG - Intergenic
1135947291 16:26876399-26876421 CCCTAAATGGAGACACAGGAAGG + Intergenic
1137926937 16:52548531-52548553 CGTTAAATGGAGACTAGGGAGGG - Intergenic
1139299824 16:65935498-65935520 CCCTATATGAAGAAAATGGGTGG - Intergenic
1144243699 17:13340808-13340830 CCTCATATGGCGGAAATGGAAGG - Intergenic
1148177560 17:45580680-45580702 CCTTTTATGGAAAAAATGTAAGG - Intergenic
1150747772 17:67829948-67829970 CCTTTTATGGAAAAAATGTAAGG + Intronic
1155081619 18:22415947-22415969 CCTTCTTTGGATAAAATGGATGG - Exonic
1155191162 18:23432116-23432138 TCTTATATGGAGAAAAGGAAAGG + Intronic
1155376293 18:25161407-25161429 CTTTTTATGGACACAATGGAGGG + Intronic
1155597061 18:27500454-27500476 CCTTCTCTGGAGACAAATGATGG + Intergenic
1156576950 18:38328165-38328187 CCTTAGATGGGGAAAAGGGAAGG + Intergenic
1159110764 18:64053988-64054010 ACTTACATGAAGACACTGGAAGG + Intergenic
1164486981 19:28666922-28666944 CCTTATGGGGACAAAATGGAAGG - Intergenic
1166627352 19:44370886-44370908 CCTTAAATGGAGACTATGGAGGG + Intronic
1168417079 19:56175955-56175977 CCTTCTGAGGAGACAATAGAAGG - Intergenic
928700713 2:33895967-33895989 CCTTATAAGAGGATAATGGAAGG + Intergenic
928945104 2:36765078-36765100 CCTTATATGGAAAAAATGTGGGG + Intronic
929349202 2:40928062-40928084 ACATATATGGAAACACTGGAGGG - Intergenic
931612453 2:64116995-64117017 CCTTATATGGACACAATTCAGGG - Intronic
935285109 2:101557517-101557539 CTTATTATGGAGACAATGGGAGG - Intergenic
938076223 2:128340022-128340044 CTTCATATGGAGACACGGGAGGG + Intergenic
938546146 2:132333671-132333693 CCTTAAATGGAGACTATGGAGGG - Intergenic
941615513 2:167714110-167714132 CCTTGTTTGGATAAAATGGATGG - Intergenic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
943980636 2:194545275-194545297 TCTTATATGATGACAAAGGAGGG - Intergenic
946006956 2:216533524-216533546 CCCCATAGGGAGACAATGGAGGG + Intronic
946467316 2:219923486-219923508 ACCTATATAGAGAAAATGGAGGG + Intergenic
948693532 2:239721386-239721408 CTTTATGTGGAGACAAGGAAAGG + Intergenic
1168881823 20:1212719-1212741 CCTTATATGGAAAGAAAGGCAGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170415233 20:16132745-16132767 TCTTATAGGGAGAAAATTGAGGG - Intergenic
1171229839 20:23475490-23475512 CCTTGTTTGGAGATAACGGAGGG + Intergenic
1171875010 20:30566404-30566426 CCTTAAATGGAGACTATGGAGGG - Intergenic
1174170234 20:48613108-48613130 CCTTGTAAGGAGACACGGGAGGG + Intergenic
1175591049 20:60192413-60192435 CCTTATAAGGTCAAAATGGAGGG - Intergenic
1177233679 21:18357478-18357500 GATTATATAGAGACAATGTAAGG - Intronic
1178095644 21:29212306-29212328 GGTTAAATGGAGACTATGGAAGG - Intronic
1178709500 21:34902359-34902381 CCTTAAATGTGGACAATGGTGGG + Intronic
1178780206 21:35595650-35595672 CCTTATATGAAGATAAAGAAAGG + Intronic
1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG + Intergenic
1182066714 22:27436284-27436306 CAGAATCTGGAGACAATGGAAGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
951002052 3:17574253-17574275 CTTAATTTGGAGGCAATGGAAGG - Intronic
952233269 3:31453782-31453804 ACATATGTGGAGCCAATGGATGG - Intergenic
953138621 3:40206114-40206136 GCTGATATGGAGTCCATGGATGG - Intronic
956021199 3:64934952-64934974 CCTTGTCTGGAGGCAAAGGATGG + Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956788990 3:72666113-72666135 CCTTCTATTGACACAATAGAAGG + Intergenic
958531410 3:95336633-95336655 CCCTATAAAGAGACTATGGAAGG + Intergenic
960489836 3:118302599-118302621 GTTAATATGGAGACATTGGAAGG - Intergenic
963943638 3:151120659-151120681 CCACATAAGGAAACAATGGAAGG + Intronic
968312255 3:197693871-197693893 CCTTATATTGTGACACTGGAAGG - Intronic
969901171 4:10351098-10351120 TCTTATATGGAGAAAATTTAAGG - Intergenic
971513398 4:27456029-27456051 CCTTACATGGAGATATTTGAGGG + Intergenic
975384600 4:73741438-73741460 GATTATTTGGAGACTATGGAAGG - Intronic
976660457 4:87535243-87535265 TCTGAAATGGAGAAAATGGAAGG + Intergenic
976978757 4:91197236-91197258 CCTTATATGGGGAGAAAGCAAGG - Intronic
979486492 4:121276546-121276568 CTTCATATGGAGAGAAGGGAGGG - Intergenic
979981239 4:127257948-127257970 TCTTAAATGGAGATAATGGGAGG + Intergenic
981574564 4:146191186-146191208 TCTTTTAAGGAGAAAATGGATGG + Intronic
990718966 5:58671616-58671638 GCTGATATGGAGACATGGGAAGG - Intronic
1001771025 5:174295878-174295900 CCAGAGATGGAGACAAAGGATGG + Intergenic
1003682658 6:8271402-8271424 CCTTGTATGGGAACAATGGCTGG + Intergenic
1003835823 6:10071456-10071478 CCTTATGTGGAGACTTTGTAAGG + Intronic
1005995619 6:30929466-30929488 TTTCATATGGAGATAATGGAGGG + Intergenic
1006421184 6:33935188-33935210 CCTTCTATGGAGGCCATGGTGGG - Intergenic
1006974440 6:38085351-38085373 CCTTGTATGGATAGATTGGATGG - Intronic
1007995373 6:46302236-46302258 CCTGAAATGGAGAAAATGGCAGG + Intronic
1013802298 6:113961628-113961650 CCTTACATGGTGACAATACAAGG + Intronic
1018818504 6:167354557-167354579 CTTTAGAAGCAGACAATGGAAGG - Intronic
1018938127 6:168287361-168287383 CCTTCTTTGGATAAAATGGATGG - Intergenic
1025753240 7:64311582-64311604 CCTCAGATGGTGCCAATGGAAGG + Intronic
1027406159 7:77863497-77863519 CCTTATATGAAATCAATGTAAGG - Intronic
1027856780 7:83521770-83521792 CCTTATATGAAGAGACAGGAGGG - Intronic
1030810335 7:113964096-113964118 CCTTATAGGGAGTCCATGCATGG - Intronic
1030925630 7:115450309-115450331 CTTAACATGGAGGCAATGGAGGG - Intergenic
1033139025 7:138808719-138808741 CCTTAAATGTAGACAATTAAGGG - Intronic
1036031861 8:4982457-4982479 CCTCATTTGGAGACAAAGAACGG + Intronic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1039439459 8:37584629-37584651 GCCTATTTGGAGACAATGGGTGG - Intergenic
1041024026 8:53665963-53665985 CCTTGTCTGGAGACAATGTCTGG + Intergenic
1044790536 8:95842425-95842447 CCATATATGGATACATGGGATGG + Intergenic
1045358695 8:101412432-101412454 CCTGATATGGGGAGACTGGAAGG - Intergenic
1047195243 8:122715137-122715159 CCTTACATGGGAACATTGGAGGG + Intergenic
1051988276 9:23118356-23118378 CTTTATATGAAGACACTTGAGGG + Intergenic
1052022770 9:23543753-23543775 CCTTATTTGGGGACATTGTAAGG + Intergenic
1053069639 9:35093496-35093518 CCACAAATGGAGACCATGGAGGG - Exonic
1186088329 X:6015742-6015764 CATTGTATGGAGACAATATAAGG - Intronic
1187474745 X:19601085-19601107 CCATATATGAAGACTATGGAAGG - Intronic
1189135323 X:38543177-38543199 CCCTCCATGTAGACAATGGATGG + Intronic
1195449888 X:104999230-104999252 CCTTCTATTGTTACAATGGATGG - Intronic
1198746146 X:139892583-139892605 CCTTTTATGGGTACAATGGTTGG - Intronic
1200282640 X:154790933-154790955 ACACTTATGGAGACAATGGAAGG + Intronic
1201245953 Y:12003925-12003947 AATTAAATGGTGACAATGGATGG - Intergenic