ID: 1169780600

View in Genome Browser
Species Human (GRCh38)
Location 20:9306128-9306150
Sequence TATCTCTAACTTTTTCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 367}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169780598_1169780600 -3 Left 1169780598 20:9306108-9306130 CCTTTCCTTTCTATTTTCTATAT 0: 2
1: 0
2: 16
3: 184
4: 2222
Right 1169780600 20:9306128-9306150 TATCTCTAACTTTTTCACCCAGG 0: 1
1: 0
2: 0
3: 28
4: 367
1169780592_1169780600 28 Left 1169780592 20:9306077-9306099 CCCTCCATTGTCTCCATATAAGG 0: 1
1: 0
2: 3
3: 8
4: 129
Right 1169780600 20:9306128-9306150 TATCTCTAACTTTTTCACCCAGG 0: 1
1: 0
2: 0
3: 28
4: 367
1169780599_1169780600 -8 Left 1169780599 20:9306113-9306135 CCTTTCTATTTTCTATATCTCTA 0: 1
1: 1
2: 7
3: 150
4: 1394
Right 1169780600 20:9306128-9306150 TATCTCTAACTTTTTCACCCAGG 0: 1
1: 0
2: 0
3: 28
4: 367
1169780595_1169780600 24 Left 1169780595 20:9306081-9306103 CCATTGTCTCCATATAAGGTTGG No data
Right 1169780600 20:9306128-9306150 TATCTCTAACTTTTTCACCCAGG 0: 1
1: 0
2: 0
3: 28
4: 367
1169780594_1169780600 27 Left 1169780594 20:9306078-9306100 CCTCCATTGTCTCCATATAAGGT 0: 1
1: 0
2: 1
3: 14
4: 126
Right 1169780600 20:9306128-9306150 TATCTCTAACTTTTTCACCCAGG 0: 1
1: 0
2: 0
3: 28
4: 367
1169780597_1169780600 15 Left 1169780597 20:9306090-9306112 CCATATAAGGTTGGTAAACCTTT 0: 1
1: 0
2: 2
3: 4
4: 117
Right 1169780600 20:9306128-9306150 TATCTCTAACTTTTTCACCCAGG 0: 1
1: 0
2: 0
3: 28
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169780600 Original CRISPR TATCTCTAACTTTTTCACCC AGG Intronic
900717665 1:4155730-4155752 AACCTCTCACTTTGTCACCCAGG + Intergenic
900764764 1:4497310-4497332 TTGCTCTAATTTTTGCACCCAGG + Intergenic
901690802 1:10971996-10972018 TATGTCTAACCTGTTCACCATGG + Intronic
902137752 1:14325180-14325202 TCTCTCTCTCTTTTTCACCTCGG + Intergenic
902413500 1:16225788-16225810 TATCTCTAGCCTTGTCACCGTGG - Intergenic
904196937 1:28792756-28792778 AAGGTCTCACTTTTTCACCCAGG - Intergenic
904740682 1:32673461-32673483 GGTCTCTCACTTTTTCACCCAGG + Intronic
905826981 1:41033258-41033280 TGTCTCTCACTGTGTCACCCAGG - Intronic
908521022 1:64942201-64942223 TATGTATATCTTTTTCTCCCTGG - Intronic
908622440 1:65999211-65999233 TATCTCTCAGTTTTTCTCCTTGG + Intronic
909630000 1:77761012-77761034 AATATCTCACTTTGTCACCCAGG - Intergenic
910855154 1:91687479-91687501 TATTTCTAAGTCTTTCACCATGG + Intronic
911437698 1:97883470-97883492 TCTCTCTCACTTTGTCACCCAGG + Intronic
911593507 1:99774354-99774376 TAGCTCTGAGTTTTTCAGCCAGG + Intergenic
913426047 1:118730891-118730913 TCTCTCTCGCTTTGTCACCCAGG + Intergenic
914727881 1:150343214-150343236 TCTCTCTCACTCTGTCACCCAGG - Intronic
914732891 1:150387940-150387962 TGTCTCTCACTCTGTCACCCAGG + Intronic
916305479 1:163325359-163325381 GTTCTCTAACTTTATCACCAAGG - Intronic
917423541 1:174889753-174889775 TGTCTCTTACTCTGTCACCCAGG + Intronic
919019925 1:192092393-192092415 TATCCCTCACTTTTTCACCTGGG - Intergenic
921058218 1:211560769-211560791 GCTTTCTAACTTTATCACCCTGG - Intergenic
921532467 1:216301624-216301646 TATCTCTAAATTTTATAGCCAGG - Intronic
921626899 1:217387280-217387302 TGTGTCTAACTCTGTCACCCAGG + Intergenic
922113032 1:222581068-222581090 TCTCACTCACTTTGTCACCCAGG - Intronic
923338980 1:232992048-232992070 TCTCTCTTGCTTTTTCTCCCTGG - Intronic
924074842 1:240323218-240323240 TCTCTCTCACTCTCTCACCCAGG + Intronic
924135336 1:240960121-240960143 TCTCACTCACTCTTTCACCCAGG - Intronic
924411960 1:243815689-243815711 TATCTCTAAGTTCTTGAGCCTGG - Intronic
924723491 1:246645283-246645305 TTTTTCTTTCTTTTTCACCCTGG - Intronic
924732198 1:246722603-246722625 AATATCTCACTTTGTCACCCAGG + Intergenic
924781675 1:247154805-247154827 TGGGTCTAACTTTGTCACCCAGG - Intronic
1062948842 10:1480670-1480692 TCTCACTCACTCTTTCACCCAGG - Intronic
1063389683 10:5641125-5641147 AATCTCTTACTCTGTCACCCAGG + Intronic
1063642950 10:7849703-7849725 TGTCTCTCACTCTGTCACCCAGG + Intronic
1064604082 10:17020071-17020093 TACCTCTAACTTTTGAACCAAGG - Intronic
1065698829 10:28404876-28404898 AAGCTCTCACTTTGTCACCCAGG - Intergenic
1065744420 10:28826735-28826757 TGTCTCTCCCTCTTTCACCCAGG + Intergenic
1065807487 10:29408470-29408492 TATCTCTCACTCTGTCGCCCAGG + Intergenic
1066987262 10:42478876-42478898 TACATCTGACTTTCTCACCCAGG - Intergenic
1067136948 10:43617949-43617971 TAGCTCTTACTCTGTCACCCAGG + Intergenic
1068227073 10:54119004-54119026 TTTCTGTAACTTTTTCATGCAGG - Intronic
1068456604 10:57262992-57263014 TATCTCCAACTTCCTCACCGTGG + Intergenic
1069175286 10:65282667-65282689 TTTCTCTAAGTTTTTCTCTCTGG - Intergenic
1070096903 10:73346297-73346319 TACCTCTGACATTTTCACTCAGG + Intronic
1070248120 10:74750710-74750732 TCTCTCTCACTTTGTCACCCAGG - Intergenic
1071401990 10:85282203-85282225 TATCTGTGACTTTTTTACTCTGG - Intergenic
1072221290 10:93329737-93329759 TTTCTCCTACTTTTTCATCCCGG + Exonic
1072604555 10:96968907-96968929 GATCTCTTACTTAGTCACCCAGG - Intronic
1072962375 10:99940908-99940930 AGAGTCTAACTTTTTCACCCAGG + Intronic
1073229828 10:101959655-101959677 TATTTCTCACTTTGTCATCCTGG - Intronic
1074656480 10:115594530-115594552 TGTGTCTCACTCTTTCACCCAGG + Intronic
1076108004 10:127839763-127839785 TAGGTCTCACTTTGTCACCCAGG + Intergenic
1077668065 11:4133200-4133222 AATGTCTCACTTTGTCACCCAGG + Intronic
1078206060 11:9230264-9230286 CAAGTCTCACTTTTTCACCCAGG + Intronic
1078261091 11:9709548-9709570 AATCTCTCACTTTGTCACCTAGG + Intronic
1080475000 11:32582286-32582308 TCTCACTCACTTTGTCACCCAGG + Intergenic
1080701115 11:34644928-34644950 TGTCTCTAACTTTTTCTTCAAGG - Intronic
1084762001 11:71279838-71279860 TCTATTTAACTTTTTCCCCCTGG - Intergenic
1084919309 11:72456303-72456325 TTTCTCTAACTCCGTCACCCAGG - Intergenic
1087687026 11:101276496-101276518 AATGTCTCACTTTGTCACCCAGG + Intergenic
1088129032 11:106465095-106465117 CATCCCTAAGTTTTACACCCAGG - Intergenic
1089290056 11:117432142-117432164 TATCACTAACTTTATCTCTCTGG - Intronic
1090245514 11:125213482-125213504 GATCTCTCACTCTGTCACCCAGG + Intronic
1090440208 11:126719010-126719032 TATCTCTAACTTTTTTAAAATGG + Intronic
1090694121 11:129219772-129219794 TGTCTCTACTTTTTTCACTCTGG - Intronic
1091129064 11:133128689-133128711 AATCTGTATCTTTTCCACCCTGG - Intronic
1092844454 12:12571100-12571122 TAGCTCTAGCTCTGTCACCCAGG - Intergenic
1093279059 12:17168457-17168479 AATTTCCAATTTTTTCACCCTGG + Intergenic
1095204297 12:39421981-39422003 AAACTCTCACTTTATCACCCAGG + Intronic
1096350381 12:50893770-50893792 TATTTTTTATTTTTTCACCCAGG - Intergenic
1096871862 12:54597834-54597856 TCCCTCTAACTTGTTCAGCCTGG - Intergenic
1097043107 12:56168114-56168136 GATCTCCAACTTTTTCATCTGGG + Exonic
1097985155 12:65775341-65775363 TCTCTCTCACTTTGTCACTCAGG + Intergenic
1098164672 12:67681921-67681943 TTTCTTCAACTTTTTCTCCCAGG - Intergenic
1100245225 12:92750911-92750933 TAGGTCTGACTTTGTCACCCAGG - Intronic
1100385337 12:94100724-94100746 CAACTCTGCCTTTTTCACCCTGG + Intergenic
1101148199 12:101861584-101861606 TATGTCTAATTTTTTTACACTGG - Intergenic
1102361320 12:112290292-112290314 TAGCTCTCACTTTATCACTCAGG - Intronic
1103653092 12:122448510-122448532 AAGGTCTCACTTTTTCACCCAGG + Intergenic
1104398020 12:128452117-128452139 TCTCTCTCACTCTGTCACCCAGG + Intronic
1104508741 12:129356837-129356859 TTTGTCTCACTCTTTCACCCAGG - Intronic
1104802350 12:131562805-131562827 TCTCTCTCACTCTGTCACCCAGG + Intergenic
1105239097 13:18594601-18594623 TGGGTCTAGCTTTTTCACCCAGG - Intergenic
1105375067 13:19836468-19836490 TGTCTCTTGCTTTATCACCCTGG + Intronic
1105458188 13:20560249-20560271 TTACTCTTCCTTTTTCACCCAGG - Intergenic
1105469782 13:20683104-20683126 TAGCTCCAACATTTTCTCCCTGG - Intronic
1105757598 13:23483345-23483367 TATCTATCACTCTGTCACCCAGG - Intergenic
1106610315 13:31273118-31273140 TCTCTCTCACTCTGTCACCCAGG + Intronic
1107350622 13:39510749-39510771 TTTATATAACTTTTTCACTCAGG - Intronic
1108089836 13:46837451-46837473 TTTTTCTGACTTTTTCTCCCAGG - Intronic
1108554196 13:51577204-51577226 TCTCTCTCACTCTGTCACCCAGG + Intergenic
1109477392 13:62899698-62899720 GATCTCTCACTCTGTCACCCAGG + Intergenic
1109479494 13:62930197-62930219 TTTCTCTAACTTTTTCATATGGG - Intergenic
1111945098 13:94656626-94656648 TATTTCTCACTTTGTCATCCAGG - Intergenic
1112082716 13:95992135-95992157 TAGCTCTAGCTCTGTCACCCAGG - Intronic
1112386335 13:98943376-98943398 TATCTCTGCCTTTTTCTACCAGG - Intronic
1114262760 14:21050380-21050402 TCTCTGTAATGTTTTCACCCTGG - Intronic
1115304984 14:31924314-31924336 CATTTCTACCTTTTTCACTCAGG + Intergenic
1115900493 14:38141739-38141761 TATGACTAACTTTTTCACTTAGG - Intergenic
1116084928 14:40223217-40223239 TATCCCTCACTTTTTGGCCCTGG + Intergenic
1116498729 14:45594297-45594319 TATCTGTAACCTTTTCATCTTGG - Intergenic
1117493777 14:56279869-56279891 TATCTTCAACTCTTTCCCCCTGG - Intronic
1117955929 14:61123718-61123740 TATCTGTGACTTCTTCACCCTGG + Intergenic
1118025682 14:61765912-61765934 TTTCTCTATCTTTTTCGCCTCGG + Intronic
1118207762 14:63739080-63739102 TCTCTCTCACTCTGTCACCCAGG + Intergenic
1119401908 14:74368441-74368463 TCACTCTCACTTTGTCACCCAGG - Intergenic
1120240939 14:81948807-81948829 TTTGTCTCACTTTGTCACCCAGG - Intergenic
1120901099 14:89576121-89576143 TATTTCTAACATTTTCCCCCTGG - Intronic
1121193558 14:92049814-92049836 TGTCTCATTCTTTTTCACCCAGG - Exonic
1121518346 14:94568836-94568858 TCTCACTCACTTTGTCACCCAGG - Intronic
1202868766 14_GL000225v1_random:140101-140123 TATCTCTGACGTGATCACCCAGG + Intergenic
1124420625 15:29518173-29518195 TAGGTCTCACTCTTTCACCCAGG - Intronic
1124788492 15:32704110-32704132 TATTTCTTACTTTATCAACCAGG - Intergenic
1125013786 15:34909662-34909684 TATTTCTATTTTTTTCACCTTGG + Intronic
1125315223 15:38424261-38424283 AGTCTCTCACTTTGTCACCCAGG - Intergenic
1127203762 15:56689878-56689900 TATCTCTAAATTTTTGAAACAGG - Intronic
1128540082 15:68521773-68521795 TCTTTCTCACTTTATCACCCAGG + Intergenic
1128628899 15:69243029-69243051 GATCTCTCACTCTGTCACCCAGG - Intronic
1128716994 15:69916023-69916045 TTTCTCAAACTTTTCCACCAAGG - Intergenic
1128918005 15:71584291-71584313 AATGTCTCACTTTGTCACCCAGG + Intronic
1130339710 15:82988806-82988828 GGTCTCTCACTTTGTCACCCAGG - Intronic
1132910322 16:2306987-2307009 AGTCTCTCACTCTTTCACCCAGG - Intronic
1135733343 16:24912427-24912449 TCTCTCTCACTCTGTCACCCAGG + Intergenic
1136091966 16:27927173-27927195 AAGGTCTCACTTTTTCACCCAGG + Intronic
1136124631 16:28169021-28169043 TATCTCTAACTCCTTTATCCAGG - Intronic
1136911897 16:34150661-34150683 TCTCTCTCGCTCTTTCACCCAGG + Intergenic
1136988071 16:35130507-35130529 TATGTCTCACTTTGTCACCCAGG - Intergenic
1137532124 16:49284374-49284396 TATCTCCTAATTTTTCATCCAGG + Intergenic
1137638873 16:50010869-50010891 TTTCTCTCACTTTGTCACCCAGG - Intergenic
1137982747 16:53083774-53083796 TGTCTCTCACTCTGTCACCCAGG + Intronic
1137988004 16:53126978-53127000 CAGGTCTCACTTTTTCACCCAGG + Intronic
1138613699 16:58147529-58147551 TATTTCTCACTCTGTCACCCAGG - Intergenic
1139907198 16:70374525-70374547 CAGCTCTCACTTTGTCACCCAGG + Intergenic
1140271967 16:73474171-73474193 TCTCTCTCACTCTGTCACCCAGG + Intergenic
1140364483 16:74370616-74370638 TAGCTCTCACTCTGTCACCCAGG + Intergenic
1140448216 16:75049028-75049050 AGTCTCTCACTTTGTCACCCAGG + Intronic
1140512850 16:75520566-75520588 AGTGTCTCACTTTTTCACCCAGG - Intergenic
1141222707 16:82086119-82086141 TATCTCTTACATATACACCCAGG - Intronic
1145324732 17:21795524-21795546 TCTCACTCACTCTTTCACCCAGG + Intergenic
1145359068 17:22196973-22196995 GATCTCTAACTTTTTCACATGGG + Intergenic
1149354079 17:55821885-55821907 TGCCTCTGACTTTCTCACCCTGG + Intronic
1149749147 17:59128649-59128671 CATGTCTAACTTTTTCACTTAGG - Intronic
1149793861 17:59501433-59501455 TTTCTTTAACTTTTCCACCAAGG - Intergenic
1150044160 17:61894820-61894842 TTTATCTCACTTTGTCACCCAGG - Intronic
1150291325 17:63984028-63984050 AATGTCTTACTTTGTCACCCAGG + Intergenic
1150727130 17:67660569-67660591 TCTCACTCACTTTGTCACCCAGG + Intronic
1150743864 17:67800827-67800849 TATGTCTCACTCTGTCACCCAGG + Intergenic
1152150812 17:78599901-78599923 GAAGTCTCACTTTTTCACCCAGG + Intergenic
1152964979 18:106298-106320 TATCTCTGCCCTTATCACCCAGG + Intergenic
1154449699 18:14464035-14464057 TGGGTCTAGCTTTTTCACCCAGG + Intergenic
1155826655 18:30452955-30452977 TATATGTAACGTTTTCACACAGG - Intergenic
1156348055 18:36275908-36275930 TGTTTCTCACTTTGTCACCCAGG + Intergenic
1156865162 18:41880787-41880809 TCTCTCTACCTCTCTCACCCTGG - Intergenic
1156963036 18:43056070-43056092 TATTTCTTACTTTTGCACACAGG - Intronic
1157072792 18:44429027-44429049 AAGGTCTCACTTTTTCACCCTGG - Intergenic
1157620276 18:49013219-49013241 TGTCTCTCTATTTTTCACCCTGG + Intergenic
1157686748 18:49648951-49648973 CATAACTAACTTTTACACCCAGG + Intergenic
1160013150 18:75121929-75121951 TTTCTCTCACTCTGTCACCCAGG + Intergenic
1161785191 19:6320336-6320358 TATATCTCACTCTGTCACCCAGG + Intronic
1164098752 19:22035480-22035502 TATCTTTACCTTTATCACCTTGG - Intergenic
1164191744 19:22924316-22924338 TATCTCTGATTTTCTCACCTAGG + Intergenic
1164233148 19:23308764-23308786 TATCTCTGACATTCTCACCAAGG + Intronic
1165535292 19:36439138-36439160 AATGTCTCACTTTGTCACCCAGG - Intergenic
1166187977 19:41154346-41154368 TATTTCTTGCTTTGTCACCCAGG - Intergenic
1168075540 19:53979143-53979165 TCTCTCCCACTTTTTCTCCCTGG - Intronic
1168385479 19:55959564-55959586 CATCTCTAACTTTATCAGCAGGG + Intronic
927540794 2:23909381-23909403 AATGTCTCACTTTGTCACCCAGG - Intronic
928190126 2:29157349-29157371 TATCTATGGCTTTTTCAACCAGG + Intronic
928820132 2:35351834-35351856 TCTCTCTATCTATCTCACCCAGG - Intergenic
929573099 2:43035152-43035174 GGTCTCTCACTTTGTCACCCAGG - Intergenic
929623296 2:43379922-43379944 TATGTGTAACTTTTTCATTCTGG - Intronic
929683861 2:44017676-44017698 AATATCTCACTTTGTCACCCAGG - Intergenic
929759796 2:44797714-44797736 TATCTCTATCTCTGCCACCCTGG - Intergenic
930319489 2:49836199-49836221 TCTCACTCACTTTGTCACCCAGG - Intergenic
930935218 2:56940979-56941001 TTTTTCTAAATTTTTCTCCCAGG + Intergenic
931674769 2:64683364-64683386 TATCTCTTTCTTTTTCTCCAAGG - Intronic
931795755 2:65708417-65708439 GATCTCTAACCTTTTCATCCTGG + Intergenic
931893595 2:66703562-66703584 TATCACTAACTTTTCAACCGAGG - Intergenic
933044519 2:77518812-77518834 CATCACTAACCTTTTCACCCTGG + Exonic
933625340 2:84591211-84591233 TATTTTTAAATTTTTCCCCCTGG - Intronic
934317024 2:91932071-91932093 TATCCCTAACTAATTCACCAAGG - Intergenic
934473681 2:94578161-94578183 TTCCTGTAACTCTTTCACCCTGG - Intergenic
939785869 2:146511648-146511670 TCTCTCTCTCTTTTTCTCCCGGG - Intergenic
940301366 2:152179238-152179260 TAGCTCTAACATTTTCCCCTTGG - Intergenic
942481668 2:176394710-176394732 TTCCTCTCACTCTTTCACCCTGG + Intergenic
944053410 2:195497196-195497218 TATTTCTTACTGTGTCACCCGGG + Intergenic
945505348 2:210633783-210633805 TATCTTTAGCTTTTTCAGTCAGG - Intronic
946504174 2:220281219-220281241 TCTCTCTCACTCTTTCGCCCAGG - Intergenic
946929252 2:224655930-224655952 GAAGTCTCACTTTTTCACCCAGG + Intergenic
948453737 2:238094485-238094507 TACCTGTAACTTTTCCATCCGGG + Exonic
948637748 2:239350089-239350111 TGTCTCTAACCTTTTCAGGCCGG - Intronic
1169780600 20:9306128-9306150 TATCTCTAACTTTTTCACCCAGG + Intronic
1169929566 20:10817762-10817784 TATGTATACCTTTTTCACCAAGG + Intergenic
1170459198 20:16560757-16560779 AATATCTCACTTTGTCACCCAGG - Intronic
1171014197 20:21524829-21524851 TGTCTCTCAGTTTTCCACCCTGG - Intergenic
1171907219 20:30909001-30909023 TATCTCTCGCTCTTTCACCCAGG + Intergenic
1173046476 20:39517540-39517562 TCTCACTGACTTTGTCACCCAGG + Intergenic
1173605128 20:44326444-44326466 TCTCTCTCACCTTGTCACCCAGG - Intergenic
1174948134 20:55011466-55011488 TAGGTCTCACTCTTTCACCCAGG + Intergenic
1174990919 20:55508640-55508662 AATCTCTCACTTTCTCACCTCGG + Intergenic
1174994869 20:55555107-55555129 TACCTTTAACTTTTTAATCCAGG + Intergenic
1177441525 21:21132888-21132910 TATGTCTAACGGTTTTACCCTGG - Intronic
1178459824 21:32792976-32792998 GATCTCTGACTCTGTCACCCAGG + Exonic
1178677789 21:34645910-34645932 AATCTCTCACTCTGTCACCCAGG + Intergenic
1180340625 22:11614938-11614960 TCTCTCTCGCTCTTTCACCCAGG + Intergenic
1180863553 22:19102027-19102049 TTTGTCTCACTCTTTCACCCAGG - Intronic
1181183408 22:21083358-21083380 TATTTCTCACTCTGTCACCCAGG + Intergenic
1181965673 22:26655111-26655133 TTTCTCTAACTCTTTCACATGGG + Intergenic
1183856745 22:40639722-40639744 TCTCTCTTACTCTGTCACCCAGG - Intergenic
1184281296 22:43438919-43438941 AATCTATAACTTTCTCATCCAGG - Intronic
1184867286 22:47208857-47208879 TATCTCTGAGATTTTCCCCCTGG + Intergenic
949308048 3:2665590-2665612 GATGTCCAATTTTTTCACCCAGG - Intronic
950314034 3:11984844-11984866 TCTCTCTCACTCTGTCACCCAGG + Intergenic
950606475 3:14085846-14085868 GATGTCTCACTTTGTCACCCAGG + Intergenic
951411800 3:22374850-22374872 TATCTCTAACTTTCTGTCCCTGG + Intergenic
952710176 3:36423144-36423166 TCTCTCTTCCTTTTTCACACTGG - Intronic
952938711 3:38423029-38423051 TAGCTCTAACGTTTCCCCCCTGG + Intergenic
953191326 3:40690800-40690822 TCTCTCTCACCATTTCACCCAGG - Intergenic
953399880 3:42603759-42603781 GAAGTCTCACTTTTTCACCCAGG + Intronic
954207348 3:49069827-49069849 TATCTCTAACTTGCTCATCAAGG + Intronic
955031607 3:55227122-55227144 TCTCACTGACTTTGTCACCCAGG - Intergenic
955139479 3:56255168-56255190 TACCTCTAACTTCTTGACACTGG + Intronic
956141296 3:66149271-66149293 AGTGCCTAACTTTTTCACCCTGG + Intronic
956311485 3:67885451-67885473 TATACCTCACTTTATCACCCAGG - Intergenic
956770391 3:72521026-72521048 CACCATTAACTTTTTCACCCTGG + Intergenic
958768686 3:98401302-98401324 TGAGTCTAACTTTTTCAGCCAGG + Intergenic
959889074 3:111533930-111533952 TATCTCTTACTTTCTGACCTGGG - Intronic
960669740 3:120144719-120144741 AATGTCTCACTCTTTCACCCAGG - Intergenic
960826924 3:121796971-121796993 TATCTTTAAATTTTTTACTCAGG - Intronic
961242567 3:125424879-125424901 CATCTCTTACTCTGTCACCCAGG + Intergenic
961881830 3:130067082-130067104 TTTTTCTTTCTTTTTCACCCAGG + Intergenic
962158696 3:132976628-132976650 CATCTCAAACTTCTTCACCCTGG - Intergenic
963554267 3:146768012-146768034 AATTTCTAACTTTTTAACTCTGG + Intergenic
964121254 3:153185941-153185963 TTTCTCTCACTCTGTCACCCAGG + Intergenic
964698955 3:159541851-159541873 TATTTCTGATTTTTTCTCCCTGG - Intronic
966304821 3:178519664-178519686 TAACTCTAACTTTTTCACAGAGG - Intronic
966395766 3:179501322-179501344 AGTCTCTAACTCTGTCACCCAGG + Intergenic
967391671 3:188962159-188962181 CCTCTCTAACTTTTTCCCCCTGG - Intronic
968138444 3:196236331-196236353 TCTGTCTAACTTATTCTCCCTGG - Exonic
968399986 4:285763-285785 AATGTCTCACTTTGTCACCCAGG + Intronic
969374077 4:6751640-6751662 TTTCACTTTCTTTTTCACCCTGG - Intergenic
969676604 4:8617859-8617881 CAGCTCCAACGTTTTCACCCTGG - Intronic
969895556 4:10301199-10301221 TAGCTCCAACATTTTCCCCCAGG - Intergenic
971165470 4:24178066-24178088 TATCTCAAATATTTTCACCAAGG - Intergenic
971231278 4:24801595-24801617 TAGCTGTGACTTTTCCACCCTGG + Intergenic
973056284 4:45663370-45663392 TTTCTCTGAATTTTTCACCCAGG - Intergenic
973940954 4:55910071-55910093 TATTTCTTGCTTTGTCACCCAGG - Intergenic
974911751 4:68131526-68131548 AATCTCTAACTTTTTAAACATGG - Intergenic
975052095 4:69878391-69878413 GATCTCTGACTTTGTTACCCAGG + Intergenic
975089165 4:70380249-70380271 TATCTCTAACTTGTGCAGCATGG - Intronic
975457688 4:74611890-74611912 TATATCTAACTTTCTAACCAAGG - Intergenic
975775673 4:77784521-77784543 TAGGTCTCACTTTATCACCCAGG + Intronic
976645239 4:87380830-87380852 TAGCTCTAGCTTTGTCGCCCAGG - Intronic
976885892 4:89983802-89983824 TAGGTCTCACTTTTTCACCCAGG - Intergenic
976929845 4:90552481-90552503 TATTTTTATCTTTTTTACCCAGG + Intronic
977026787 4:91829793-91829815 TATATCTCACTATTTCACCAAGG - Intergenic
977980252 4:103312865-103312887 TATATATTATTTTTTCACCCAGG - Intergenic
979062751 4:116084962-116084984 TATATATATCTTTTTCACCCTGG + Intergenic
980014791 4:127636584-127636606 TGTGTCTCACTTTGTCACCCAGG - Intronic
980393226 4:132172256-132172278 TCTCTCTCGCTTTGTCACCCAGG - Intergenic
980908883 4:138976099-138976121 GATATCTCACTTTGTCACCCAGG + Intergenic
982373465 4:154659877-154659899 TATCTATAATTTTTTCACTAAGG + Intronic
982951741 4:161705884-161705906 AAGCTCTCACTTTGTCACCCAGG - Intronic
984034362 4:174647379-174647401 GATCTCTCACTCTGTCACCCAGG - Intronic
984060796 4:174987348-174987370 TAGCTCCAACATTTTCCCCCTGG - Intergenic
984223205 4:177003361-177003383 TCTCTCTCACTCTGTCACCCAGG - Intergenic
984511107 4:180679812-180679834 TATCAATGACTTTTCCACCCAGG - Intergenic
984542572 4:181059339-181059361 TTTCTCTCACTTTGTCACCCAGG + Intergenic
984966773 4:185146187-185146209 TTTCCCTAGCTTTTGCACCCAGG - Intronic
985189317 4:187354742-187354764 TATCTCTCACTTTTTCCCTTCGG + Intergenic
986633885 5:9801163-9801185 TCTCTCTCACTTTGTCGCCCAGG - Intergenic
987156132 5:15091420-15091442 TCTCTCTCACTCTGTCACCCTGG + Intergenic
987542676 5:19275861-19275883 TATCTGTGACCTTTTCAACCTGG - Intergenic
987570101 5:19646363-19646385 TCTCTCTCACTCTGTCACCCAGG + Intronic
987574202 5:19704755-19704777 TAGCTCCAACATTTTCCCCCTGG + Intronic
987820555 5:22961216-22961238 TCTCTCTCACTCTGTCACCCAGG + Intergenic
988162394 5:27536750-27536772 TATTTTTGACTTTTTCACGCAGG - Intergenic
988607539 5:32692340-32692362 TAGCTCTTACTATTTCTCCCAGG + Intronic
988613408 5:32750152-32750174 TATTTCTCACTCTGTCACCCAGG + Intronic
991299562 5:65116129-65116151 TATCTCTATCTTTTGCATGCAGG + Intergenic
991423822 5:66469607-66469629 CATCTCTAGTTTTTTCACCCAGG - Intergenic
992929708 5:81630280-81630302 TATCCTTAACTCTTTCAACCTGG - Intronic
992938397 5:81736629-81736651 TATCTCTAAATTTTTCTTCTTGG + Intronic
992953130 5:81880347-81880369 TATCTTTAACTTTTTTGTCCAGG + Intergenic
993813085 5:92507465-92507487 AGTATCTCACTTTTTCACCCAGG - Intergenic
994103420 5:95919037-95919059 TATTTTTAACTTCTTTACCCTGG + Intronic
994773934 5:104020328-104020350 TACCTCTAAATTTTCCAGCCTGG - Intergenic
995404862 5:111783429-111783451 TATGCTTAACTTTATCACCCAGG + Intronic
995653633 5:114400222-114400244 TCTTTCTAACTTTTTCACATGGG + Intronic
995788244 5:115855060-115855082 TATCTCTGTCTCTGTCACCCAGG + Intronic
997308278 5:132856776-132856798 TCTCTCTCACTCTGTCACCCAGG - Intergenic
998715399 5:144878249-144878271 CTTATCTAACTTTTTCCCCCTGG + Intergenic
999158002 5:149472255-149472277 TCTCACTCACTTTGTCACCCAGG + Intergenic
999680369 5:154053422-154053444 TCTCTTTAATTCTTTCACCCAGG - Exonic
999833249 5:155341048-155341070 CACCTCTAACTTTTTCACCATGG + Intergenic
1000114405 5:158139747-158139769 AAGGTCTCACTTTTTCACCCAGG + Intergenic
1000192702 5:158926696-158926718 TCTCTCTGTCTTTGTCACCCAGG - Intronic
1000216625 5:159163721-159163743 TGTCTCTAAATTTTTGAGCCTGG + Intronic
1000707814 5:164533522-164533544 AATGTCTCACTTTTTCGCCCAGG + Intergenic
1001387236 5:171349857-171349879 TTTGTCTCACTTTGTCACCCAGG + Intergenic
1002944423 6:1747393-1747415 TGACTGTTACTTTTTCACCCTGG + Intronic
1003338286 6:5195606-5195628 GGTCTCTCACTTTGTCACCCAGG - Intronic
1003367017 6:5484657-5484679 TATCCTTTTCTTTTTCACCCTGG - Intronic
1006846689 6:37067010-37067032 AATGTCTCACTTTGTCACCCAGG - Intergenic
1007527615 6:42510377-42510399 TATCCCTAAATTTTCCAGCCAGG - Intergenic
1008136937 6:47787869-47787891 AAGGTCTCACTTTTTCACCCAGG - Intronic
1010329923 6:74611073-74611095 TATCTTTAACTTTTATACCCTGG - Intergenic
1011325844 6:86149473-86149495 TACCCCAAACTGTTTCACCCTGG + Intergenic
1011422959 6:87193512-87193534 GGTCTCTCACTTTGTCACCCAGG - Intronic
1011574583 6:88781883-88781905 TCTCTATTACTTTTTCACCCAGG + Intronic
1011692149 6:89879934-89879956 AATCTCTCACTCTGTCACCCAGG - Intergenic
1012039066 6:94181606-94181628 TACTTCTAACTTTTTCACTAAGG + Intergenic
1017075048 6:150610125-150610147 TTTCTCTCACTCTGTCACCCAGG + Intronic
1019696041 7:2446672-2446694 CATTTCTAACATTTTAACCCAGG + Intergenic
1020022632 7:4878203-4878225 CCTCTCTCACTTTTTCACCCAGG - Exonic
1020174503 7:5871492-5871514 TATCTCTCCCTTTTTCATCACGG + Intergenic
1020618324 7:10487960-10487982 AATGTCTCACTTTGTCACCCAGG + Intergenic
1023113801 7:36840686-36840708 TAGATATAACTTTTTCCCCCGGG + Intergenic
1024858398 7:53808852-53808874 TAAATCTAAATATTTCACCCAGG + Intergenic
1026345538 7:69470738-69470760 GAGATCTCACTTTTTCACCCAGG - Intergenic
1026999473 7:74642334-74642356 TCTCTCTCACTCTGTCACCCAGG - Intergenic
1027705712 7:81530872-81530894 TACCTATAATTTTGTCACCCAGG - Intergenic
1028044636 7:86102036-86102058 TGTCTCTATCTTTATGACCCTGG - Intergenic
1029097074 7:98095124-98095146 TTTTTCTAGCTTTGTCACCCAGG + Intergenic
1029102739 7:98147242-98147264 TAAGTCTCACTTTGTCACCCAGG + Intronic
1030179548 7:106690960-106690982 TATCTCAATCTTTGTCACCTTGG - Intergenic
1030989527 7:116283238-116283260 CAGTTCTAACTTTTTCACACTGG - Intergenic
1031064957 7:117094844-117094866 TTTCTCTAAACTTTTCTCCCAGG + Intronic
1031131713 7:117840499-117840521 TGTCTCAAACTCTGTCACCCAGG - Intronic
1032686253 7:134237078-134237100 TGTCTCTTACTCTGTCACCCAGG + Intronic
1032930580 7:136664121-136664143 TCTCTCTCACTCTGTCACCCAGG + Intergenic
1033070261 7:138195668-138195690 TATCTCTCTCTCTTTCACCCTGG + Intergenic
1033383936 7:140852992-140853014 CTTCTCTAACTTTACCACCCTGG + Intronic
1034104351 7:148477648-148477670 TAAGTCTTACTTTGTCACCCAGG + Intergenic
1034124036 7:148655191-148655213 TATTTCTCACTCTATCACCCGGG + Intergenic
1036049742 8:5183329-5183351 TGTCTCTCACTCTGTCACCCAGG + Intergenic
1036512265 8:9411664-9411686 TCTCACTCACTCTTTCACCCAGG + Intergenic
1038855048 8:31321889-31321911 TTGCTCTAATTTTTTCACCAAGG - Intergenic
1038874210 8:31529765-31529787 TCTCACTCACTCTTTCACCCAGG - Intergenic
1038934420 8:32232682-32232704 TATCTTTTACTTTTTATCCCAGG + Intronic
1042705239 8:71659859-71659881 TGTGTCTTACTCTTTCACCCAGG - Intergenic
1042790291 8:72597770-72597792 CATCCCTAACTTTATCAGCCAGG + Intronic
1043154287 8:76758518-76758540 AATGTCTTACTTTGTCACCCAGG + Intronic
1043544405 8:81299135-81299157 TTTCTCTAACTTTCTTTCCCAGG + Intergenic
1044408968 8:91864018-91864040 TATTTCAAATATTTTCACCCAGG + Intergenic
1044415708 8:91937032-91937054 TATCTCTAACTATATTACCATGG - Intergenic
1044489451 8:92794960-92794982 TACCTTTAACTTATGCACCCAGG + Intergenic
1045990309 8:108298829-108298851 TCTCTCTCACTCTGTCACCCAGG + Intronic
1047287901 8:123504052-123504074 TCTCTCTCACTCTGTCACCCAGG - Intronic
1047584037 8:126249622-126249644 TATCTTTAACTTTCTGTCCCAGG - Intergenic
1047867757 8:129046044-129046066 TATTTCTTACTCTGTCACCCAGG - Intergenic
1053026763 9:34735771-34735793 AGTCTCTTACTCTTTCACCCAGG - Intergenic
1053684649 9:40510351-40510373 TTCCTGTAACTCTTTCACCCTGG + Intergenic
1053934615 9:43138629-43138651 TTCCTGTAACTCTTTCACCCTGG + Intergenic
1054279077 9:63114614-63114636 TTCCTGTAACTCTTTCACCCTGG - Intergenic
1054297743 9:63345813-63345835 TTCCTGTAACTCTTTCACCCTGG + Intergenic
1054395759 9:64650324-64650346 TTCCTGTAACTCTTTCACCCTGG + Intergenic
1054430403 9:65155519-65155541 TTCCTGTAACTCTTTCACCCTGG + Intergenic
1054499977 9:65866002-65866024 TTCCTGTAACTCTTTCACCCTGG - Intergenic
1055006936 9:71518410-71518432 TATGTGTAACTTTTTCAGCAGGG + Intergenic
1056362245 9:85870282-85870304 TACCTCTACCTTTTTCCCTCAGG + Intergenic
1056721152 9:89073329-89073351 TAGCTCTAATTTTCTTACCCTGG - Intronic
1058871568 9:109206477-109206499 TATAACTATCTTCTTCACCCTGG - Intronic
1059758284 9:117314104-117314126 TGTCTCTATCTTTTTCAGCAAGG - Intronic
1059872465 9:118593187-118593209 TATATCTTGCTTTTTCTCCCAGG - Intergenic
1060715581 9:125925478-125925500 TTTCTCTCACTCTGTCACCCAGG + Intronic
1061567497 9:131452175-131452197 TCTCTCTCACTTTGTCACCCAGG + Intronic
1061922687 9:133790883-133790905 AATCACAAACATTTTCACCCTGG - Intronic
1062596005 9:137299675-137299697 TATTTATAAATTTTTCACGCTGG + Intergenic
1062660151 9:137626495-137626517 TCTCTCTCACTCTGTCACCCAGG - Intronic
1185873981 X:3687197-3687219 GAGATCTCACTTTTTCACCCAGG + Intronic
1187411627 X:19055757-19055779 TCTCTCTCACTCTGTCACCCAGG + Intronic
1189078658 X:37944838-37944860 TATCTCTCACTTTTGCATCCTGG + Intronic
1190825331 X:54012912-54012934 AGTCTCTCACTTTGTCACCCAGG - Intronic
1192364986 X:70464286-70464308 TTTGTCTCACTTTGTCACCCAGG + Intronic
1192691450 X:73369293-73369315 TCTTTCTAACTTTTTCACGTTGG + Intergenic
1192836805 X:74808376-74808398 TCTCACTCACTTTGTCACCCAGG - Intronic
1193230244 X:79036002-79036024 TATCTCCAACTCTTTAATCCGGG - Intergenic
1194535838 X:95105114-95105136 TAGCTCCAACATTTTCCCCCTGG - Intergenic
1194589910 X:95787492-95787514 AATGTCTTACTTTGTCACCCTGG + Intergenic
1195064563 X:101228876-101228898 GGTCTCTCACTTTGTCACCCAGG - Intronic
1195605906 X:106805106-106805128 GATCTCTCACTCTGTCACCCAGG + Intronic
1196471839 X:116037258-116037280 TAGCTCCAACATTTTCCCCCTGG + Intergenic
1196569311 X:117247271-117247293 TGTCTAAAACTTTTTCTCCCAGG + Intergenic
1196667374 X:118330659-118330681 AATCTCTCACTCTGTCACCCAGG - Intergenic
1197229192 X:123985253-123985275 AAGGTCTCACTTTTTCACCCAGG + Intronic
1197866448 X:131024078-131024100 TTTCTCTAACTTTTTGAGACTGG + Intergenic
1197997139 X:132389701-132389723 TATGTCTTTCTTTTTCTCCCTGG - Intronic
1198036811 X:132809012-132809034 TCTCACTCACTTTGTCACCCAGG + Intronic
1198110275 X:133496791-133496813 TCTCACTCACTTTGTCACCCAGG - Intergenic
1198467561 X:136917160-136917182 TCTTTCTCACTTTGTCACCCAGG + Intergenic
1200233141 X:154455341-154455363 AATGTCTCACTTTGTCACCCAGG - Intergenic
1201125828 Y:10913254-10913276 TATCTCTACCCTGATCACCCAGG - Intergenic
1201374577 Y:13303393-13303415 TGTTTCTAACTCTTTCACCATGG - Intronic
1202624585 Y:56844331-56844353 TATCTCTGACCTGATCACCCAGG + Intergenic
1202624809 Y:56846383-56846405 TATCTCTGACGTGATCACCCAGG + Intergenic