ID: 1169781419

View in Genome Browser
Species Human (GRCh38)
Location 20:9314519-9314541
Sequence GTGGAGAGAATGCCAGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 608
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 563}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169781419 Original CRISPR GTGGAGAGAATGCCAGAGAA GGG Intronic
900780850 1:4616297-4616319 GAAGAGAGAATTCCAGACAATGG + Intergenic
901587778 1:10312575-10312597 GTGGATGGAATGGCAGAGTAGGG - Intronic
902060584 1:13638774-13638796 GTGGAGTGAGTGCGAGAGAGGGG + Intergenic
902381590 1:16055405-16055427 GTGGAGAGACAGCCAGAGGGAGG - Intronic
902675479 1:18005756-18005778 ATGGAGAGAAGGCCAGGGAGAGG + Intergenic
902714900 1:18265885-18265907 CTGGAGAAAATGCCAGTGGAAGG - Intronic
904964885 1:34364116-34364138 AGACAGAGAATGCCAGAGAAAGG + Intergenic
905079902 1:35308993-35309015 GTGGTGTGAATGACAGAAAATGG + Intronic
905392986 1:37650165-37650187 GAGGAGTGTTTGCCAGAGAAGGG + Intergenic
905871286 1:41405977-41405999 GTGGAGAGAACCCCAGAAACAGG + Intergenic
906287289 1:44595585-44595607 CTGGAGAGAATGCCAGGGCTGGG - Intronic
906364277 1:45192488-45192510 GTAGATAGAAAGACAGAGAAAGG + Intronic
906533096 1:46534737-46534759 GGGGAAAAAATGCCAGAAAAGGG + Intergenic
906695405 1:47820023-47820045 GTGGAGAGTATGGCAGAGTGTGG - Intronic
907593871 1:55702007-55702029 GGGGAGGGAATTCCAGACAAGGG + Intergenic
908534419 1:65065731-65065753 GGGGAAAGAAAGCCAGAGACAGG + Intergenic
909404178 1:75268014-75268036 GTGCAGAGAAGGACATAGAAAGG - Intronic
909528142 1:76650268-76650290 CTGGACAGAATACCAGAAAAAGG + Intergenic
910439064 1:87233643-87233665 GTGGAGAGCACTCCAGGGAAAGG - Intergenic
911105034 1:94122975-94122997 GAGGAGGGAATGCCAGAGGAAGG + Intergenic
911580775 1:99630985-99631007 CTGGAGAGAAGCTCAGAGAAGGG - Intergenic
912501957 1:110128688-110128710 GTGGACAGGTTGCCAGAGAAGGG + Intergenic
912577389 1:110685960-110685982 ATGGAGAGAGGGACAGAGAATGG - Intergenic
912680409 1:111725571-111725593 GTGGGGAGAAGGCCACGGAATGG + Exonic
913206663 1:116545266-116545288 ATGGAGAGGAAGCCACAGAAAGG + Intronic
913571019 1:120120150-120120172 GTGGAGAGGAAGGCAGAGATTGG - Intergenic
913960574 1:143335705-143335727 ATGGAAAGAGTGCCAGAGAATGG + Intergenic
913963606 1:143357115-143357137 GTGGAGGGAAGGCTAGAGGAAGG - Intergenic
914054928 1:144161277-144161299 ATGGAAAGAGTGCCAGAGAATGG + Intergenic
914057966 1:144182704-144182726 GTGGAGGGAAGGCTAGAGGAAGG - Intergenic
914121180 1:144783661-144783683 GTGGAGGGAAGGCTAGAGGAAGG + Intergenic
914124218 1:144805084-144805106 ATGGAAAGAGTGCCAGAGAATGG - Intergenic
914291829 1:146281128-146281150 GTGGAGAGGAAGGCAGAGACTGG - Intergenic
914552873 1:148731911-148731933 GTGGAGAGGAAGGCAGAGACTGG - Intergenic
915427269 1:155837096-155837118 GTGGATGGAATGACAGAGTAAGG - Intronic
915898542 1:159829752-159829774 GTGGAGGGAATGTCAGTGGAGGG + Intronic
917062203 1:171053146-171053168 GTGGAGTGCATTCCAGAGATAGG - Intronic
917624158 1:176829265-176829287 AGGGAGAGAATGAGAGAGAATGG + Intronic
917725205 1:177821315-177821337 CTGAAGAGAATGCCTGGGAAGGG + Intergenic
917742432 1:177973966-177973988 GTGGAGAGACTGGAGGAGAAGGG + Intronic
919473962 1:198011651-198011673 GAGGAAGGAATGCAAGAGAAAGG - Intergenic
919691069 1:200528927-200528949 GTGGAGACAATCCCAGAATAAGG - Intergenic
920299796 1:204981754-204981776 CTGGAGAGGCTGCCAGAGAGGGG - Intronic
920369013 1:205465713-205465735 GGGGAGAGAGGGTCAGAGAAAGG - Intergenic
920376767 1:205512926-205512948 ATGGAGAGAAACCCAGAGACAGG + Intronic
920739326 1:208565242-208565264 GTGGAGAGCATTTCAGGGAAAGG + Intergenic
920961050 1:210664473-210664495 GTGCAGAGAGTGCCAGGGCAGGG + Intronic
920988337 1:210911872-210911894 GTGGAGAGATTGCAGGAGAGGGG - Intronic
921214153 1:212923126-212923148 GTGCAGAGAATGGGAGGGAAAGG - Intergenic
921219520 1:212963270-212963292 CTGCAGAGAGGGCCAGAGAAGGG + Intronic
921669131 1:217907090-217907112 GGGGAGAAATTCCCAGAGAAAGG + Intergenic
921937295 1:220806876-220806898 GTGGAGGGAATTACGGAGAAGGG + Intronic
922023314 1:221726272-221726294 GTGGAGAAAATTCCAAACAAGGG + Intronic
922209198 1:223474514-223474536 ATGAAGAGACTGCCAGGGAAGGG + Intergenic
922988134 1:229882633-229882655 GTGGAGAGCATGCCAGAGGAGGG - Intergenic
923035360 1:230281421-230281443 GTGGAGTGCAGGCCAGAGCAGGG + Exonic
923863188 1:237913162-237913184 GTGGGGAAAATGGCAGAGCAAGG - Intergenic
1062947872 10:1474697-1474719 GGGGAGAGAATGCGTGGGAATGG + Intronic
1064128443 10:12685717-12685739 CTGGAGAGATTGAGAGAGAAAGG + Intronic
1064244063 10:13655567-13655589 GGGGATAGAATGCCAGAGCCTGG + Intronic
1064371893 10:14759382-14759404 CAGGAAAGAATGGCAGAGAAGGG - Intronic
1064529462 10:16292815-16292837 GTGGAGAGAGAGACTGAGAAAGG - Intergenic
1064695783 10:17963986-17964008 GTGGAGAGAATTCAAGAGGTGGG - Intronic
1065169102 10:23010161-23010183 CTGGAGAGAAGGGAAGAGAAGGG - Intronic
1065193754 10:23240634-23240656 CTGTAGAGAAGGCAAGAGAATGG + Intergenic
1066198951 10:33127924-33127946 GGGGAGAGAACGCAAGGGAAGGG - Intergenic
1066513817 10:36132737-36132759 GTGGAGATGATTCCAAAGAATGG + Intergenic
1067029003 10:42867961-42867983 ATGGAGAGAGTGCCAGAGAATGG + Intergenic
1067274254 10:44820201-44820223 GTGGAGAGGGTGATAGAGAAGGG - Intergenic
1067382209 10:45785252-45785274 GGGGAGAAAATGACATAGAAAGG - Intronic
1067889904 10:50125800-50125822 GGGGAGAAAATGACATAGAAAGG - Intronic
1068271420 10:54730964-54730986 GTAAAGAGACAGCCAGAGAATGG + Intronic
1068974005 10:62988770-62988792 CTGAAGAGAATGAAAGAGAATGG - Intergenic
1069824150 10:71245103-71245125 GGGGAGAGGAGGTCAGAGAAGGG - Intronic
1071605573 10:86985167-86985189 GGGAAGTGACTGCCAGAGAAAGG - Intergenic
1072124711 10:92435126-92435148 GTAGACATAAAGCCAGAGAATGG + Intergenic
1072555046 10:96508374-96508396 TTGGAGAGAATGGCAGAGTGAGG + Intronic
1072562609 10:96590000-96590022 GGGGAGAAAATGCCGGTGAAAGG + Intergenic
1072582790 10:96754117-96754139 GAAGAGAGAAAGACAGAGAAGGG + Intergenic
1073445588 10:103578478-103578500 CTGCAGAGAAGGCCAGAGAGAGG + Intronic
1073477534 10:103764094-103764116 GAGGAGAGGGTGTCAGAGAAGGG - Intronic
1073491679 10:103856470-103856492 GGGGTGAGAATGCCAGAGCCTGG - Intergenic
1073613570 10:104969627-104969649 CTGATGAGAATGTCAGAGAAAGG + Intronic
1074561727 10:114541087-114541109 GTGAAGACAAAGCCAGAGATTGG + Intronic
1074700501 10:116087925-116087947 GTGCAGAGAAAGCCAGAGCCAGG - Intronic
1076162521 10:128256193-128256215 CTGCAGAGAATGCCAGGGATAGG + Intergenic
1076768758 10:132651555-132651577 GGGGACAGAAGGCCAGAGATGGG - Intronic
1076919732 10:133445409-133445431 GGGAAGAGAGTGCCAGGGAAGGG + Intergenic
1077181361 11:1218661-1218683 GTGGGGAGACAGGCAGAGAAGGG + Intergenic
1078170048 11:8922924-8922946 ATGGAGAGCATGCCCGAGAGGGG - Intronic
1079944972 11:26731154-26731176 GTGGAGACTTTGCCAGAGAGTGG - Intergenic
1080751094 11:35151127-35151149 GAGGAGAGAAACCCAGGGAAAGG + Intronic
1080919052 11:36690285-36690307 GTGGAGCAAAAGCCAGAGGATGG - Intergenic
1081123112 11:39290469-39290491 ATGGAGAGAAAGCGAGAGAGAGG + Intergenic
1081756393 11:45547814-45547836 GAGGAGAGAAAGCAAGAGAGAGG + Intergenic
1081835342 11:46149133-46149155 GTGGAAAGAAAGCGAGATAAAGG + Intergenic
1081835440 11:46149656-46149678 GTGGAAAGAAAGCGAGATAAAGG - Intergenic
1082014815 11:47476989-47477011 TTGGCGAGAATGCCAGTGATGGG - Intronic
1082798452 11:57395757-57395779 GTGTAGGGATTGGCAGAGAAGGG + Intronic
1084488866 11:69467304-69467326 GTGGAGAGAAGGGAAGAGAGAGG + Intergenic
1084842113 11:71862670-71862692 GTGCTGAGAAGGCAAGAGAAAGG + Intergenic
1084956198 11:72692940-72692962 GTGGACAGAATGAGGGAGAAGGG + Intronic
1085044655 11:73345892-73345914 GTGGAGTCTCTGCCAGAGAAGGG + Intronic
1085552150 11:77383900-77383922 GTGGAAAGAATCTCAGAGGAAGG + Intronic
1085944131 11:81245772-81245794 TTGTAGAGAATGCCTCAGAAGGG - Intergenic
1086131747 11:83408695-83408717 GTGGGGAGAGTGGCGGAGAAGGG + Intergenic
1086574983 11:88329555-88329577 GTGGAGAGAATGCTACACAGAGG + Intronic
1087008746 11:93493905-93493927 ATGTAGAGAATGACAGAGAGGGG - Intronic
1087046735 11:93849628-93849650 GTTTAGAGAATGACAGAGCAGGG - Intronic
1088271520 11:108039374-108039396 GTGGGGAGAAAGACACAGAAGGG - Intronic
1089049565 11:115534453-115534475 GGGGAGAGAATTCCAAAGCAGGG - Intergenic
1089533254 11:119145479-119145501 GTTGGGAGAATCCTAGAGAAAGG + Intergenic
1089625576 11:119748814-119748836 GTGGTGAGAAGGACAGAGAAGGG + Intergenic
1089673958 11:120076855-120076877 GTAGAGAGAATGCCGGAGTTGGG + Intergenic
1090467235 11:126945345-126945367 GGTGGGAGAATGCCAGAGACTGG + Intronic
1091255597 11:134182203-134182225 GTGGAGAGAATGCCAGGATTGGG - Intronic
1091617752 12:2062633-2062655 GGGGAAAGAAAGCCAGAGGACGG - Intronic
1091637243 12:2206335-2206357 GTTGGGAGAATGGCAGAGCATGG + Intronic
1092284921 12:7123141-7123163 GTGGAGAGGAGGCCAGAGGCTGG + Intergenic
1094025497 12:25957247-25957269 GTGGAGTGAAAGGCTGAGAAGGG + Intergenic
1094223310 12:28018135-28018157 GTGGAGAGAATGCCTGTTATGGG - Intergenic
1095376013 12:41529890-41529912 GTGGAGAGAAGGAAAGAGAGTGG - Intronic
1095938694 12:47711778-47711800 GTGGAGGGAAGGGCAGAAAAGGG + Intronic
1096468671 12:51863329-51863351 GTGGGGAGGTTGGCAGAGAATGG - Intergenic
1096908878 12:54962390-54962412 AGGGAGAGACTGGCAGAGAAAGG - Intronic
1097486264 12:60205657-60205679 CAGGAGAGAAGGCAAGAGAATGG - Intergenic
1098108118 12:67092325-67092347 GTGGAGATAATAGCAGATAACGG + Intergenic
1099052810 12:77802230-77802252 AAGGAGAGAATGGCAGAAAAAGG - Intergenic
1100313024 12:93414785-93414807 GTGGAGATAAAGCCAGGGAGTGG - Intronic
1100594173 12:96057338-96057360 GTGAAAAGAATGAGAGAGAATGG + Intergenic
1101040751 12:100753093-100753115 GTGGTGGAAGTGCCAGAGAAGGG + Intronic
1101498301 12:105277144-105277166 GTGCAGAGAATTCTAGATAAAGG + Intronic
1102061653 12:109937013-109937035 ATGAAGAGAATGCCTGGGAAAGG + Intronic
1102123950 12:110465270-110465292 GTGGATAGTATTCCAGAGTATGG - Intronic
1102895481 12:116594976-116594998 GTGGAGAGAATGCAACAGGTGGG + Intergenic
1103164967 12:118762631-118762653 GTGCAGAGCATGGCAGAGAGTGG + Intergenic
1103221105 12:119246341-119246363 CTAGATAAAATGCCAGAGAATGG + Intergenic
1104371770 12:128229711-128229733 ATAGAGAGAATGCCAGGGAAAGG + Intergenic
1104908697 12:132229218-132229240 GTGGGGAGAAGACCAGGGAACGG - Intronic
1105595825 13:21837052-21837074 GAGGAGAGAACAACAGAGAAAGG - Intergenic
1106136363 13:26976598-26976620 GTGCAGAGGAGGCCATAGAAGGG + Intergenic
1106371612 13:29139882-29139904 ATGGAGAGAGCGCCAGAGGAAGG - Intronic
1106417532 13:29558393-29558415 GTGGAGAGAATGTGAGTGAGGGG + Intronic
1107333361 13:39326162-39326184 GTGGAGAGGATGTCATAGGATGG + Intergenic
1107528528 13:41258829-41258851 GTGAAGAGAAAACCACAGAATGG + Intronic
1107766771 13:43743899-43743921 GTAGAGAGAGAGCCAGAGAGAGG + Intronic
1107853893 13:44595970-44595992 GTGGACAGTATGGCAGAGGAAGG + Intergenic
1108015748 13:46073909-46073931 GTGGAATCCATGCCAGAGAATGG - Exonic
1109656228 13:65394440-65394462 GTGGAGAGATTCTCAGAGAGTGG + Intergenic
1109969343 13:69745090-69745112 GTGGAGAGATTATCAGACAACGG - Intronic
1110617446 13:77556738-77556760 GTGGACAGAAGGGCAGAGAGAGG + Intronic
1110744817 13:79039767-79039789 GTGGAGAGAAAGAGAGAGAGAGG - Intergenic
1111829886 13:93314644-93314666 CAGCAGAGAATGCAAGAGAATGG + Intronic
1112384588 13:98927122-98927144 GTGGAATAAATGGCAGAGAAGGG + Intronic
1112788157 13:102974364-102974386 GTGGACAGAAGGACAGAGACGGG - Intergenic
1112943693 13:104897790-104897812 ATAGAGAGAATGCAAGAGCAGGG - Intergenic
1112998309 13:105600981-105601003 GCAGAGAGAATGCAAGAGAGAGG + Intergenic
1113069497 13:106406653-106406675 GTTTAGAGGATGCCAGAGACTGG - Intergenic
1114533542 14:23409701-23409723 GTGGGGGGAAGGCCAGAGCAGGG - Intergenic
1114876009 14:26718937-26718959 GTGGAAAGAGTGCTAGAAAATGG - Intergenic
1115046375 14:29000007-29000029 GAAAAGAGAATGCAAGAGAAAGG - Intergenic
1115302688 14:31902191-31902213 GTGGAGAGAATGACTCAGAGTGG - Intergenic
1115437818 14:33396080-33396102 GTGGGGAGGAAGCCTGAGAAAGG + Intronic
1115528438 14:34304079-34304101 GAGGAGAGAATGACATAGGAGGG - Intronic
1116469510 14:45270459-45270481 AGGGAGAGAATGGCAGAGAAAGG + Intergenic
1117066361 14:52016050-52016072 GAGGAGAGGATGCTGGAGAAAGG - Intronic
1117446191 14:55805727-55805749 GTGGAGAGGAGCCCAGAGCACGG - Intergenic
1118307871 14:64670495-64670517 GTGGCGTGAATGCCAGTGACGGG + Intergenic
1118475406 14:66111722-66111744 GGAAAGGGAATGCCAGAGAAGGG + Intergenic
1118567169 14:67154214-67154236 GGGAAGAGAATTCCAGAGAAGGG - Intronic
1118779631 14:68998579-68998601 GTGGAGAGAAGGTATGAGAAAGG + Intergenic
1119115333 14:72015220-72015242 GAGGAGAGAAAGAGAGAGAAAGG + Intronic
1119436967 14:74603863-74603885 GTGCAGAGAATGGCAGAGTCAGG - Intronic
1121072807 14:91040032-91040054 GTGGGGAGAATGTGAGAGAGAGG + Intronic
1121875925 14:97453074-97453096 ATGAAGAGCATACCAGAGAAAGG - Intergenic
1122007765 14:98719276-98719298 GGGGAGAGGAGGCCAGGGAAGGG + Intergenic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1202837362 14_GL000009v2_random:88025-88047 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1202906748 14_GL000194v1_random:78155-78177 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1123874499 15:24609985-24610007 GGGGTTAGAATGACAGAGAAAGG - Intergenic
1125097402 15:35870696-35870718 GTCGGGAGAACCCCAGAGAATGG + Intergenic
1125193808 15:37023655-37023677 GTGCTGAGACTGCCTGAGAAAGG + Intronic
1125395901 15:39247737-39247759 GTGGAATGAATGCCACAGAAAGG - Intergenic
1125492073 15:40155753-40155775 GTGGAGAGAATAGCACAGGAAGG - Intergenic
1125996496 15:44166235-44166257 ATGGAGAGAATGCCACAAAGTGG - Intronic
1126704835 15:51397393-51397415 GGGGAGAGAGGGACAGAGAAGGG - Intronic
1127319577 15:57829802-57829824 TTGGGGAACATGCCAGAGAAGGG - Intergenic
1127832907 15:62766575-62766597 CTGGAGAGGATGCCAGAGAGAGG - Intronic
1128588978 15:68877530-68877552 GTGGAGAGTCTAGCAGAGAAAGG + Intronic
1128766479 15:70254103-70254125 GAGGAGAGAATCCCAGAGTGGGG + Intergenic
1129255320 15:74330945-74330967 GAGGAGAGAAGGGGAGAGAATGG - Intronic
1129875284 15:78971399-78971421 GTGTATAGTATGCTAGAGAATGG + Intronic
1130212275 15:81935679-81935701 GTGGATAATATCCCAGAGAAAGG + Intergenic
1130787724 15:87118665-87118687 CTGGAGAGCAGGCGAGAGAAAGG - Intergenic
1131171090 15:90178774-90178796 GTAGAGAGGTGGCCAGAGAAAGG + Intronic
1131460175 15:92612276-92612298 GTGGAGAGGAGGCCGCAGAAGGG - Intergenic
1132152824 15:99474573-99474595 GTTGAGAGAGAGCCATAGAAGGG - Intergenic
1132912964 16:2325142-2325164 GTGATGAGAAAGCCTGAGAAGGG - Intronic
1134008539 16:10834428-10834450 GTGGAGGGCATGCCAGGCAAGGG - Intergenic
1135122072 16:19774889-19774911 GAAGAGAGAAAGACAGAGAAGGG + Intronic
1135144650 16:19950651-19950673 GTGGGGAGAATGCCTGAGACAGG + Intergenic
1135613086 16:23885635-23885657 CAGAAGAGAATGCCAGAAAAGGG - Intronic
1136334899 16:29605022-29605044 GGGGGGGCAATGCCAGAGAATGG + Intergenic
1136469893 16:30473086-30473108 GTGGAGGCAAAGACAGAGAAGGG + Intronic
1136849641 16:33602974-33602996 GGGGAGAGAATGGGAGAGGAGGG - Intergenic
1137295911 16:47093200-47093222 GTAGAGGGAGTGGCAGAGAAAGG - Intronic
1138029665 16:53550462-53550484 GTGAAAAGAAGGCAAGAGAATGG - Intergenic
1138339249 16:56278098-56278120 GAGGAGAAATAGCCAGAGAAGGG - Intronic
1138344141 16:56309510-56309532 GTGGGGACAAGGACAGAGAAGGG + Intronic
1138408082 16:56814854-56814876 GTGCAGAGAACCCCAGAGATTGG + Intronic
1139289688 16:65846166-65846188 AGAGAGAGAATTCCAGAGAATGG + Intergenic
1139315847 16:66067797-66067819 ATGAAGACAATGCCATAGAAAGG - Intergenic
1139439641 16:66959646-66959668 GTGGAAAGCATGCCAGAGCCAGG + Intergenic
1139660686 16:68418865-68418887 GTGATGAGAAGGCCAGAGCAGGG + Intronic
1139683219 16:68581365-68581387 GTGGAGAGAATGCCTGGCATGGG - Intergenic
1139872478 16:70118591-70118613 GTAGAGAGAATGTCAGCAAAGGG + Intronic
1141254348 16:82386643-82386665 GTGGAGAGAAGGCTAGATTAGGG + Intergenic
1142897958 17:2994447-2994469 GTGAGGAGACAGCCAGAGAAGGG + Intronic
1143282220 17:5763386-5763408 TTGGAGTCAATGCCAGGGAATGG - Intergenic
1144192881 17:12862224-12862246 GGGGAGAGTCTGCCAAAGAATGG + Intronic
1144304804 17:13958885-13958907 GTGGAGGGAGTGACAGAGCACGG + Intergenic
1144350665 17:14392804-14392826 CTGGAGAGAATACGAGAAAAGGG + Intergenic
1145850879 17:28094874-28094896 TTGCAGAGAAAGTCAGAGAAAGG - Intronic
1145876831 17:28325276-28325298 GTTGAGAAAATTTCAGAGAAGGG + Intronic
1146500782 17:33362664-33362686 GTGGAGACAATGCAGGAGTAAGG - Intronic
1146888782 17:36491205-36491227 GAGGAGAGAATACCACAGAGCGG - Intronic
1147502733 17:40981166-40981188 GTGTAAAGAATGTCACAGAATGG + Intronic
1147600057 17:41739781-41739803 CGGGAGAGAATGCCAGGGGAGGG - Intergenic
1147704886 17:42419792-42419814 GGGAAGGAAATGCCAGAGAAGGG + Intronic
1148681875 17:49478842-49478864 GAGGAGAGAAAGGCAGAGACAGG + Intergenic
1149358776 17:55871069-55871091 TTGGAGAGAAAGACAGAGACAGG - Intergenic
1149454568 17:56777441-56777463 GTGGAGAGAACAACAGGGAAGGG - Intergenic
1149651707 17:58280029-58280051 GAGGAGTGAGGGCCAGAGAAGGG + Intronic
1150352541 17:64457161-64457183 GTGCTGAGAAAGCCAGAGAGTGG - Intronic
1150593635 17:66584702-66584724 GTGAAGACATTGGCAGAGAATGG - Intronic
1155756185 18:29499418-29499440 GGGGAGAGAACGTCAGAAAATGG - Intergenic
1156287911 18:35717068-35717090 GTGAAGACAATGGCAGAGATTGG - Intergenic
1157106728 18:44780944-44780966 GGGGAAAGAGTTCCAGAGAAGGG + Intronic
1157215791 18:45782376-45782398 ATGGAGAGAAGGCCAGGCAAAGG + Intergenic
1157333729 18:46722007-46722029 GTCGGGAGAAGGCCATAGAAGGG + Intronic
1157563394 18:48663962-48663984 GTGGAAAGAAGGCCGGAGAGAGG + Intronic
1157678420 18:49584575-49584597 ATGGAGAAAATGCCAGAGGAGGG - Intronic
1158513685 18:58113618-58113640 GTGCAGAGACTGCCAGAAGAGGG + Intronic
1158733047 18:60046877-60046899 GTAAAGAAAATGCCAGAAAAGGG - Intergenic
1159020472 18:63138931-63138953 GTGAAAATAATGCCAGAGAAAGG - Intronic
1159629127 18:70728769-70728791 AAGGAGAGAATGGCAGAGAGTGG - Intergenic
1159757308 18:72381313-72381335 GAGGAAAGCGTGCCAGAGAATGG - Intergenic
1159895803 18:73994993-73995015 GTGAAGAGACTCCCACAGAATGG - Intergenic
1160086819 18:75783998-75784020 GTGGAGCGAATGAGAGGGAAAGG - Intergenic
1160428002 18:78791498-78791520 ATGCAGAGAATGCCAGAGCCAGG - Intergenic
1162612681 19:11768191-11768213 GAGGAGAGAAAGCCTGAGGAAGG - Intronic
1164531112 19:29048922-29048944 ATGGGGAGAATGTCAAAGAAGGG + Intergenic
1165203656 19:34165681-34165703 TTGGAGGTAATGCCTGAGAAAGG - Intergenic
1165284909 19:34833387-34833409 GTGCAGACAGCGCCAGAGAAAGG - Intergenic
1165459909 19:35938185-35938207 TGGGAGAGATGGCCAGAGAAAGG - Intronic
1165793878 19:38507435-38507457 GAGGAGAGAAGGGCTGAGAAGGG + Intronic
1166524362 19:43501874-43501896 GCGGAGAGAATGCCAGGGCTGGG + Intronic
1167370791 19:49080426-49080448 GTAGAGAGAATGCCACAGAGAGG + Intergenic
1167375100 19:49106997-49107019 GAGGAGAGACTTCCCGAGAAAGG + Intronic
1167718516 19:51160837-51160859 GAGGAGAGAAAGGCAGAGGAGGG + Intergenic
1168050589 19:53826776-53826798 ATGGAGATAATGCCTGAGTAAGG + Intergenic
1168150971 19:54448523-54448545 GGGGAGAGAATGATAAAGAAAGG - Intergenic
1168308858 19:55451079-55451101 GAGGAGAGAGAGCCAGAGAGGGG + Intergenic
1168530480 19:57124371-57124393 GTGGGGAGAGAGACAGAGAAAGG - Intronic
1202649937 1_KI270706v1_random:170775-170797 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1202694410 1_KI270712v1_random:113952-113974 ATGGAAAGAGTGCCAGAGAATGG + Intergenic
1202697449 1_KI270712v1_random:135372-135394 GTGGAGGGAAGGCTAGAGGAAGG - Intergenic
925100258 2:1238285-1238307 GTGGAGAGAAAGAGAGAGGAAGG - Intronic
925135226 2:1522094-1522116 GTAGAGAGACTGCCAGGGCACGG - Intronic
925135246 2:1522174-1522196 GTAGAGAGACTGCCAGGGCATGG - Intronic
925212743 2:2064121-2064143 GAGGGGAGAAGCCCAGAGAAAGG + Intronic
926239111 2:11071231-11071253 GAGGAGAAAGTGCCAGTGAAAGG + Intergenic
926312026 2:11681935-11681957 GTGGAGACAAACCCAGGGAAAGG + Intronic
927086166 2:19675691-19675713 GTGAATGGAAGGCCAGAGAAGGG - Intergenic
927104826 2:19814623-19814645 GGGGAGAGATTGCCATAGGAAGG - Intergenic
927121536 2:19968863-19968885 GGGTAGAGAAGGGCAGAGAATGG - Intronic
927174740 2:20397883-20397905 GGGGAGAAAATGGCAGAGGATGG + Intergenic
927412197 2:22839410-22839432 GTGGAGAGAGTAAAAGAGAAGGG - Intergenic
927497275 2:23559400-23559422 GGGTAGAGAATGGCTGAGAAGGG + Intronic
927529876 2:23786273-23786295 TTTGAGAGAATGCCAAAAAAGGG - Intronic
927942737 2:27115563-27115585 GTGGAGAAAATACCAGAGACAGG - Intronic
928271545 2:29859587-29859609 GTGAAGGTAATGGCAGAGAAAGG + Intronic
930578694 2:53183812-53183834 GTGGACACAATGGCAGAGAGAGG - Intergenic
931927577 2:67090613-67090635 GTTGAGAGAAGGTGAGAGAAGGG + Intergenic
931991757 2:67797206-67797228 GGGGAGAGGATGTCAGAGGAGGG - Intergenic
932445760 2:71780068-71780090 GTGGAGAGAGAGAGAGAGAATGG - Intergenic
932907218 2:75767182-75767204 GAGAAGAGAAGGGCAGAGAAAGG + Intergenic
933952151 2:87340612-87340634 ATGGAAAGAGTGCCAGAGAATGG - Intergenic
934236395 2:90236950-90236972 ATGGAAAGAGTGCCAGAGAATGG - Intergenic
934278619 2:91592396-91592418 GTGGAGGGAAGGCTAGAGGAAGG - Intergenic
934573606 2:95386517-95386539 GTGAGGACAATGCCAGGGAAGGG + Intergenic
935140252 2:100346590-100346612 TTGGAGTGAATTCCAGACAAGGG + Intergenic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
936639252 2:114293630-114293652 GTGTTGAGAAAGCCTGAGAAGGG - Intergenic
937026147 2:118699460-118699482 GGGGAAAGCATGCCAGAGGATGG - Intergenic
937108150 2:119338524-119338546 GTGAGGAGAATGAGAGAGAAAGG + Intronic
937333937 2:121049148-121049170 ATGTGGAGAAGGCCAGAGAATGG + Intergenic
938134985 2:128749555-128749577 CTGGAGAGAATTCCAGACACGGG - Intergenic
938441359 2:131337003-131337025 GTGGAGAGAGTCCCAGGAAATGG - Intronic
938611142 2:132948775-132948797 GTGGGGAAAAGGCAAGAGAAGGG - Intronic
939637918 2:144605609-144605631 GTGGAGAGATTGCCTAAGATAGG + Intergenic
939966004 2:148610868-148610890 GTGCAGAGAAGGGCAGTGAAGGG + Intergenic
940075076 2:149732456-149732478 GTGGGCAGGGTGCCAGAGAAGGG + Intergenic
941789997 2:169541812-169541834 TTGGAGAGACAGCCAGAGACTGG - Intronic
942345532 2:174998659-174998681 GTTGAGAGAATGTGGGAGAAGGG - Intronic
943545714 2:189274468-189274490 GTGAGGAGGATGCCAGAGGAAGG - Intergenic
943703888 2:191014702-191014724 GTAGAAAGAATGCCAGAGGCAGG - Intronic
944091332 2:195915239-195915261 ATGTAGGGAATGTCAGAGAAAGG + Intronic
944201895 2:197116614-197116636 GAGGAGAAAGAGCCAGAGAAAGG - Intronic
944317165 2:198295687-198295709 ATGGGGAGAATCTCAGAGAATGG - Intronic
945563590 2:211368548-211368570 CCAGAGAGAATGCCAGAGAGGGG + Intergenic
947011323 2:225570196-225570218 CTGGATAGAATGCCACAAAAGGG + Intronic
947032628 2:225815190-225815212 GTGGAGAGAATGCTAGATTAAGG + Intergenic
947557921 2:231113704-231113726 ATGTAGAGAATGCCAGAGTGTGG - Intronic
947673908 2:231960872-231960894 GAGGAAAGAATGCCAGTGAGGGG - Intergenic
947875978 2:233468605-233468627 GGGGAGAGGATGGAAGAGAAGGG - Intronic
948176030 2:235943764-235943786 GTCGAGAGACAGCCAGAGATGGG + Intronic
948350880 2:237339962-237339984 GTGGAGAGCATTCCAGGGAGGGG + Intronic
1169781419 20:9314519-9314541 GTGGAGAGAATGCCAGAGAAGGG + Intronic
1171107226 20:22445821-22445843 GCAGAGAGAATGGCGGAGAAGGG + Intergenic
1171225821 20:23441285-23441307 GTGGAGAGGATGTGAGAGATAGG + Intronic
1171250257 20:23640889-23640911 GGGGAGAGATTTTCAGAGAAGGG + Intergenic
1171256358 20:23691508-23691530 GGGGAGAGATTCCCAGAGAAGGG + Intergenic
1171263712 20:23753418-23753440 GGGGAGAGATTTCCAAAGAAGGG + Intergenic
1171881431 20:30620508-30620530 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
1172121258 20:32600185-32600207 CTGGAGAAAATGTCAGAGAAGGG + Intronic
1172569753 20:35960771-35960793 GGGAAGAGAATGGAAGAGAAGGG - Intronic
1173500224 20:43547952-43547974 GAGGAGAGAAGGGGAGAGAAAGG - Intronic
1173506544 20:43591389-43591411 TTGAAGAGAAAGCGAGAGAATGG + Intronic
1173810396 20:45951853-45951875 CTGGGGAAAATGCCACAGAAGGG - Intronic
1173822342 20:46027808-46027830 GTGGACATAATGCCAGTGGATGG - Intronic
1174140272 20:48408280-48408302 GTGGAGAGCCAGCCAGGGAAAGG - Intergenic
1174421838 20:50404433-50404455 CTGGAGAGAAAGACAGAGACAGG + Intergenic
1174960233 20:55148069-55148091 GTGGGAAGAACGCCACAGAAGGG - Intergenic
1174961492 20:55162171-55162193 ATGGAGAGAATGCCAGACTGAGG + Intergenic
1175087688 20:56473942-56473964 CAGGAGAGAATGGCAGGGAATGG + Intronic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1176601885 21:8801772-8801794 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
1176626098 21:9092954-9092976 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1176718101 21:10371530-10371552 GTGGAGAGAGAGAGAGAGAAAGG - Intergenic
1178110210 21:29362801-29362823 GTGGAGAGGAAGGCAGAGACTGG + Intronic
1178481335 21:32981813-32981835 GGGGAGGGAAGGCGAGAGAAGGG - Intergenic
1179569200 21:42268087-42268109 GTGCAGAGACTGCCAGAGCCAGG - Intronic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1180220403 21:46354861-46354883 ATGGGGGAAATGCCAGAGAAGGG + Intronic
1180299329 22:11024440-11024462 GTGGAGAGAGAGAGAGAGAAAGG - Intergenic
1180344170 22:11693323-11693345 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
1180365423 22:11933901-11933923 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1181340650 22:22177074-22177096 TTGGTGAGAAGGCCACAGAATGG + Intergenic
1182550883 22:31100197-31100219 GAGGAGAGCAGGACAGAGAAAGG - Intronic
1182863570 22:33582589-33582611 GTTGAGAGAATGGCAGCCAATGG - Intronic
1183254464 22:36753476-36753498 GGGAAGAGAATTCCAGACAAAGG - Intergenic
1184092356 22:42299337-42299359 ATGGAGAGAGTGCCAGAGCAGGG - Intronic
1184506917 22:44909405-44909427 GTGCAGACACTGCCACAGAATGG + Intronic
1203308876 22_KI270736v1_random:128643-128665 GTGGAGTGAATGGAATAGAATGG + Intergenic
949396135 3:3616505-3616527 GTGAAGAGCAAGCCAGACAATGG - Intergenic
950311332 3:11960959-11960981 GTGGGGGGAAGGACAGAGAACGG + Intergenic
950416814 3:12873507-12873529 GTGGGGAGCAGGCCTGAGAAGGG + Intergenic
950880148 3:16316873-16316895 CTGGAGAGGATGCCAGGGACGGG - Exonic
953455020 3:43034207-43034229 ATGGAGAGAATGGGAGAGGAAGG + Intronic
954223363 3:49167717-49167739 GTGGAGAGAAAGCAAGAGTAGGG + Intergenic
954227385 3:49190966-49190988 CTGGAGAGAATTTCAGAGAGAGG + Intronic
954562341 3:51568302-51568324 GAGGAGTGAATGACAGAAAAAGG - Intronic
954629551 3:52040548-52040570 AGGGAGAGAGGGCCAGAGAAGGG + Intergenic
954629582 3:52040656-52040678 AGGGAGAGAGGGCCAGAGAAGGG + Intergenic
954629598 3:52040710-52040732 AGGGAGAGAGGGCCAGAGAAGGG + Intergenic
954629615 3:52040764-52040786 AGGGAGAGAGGGCCAGAGAAGGG + Intergenic
955347738 3:58173387-58173409 GTGGAGAGAAAAGCAGGGAAGGG + Intergenic
955492925 3:59501214-59501236 GAGGATGAAATGCCAGAGAAAGG - Intergenic
956246924 3:67194018-67194040 CTGGAATGAATCCCAGAGAAAGG + Intergenic
956533443 3:70248455-70248477 GTAGAAAGAATGCCAGGAAATGG + Intergenic
956614483 3:71157272-71157294 GAGGAGAGAATAACACAGAAAGG + Intronic
956767399 3:72495337-72495359 GTGGAGAAAAATCCAGAAAAGGG - Intergenic
956891269 3:73616552-73616574 GAGGATAGAAATCCAGAGAATGG + Intronic
958057850 3:88436032-88436054 GGGAAGAGAATGCAAGAGAAAGG + Intergenic
958830993 3:99089000-99089022 GGGGAAAGCATGACAGAGAATGG + Intergenic
958920129 3:100095824-100095846 GTGAAGAGAAACCCACAGAACGG + Intronic
959000113 3:100954486-100954508 GAGGAAAGGCTGCCAGAGAACGG - Intronic
959343447 3:105161147-105161169 GTGGAGAGAAGACAAGAGGAGGG - Intergenic
959427590 3:106211191-106211213 GTAGAAAGAATGCTAGGGAAAGG + Intergenic
959512245 3:107226834-107226856 GTGAAGACAATGGCAGAGATTGG + Intergenic
959712761 3:109401382-109401404 GTGAAGACAATGGCAGAGATAGG - Intergenic
960167054 3:114414886-114414908 GGGAAGAGAACCCCAGAGAAAGG - Intronic
960284283 3:115809781-115809803 GAGGAAGGAAAGCCAGAGAAAGG + Exonic
962451317 3:135519729-135519751 GTGGAGAGAAAGAAAGAGAGGGG - Intergenic
964517063 3:157523028-157523050 GAGGGGAGAAAGGCAGAGAAAGG - Intronic
965981794 3:174701307-174701329 GTTGAGCAGATGCCAGAGAAGGG + Intronic
966771566 3:183508526-183508548 GTGGAAAGGAGGCCAGAAAATGG + Intronic
966899423 3:184469602-184469624 GTGCAGAGAATGCCAAGGAAGGG - Intronic
967085639 3:186092796-186092818 GAGGAGAGACTTACAGAGAATGG - Intronic
967143172 3:186581247-186581269 AGGGATAGATTGCCAGAGAAGGG + Intronic
967525803 3:190491457-190491479 GTGGAGGGAGTACCAAAGAAGGG + Intergenic
968160225 3:196420689-196420711 ATGGAGAGAAGGACAGATAAAGG - Intronic
968299805 3:197603815-197603837 GTGGAGAGAAAGACAGGAAAAGG - Intergenic
969310941 4:6352966-6352988 GTGGAGACAAAGGCAGAGATGGG + Intronic
969630169 4:8331250-8331272 GTGGGCAGAAGGCCAGAGGAAGG + Intergenic
969783219 4:9428701-9428723 GTGCTGAGAAGGCAAGAGAAAGG + Intergenic
970251909 4:14125786-14125808 GTGGAGTGAAAGCCACAGAGTGG - Intergenic
971670083 4:29545193-29545215 ATGGTGAGAAGGACAGAGAAAGG + Intergenic
971694488 4:29881706-29881728 GAAGAGAGAATTGCAGAGAAAGG - Intergenic
972301998 4:37793165-37793187 GGGCAGAGAAGGGCAGAGAAGGG + Intergenic
972997612 4:44901165-44901187 CTGAAGAAAATGACAGAGAAGGG - Intergenic
973199072 4:47479183-47479205 GGAGAGAGAGTGCCAGAGTAGGG - Intergenic
973209149 4:47596160-47596182 GTGCAGAAAATGCCTGAAAAAGG - Intronic
973365208 4:49203579-49203601 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
973395384 4:49588875-49588897 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
973746096 4:53964964-53964986 GAGGAGAGAATGAGAGAGAAAGG - Intronic
973907911 4:55548878-55548900 TTGGAGAGAATGTGGGAGAAAGG - Intergenic
975470747 4:74763707-74763729 GTGGGGAGATAGCCAGAGATTGG + Intronic
975801859 4:78068390-78068412 GGGGAGAGAATTCCAGAGATAGG + Intronic
976339406 4:83929661-83929683 GTGCAGGTAATGCCACAGAAAGG + Intergenic
978036171 4:103998006-103998028 GTGGAGAAAATCTCAGATAATGG - Intergenic
978153072 4:105460305-105460327 GTGGAAAGAAACCAAGAGAAAGG - Intronic
978292410 4:107158241-107158263 GTGTAGAAAATACCAGAGTAAGG - Intronic
978361563 4:107935949-107935971 TTGGTGAGAATAGCAGAGAAGGG + Intronic
978821764 4:112974917-112974939 GGGGAGAAAATGACATAGAAAGG + Intronic
978844314 4:113253780-113253802 ATGGACAGAATGCAAAAGAAGGG - Intronic
979275571 4:118811349-118811371 GTGCAGATGATGCAAGAGAAAGG + Intronic
979480776 4:121214447-121214469 GTGGAGAAGAGGCAAGAGAATGG + Intronic
979620886 4:122797580-122797602 GAGGAGAGAGTGACAGAGACAGG - Intergenic
979865751 4:125751153-125751175 ATGGAGAAAGTGGCAGAGAATGG - Intergenic
980630891 4:135431693-135431715 GAAGAGAGAAAGCCAGAGAATGG + Intergenic
980889612 4:138800432-138800454 ATGTAGAGTATGCCAGAAAATGG - Intergenic
981074364 4:140576777-140576799 GTGGAGATCATGCCAAAGGATGG - Intergenic
981120229 4:141041380-141041402 GGGAAGAGAATGCCATAGGATGG + Intronic
981636474 4:146886565-146886587 GAGGAGAGAAGGCCTGATAAAGG + Intronic
982524520 4:156461039-156461061 GTGCTGAGAATGCCAGTGTAAGG + Intergenic
983568146 4:169176004-169176026 GTGGACAGAAAGGAAGAGAAAGG - Intronic
984878224 4:184388435-184388457 GTGGAGTGGATGCCTCAGAACGG - Exonic
985224798 4:187748365-187748387 GTGAAAAGAATGGCAGAGATGGG + Intergenic
1202762589 4_GL000008v2_random:125206-125228 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
987441707 5:17964955-17964977 GTGGAGAGAAATAGAGAGAAAGG - Intergenic
987705690 5:21459943-21459965 CTGGAGAGAAAGGAAGAGAAAGG + Intergenic
989582398 5:43045177-43045199 GTGCAGAGGAGCCCAGAGAAGGG + Intergenic
990982918 5:61617722-61617744 CTTAAGAGAAAGCCAGAGAAAGG - Intergenic
991465001 5:66903193-66903215 GTGGAGAGAATGAAAGACATTGG + Intronic
991681123 5:69140567-69140589 GTGAAGAGAAACCCACAGAATGG - Intergenic
993478823 5:88397507-88397529 GTGGAGTGCATGCCAGGGGATGG - Intergenic
993698173 5:91086784-91086806 GTGGAGAGAATGCTAGAGGCAGG - Intronic
993728085 5:91391072-91391094 CTGAAGAGAATGCAATAGAAAGG + Intergenic
994042009 5:95269548-95269570 TTGGAGAGAAGGCTAGAGGAAGG - Intronic
995214043 5:109574253-109574275 GTGGAGAGAGGGCAAGAGAGAGG + Intergenic
995866615 5:116698241-116698263 GTGGAGGAAATGCCAGCAAAGGG + Intergenic
995941310 5:117588261-117588283 GTAGAAAGAATGACAGAAAATGG + Intergenic
996681591 5:126233281-126233303 GTGGAGAGGATGCGTGAGAAAGG + Intergenic
996891457 5:128426108-128426130 GCATAGAGAATGCCAGTGAATGG - Intronic
997033646 5:130160826-130160848 TTGGAGGGAATACCAGGGAATGG + Intronic
997368592 5:133341642-133341664 CTGGAGAGAATGGCACAGAGAGG - Intronic
998232432 5:140369545-140369567 GTGTGGAGAATGTCAGACAAGGG + Intronic
1000513337 5:162209977-162209999 GAGGAGAGAGTGTCAGAGAGAGG + Intergenic
1001679757 5:173547476-173547498 GTGGGGAGAAGGCCAGTGCAGGG + Intergenic
1001913317 5:175539056-175539078 GAGGACAGAGGGCCAGAGAAAGG - Intergenic
1002190896 5:177476972-177476994 GTGGAAAGTCTGCCAGAAAACGG - Intergenic
1002555630 5:180037253-180037275 GTGGAAAGAAGGACAGAGAGAGG + Intronic
1002874486 6:1199537-1199559 GTGGAGAGAGACCCAGGGAAGGG + Intergenic
1002945588 6:1758249-1758271 GTGGAGATAATGACCAAGAAGGG - Intronic
1003614823 6:7645440-7645462 GTGGAGAGAGAACAAGAGAATGG - Intergenic
1004932586 6:20476498-20476520 GTGGAGAGAAGGAGAGAGAGGGG - Intronic
1004990108 6:21127410-21127432 GTTAAGTGAATGCCAGAAAAAGG + Intronic
1005583021 6:27251323-27251345 GGGAAGAGGAGGCCAGAGAAGGG + Intronic
1005824918 6:29627105-29627127 GTGGAGGGAATGTCAGAGGTGGG - Intronic
1005862465 6:29912063-29912085 GTGGAAAGATGGCCAGAGAGTGG - Intergenic
1005873906 6:29997071-29997093 GTGGAAAGATGGCCAGAGAGTGG - Intergenic
1005996578 6:30934835-30934857 GTGGGGAGACTTCCAGAGACAGG - Intergenic
1006067167 6:31470443-31470465 GTGGAAAGATGGTCAGAGAATGG + Intergenic
1006338543 6:33433320-33433342 GTATAGAGCATGGCAGAGAAGGG + Intronic
1006357692 6:33570056-33570078 GTGGAGAGAGAGAAAGAGAAGGG - Intergenic
1006914056 6:37583311-37583333 GTGGAGGGCATGCCAGCCAAGGG + Intergenic
1007075607 6:39064382-39064404 AGGGAGTGAAGGCCAGAGAATGG - Intronic
1007268826 6:40620284-40620306 CTGGAGAGCATGCCAGAGCCTGG + Intergenic
1007695360 6:43728977-43728999 GTGGAGAGAAGCCCAGAGTCTGG - Intergenic
1007728222 6:43929664-43929686 GTGGACAGACTGCCAGAGCTGGG + Intergenic
1007968343 6:46024938-46024960 ATTGACAGAATTCCAGAGAAAGG + Intronic
1009418607 6:63441646-63441668 GGAGAAAGAGTGCCAGAGAAAGG + Intergenic
1009676379 6:66827928-66827950 GAGGAGAGCATTCCAGAGAGAGG - Intergenic
1010510655 6:76715070-76715092 ATGAAGAGAAAGGCAGAGAAGGG + Intergenic
1011968526 6:93191745-93191767 GTGGAGAGGAAGGAAGAGAAGGG + Intergenic
1012983020 6:105849934-105849956 GTGCAGGGAATCCCAGAGGAGGG - Intergenic
1013073275 6:106748504-106748526 GCGGAGAGGATGCGAGAGAAAGG - Intergenic
1013588391 6:111599363-111599385 GAGTAGAGAAGCCCAGAGAAAGG - Intronic
1014893480 6:126871072-126871094 GTGTAGAGAAAGGCAGGGAAAGG - Intergenic
1015071906 6:129104765-129104787 GTGGAGTGGAGGGCAGAGAAGGG - Intronic
1015771191 6:136769872-136769894 GTGGAGAGAAGGGAAGGGAAAGG + Intronic
1016662799 6:146600388-146600410 GTGGAGAGAAGGCTAGTGGAAGG - Intronic
1017203160 6:151777062-151777084 GAGCATAAAATGCCAGAGAAAGG + Intronic
1017334199 6:153236187-153236209 GTGGAGAGAATGAGGAAGAAAGG - Intergenic
1018160558 6:161038055-161038077 GAGGAGAGAAAGCGTGAGAAAGG - Intronic
1018184867 6:161257919-161257941 GTTGAGAAAGTGCCAGAGCAAGG - Intronic
1018197635 6:161368835-161368857 TTGGAGACAATGACAAAGAAAGG - Intronic
1018325885 6:162668474-162668496 TAGAAGAGAATGCCAGAGACGGG + Intronic
1018761829 6:166899989-166900011 GTGGAGAGAATGCCATGTGAAGG + Intronic
1019200264 6:170308043-170308065 GTGAAGGGGAGGCCAGAGAAAGG - Intronic
1019730720 7:2627919-2627941 AAGGAGAGAAGGCCAGAGAGAGG - Intergenic
1019867677 7:3727952-3727974 TTGGAGAAACTGCCAGAGACTGG - Intronic
1020342396 7:7126093-7126115 ATGAAGAGAATGACAAAGAATGG - Intergenic
1021616263 7:22505997-22506019 GCAGCGAGCATGCCAGAGAAGGG + Intronic
1021725623 7:23545430-23545452 TTGGAGAGAATGACAATGAAAGG - Intergenic
1022325481 7:29327139-29327161 GTGGAGATAATGCTGGAGAGAGG + Intronic
1022772649 7:33491109-33491131 TTGGAGAGAATGCCCCACAAGGG + Intronic
1022926055 7:35057212-35057234 GCAGCGAGCATGCCAGAGAAGGG + Intergenic
1023320101 7:38987271-38987293 GAGGTAAGAATGACAGAGAATGG + Intronic
1024101494 7:46037076-46037098 GTGGAGTCAATCCCAGAGGATGG - Intergenic
1024257484 7:47549546-47549568 TTGGAGAGCAGGCCAGAGACAGG - Intronic
1024644043 7:51356484-51356506 ATGGAGACAAAGCCAGAGCAGGG - Intergenic
1025025934 7:55516043-55516065 GAGGAGAGAATGCAAGCCAAGGG + Intronic
1025248981 7:57338991-57339013 ATGGAGAGAAAGACAGAGACAGG - Intergenic
1026985945 7:74555325-74555347 GTGGGGAGAATGCCAGGGCCAGG - Intronic
1027014291 7:74769814-74769836 GTGGAAAGACTGCTAGAGGAAGG + Intergenic
1027180297 7:75934833-75934855 GTGGACAGAATGCAAGAGTGAGG + Intronic
1027519745 7:79190754-79190776 GTGTATAGAATCCCAGAGCATGG - Intronic
1027887375 7:83926491-83926513 GTGGAAAGAAAACCAGAGAATGG - Intergenic
1028117017 7:87009695-87009717 GAGGTGAGAAAGCCAGAGAAAGG - Intronic
1028376202 7:90148341-90148363 GCAGTGAGCATGCCAGAGAAGGG - Intergenic
1029824063 7:103171901-103171923 GCAGCGAGCATGCCAGAGAAGGG + Intergenic
1030384297 7:108848743-108848765 GTAAAGAGAATGAGAGAGAAAGG - Intergenic
1030659884 7:112207025-112207047 GCGGAGAAAATGCCATGGAATGG + Intronic
1031210508 7:118819867-118819889 GTGGAAAGAATGACACAAAAGGG + Intergenic
1031417769 7:121513264-121513286 AGGAAGAGAATTCCAGAGAAAGG + Intergenic
1031575891 7:123415476-123415498 TGGGAGAGGATGACAGAGAAAGG - Intergenic
1033945561 7:146713428-146713450 ATGGACAGAATGACAAAGAAGGG - Intronic
1034438402 7:151074610-151074632 GTGGAGGGCATGCCATGGAAAGG - Intronic
1034731050 7:153387833-153387855 GAGGAGAGAATGCAAGAGGATGG + Intergenic
1034867002 7:154650343-154650365 GTGGAGAGGAGGGCAGAGGAGGG + Intronic
1036565048 8:9931327-9931349 GTGTAGATTATGCCAGAGGATGG + Intergenic
1036592487 8:10181633-10181655 GTGGAGAGGAGCCCAGAGAGAGG + Intronic
1036652768 8:10655587-10655609 GTGGAGAAAATGGCTGAGGACGG - Intronic
1036835831 8:12065350-12065372 GTGCTGAGAAGGCAAGAGAAAGG - Intronic
1036857674 8:12311919-12311941 GTGCTGAGAAGGCAAGAGAAAGG - Intergenic
1037839209 8:22232071-22232093 GAGGAGAGAGAGGCAGAGAAGGG + Exonic
1038006849 8:23437839-23437861 GTGCAGTGCATGCCAAAGAAAGG + Intronic
1038500065 8:28036373-28036395 GTGGAGAGAAGGACAGTGATAGG - Intronic
1039227458 8:35403909-35403931 ATGGAGAGAATGTCAGTGGAGGG - Intronic
1039286034 8:36041874-36041896 GGTAAGAGAATGCTAGAGAAAGG + Intergenic
1039339174 8:36628066-36628088 GAGAAGAGCCTGCCAGAGAAAGG + Intergenic
1039367887 8:36950882-36950904 GTGACGAGAAGGCAAGAGAAAGG - Intergenic
1039615427 8:38951405-38951427 GTAGAGTGCATGACAGAGAAAGG + Intronic
1041938654 8:63362560-63362582 AGTGTGAGAATGCCAGAGAACGG - Intergenic
1042398323 8:68316900-68316922 GTGGAGGGAATGCCACTGAGAGG - Intronic
1042966677 8:74361086-74361108 GTGGAGAAAAAGGAAGAGAAGGG - Intronic
1042978486 8:74498817-74498839 GTGGGGAGCAGGACAGAGAAAGG - Intergenic
1044542122 8:93419760-93419782 CTGGAAAGAAGCCCAGAGAAAGG - Intergenic
1046374129 8:113353353-113353375 GTAGAGAGAATGGTAGATAAAGG + Intronic
1046494880 8:115000496-115000518 GTAGAGAGAAAGAGAGAGAAAGG - Intergenic
1046997552 8:120541291-120541313 GTGGAGAGAGGGCCAGAGGAGGG - Intronic
1047219832 8:122910573-122910595 GCTGAGAGACTGCCAAAGAAAGG - Intronic
1047294738 8:123560693-123560715 GAGGAGAACCTGCCAGAGAATGG + Intergenic
1047312102 8:123700778-123700800 GTGGAGAGGAAGGGAGAGAAGGG - Intronic
1048323050 8:133416572-133416594 GTGGAGAGAACGCCAGAAATAGG + Intergenic
1048618418 8:136104876-136104898 GAGGACAGGATGCCTGAGAAGGG + Intergenic
1049270993 8:141696248-141696270 GTGGAGAGAGAGGCAGAGACTGG - Intergenic
1049467043 8:142756328-142756350 GTGGAGAGAATGACAAAGTCGGG - Intergenic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1051428617 9:16959937-16959959 GTGGAGAGAAAGGGAGGGAAAGG - Intergenic
1052843123 9:33310551-33310573 ATGGAGAGAATGAAAGGGAAGGG - Intronic
1053575255 9:39353488-39353510 GTGGAGGGCAGGCCAGACAATGG - Intergenic
1053839759 9:42181422-42181444 GTGGAGGGCAAGCCAGACAATGG - Intergenic
1054096817 9:60912171-60912193 GTGGAGGGCAGGCCAGACAATGG - Intergenic
1054118221 9:61187797-61187819 GTGGAGGGCAGGCCAGACAATGG - Intergenic
1054589534 9:66994767-66994789 GTGGAGGGCAGGCCAGACAATGG + Intergenic
1054796686 9:69308763-69308785 GTGGAGATAAAGGCAGAGATTGG + Intergenic
1055815244 9:80197182-80197204 GTGAAGAGATTGCCAGGGAAAGG - Intergenic
1056445013 9:86656978-86657000 GTGAAGAGAGTTACAGAGAATGG - Intergenic
1056747920 9:89320448-89320470 GTGGAGGGAAGGGCAAAGAAAGG + Intronic
1057492360 9:95530923-95530945 GTGGAGATAATGAATGAGAATGG + Intergenic
1057993927 9:99802055-99802077 GTGGACAGAATTGCAGAGATAGG - Intergenic
1058311485 9:103509180-103509202 GTGCAAAGAATGACAGAGAAGGG + Intergenic
1058616895 9:106839543-106839565 TTGCAGAGAATGCCAAAGAAGGG + Intergenic
1058681860 9:107447058-107447080 GTGGAGAGACAGCCACTGAAAGG + Intergenic
1059589608 9:115644445-115644467 ATGGAGAGAATGCCAGGACAAGG - Intergenic
1059738915 9:117130424-117130446 GTAGAGAGAAAGCCTGAGCAAGG - Intronic
1060041266 9:120303749-120303771 ATGGAGAGAAAGCCAGTGGAAGG + Intergenic
1060058144 9:120433779-120433801 GTGGAGTGAATGGCAGAGCTGGG - Intronic
1060614715 9:125002351-125002373 ATGTAGAGAAAGCCACAGAAGGG - Intronic
1061326917 9:129869622-129869644 GTGCAGACATTGCCAGAGGATGG + Intronic
1061877772 9:133553542-133553564 TGGGAGAGAATGCCAGCGAAAGG - Intronic
1062242659 9:135548504-135548526 GGGGAGAGGAGGCCTGAGAATGG - Intronic
1062382926 9:136296289-136296311 GTGGAGTGAACGCCTGAGATTGG - Intronic
1203749270 Un_GL000218v1:63375-63397 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1203348492 Un_KI270442v1:56864-56886 GTGGAAAGAATGCTATGGAATGG + Intergenic
1203543349 Un_KI270743v1:110087-110109 CTGGAGAGAGTGCAAGAGGAAGG - Intergenic
1185616831 X:1427157-1427179 GTGGAGACAAAGGCAGAGACTGG + Intronic
1186047480 X:5552167-5552189 GAGCAGAGAATGGCAGAGAGTGG + Intergenic
1186682192 X:11886857-11886879 GGAGAGAGCATTCCAGAGAAAGG - Intergenic
1187360476 X:18622219-18622241 GTCGAGAGGATGTTAGAGAATGG - Intronic
1189376494 X:40470729-40470751 ATGCAGTGCATGCCAGAGAAGGG + Intergenic
1189583552 X:42433146-42433168 GTTGACAGAATGCCAGGTAACGG - Intergenic
1190372823 X:49759228-49759250 GGAGAGAGAAAGACAGAGAAGGG - Intergenic
1190904294 X:54710784-54710806 GGGGAGAGAATGAGAGAAAAAGG - Intergenic
1191171491 X:57452096-57452118 GAGGGGAGAAAGCCAGTGAAAGG - Intronic
1192317700 X:70065712-70065734 GTGGAGAGAAGGGCAGGAAAGGG + Intergenic
1192438025 X:71154648-71154670 GGGGAGTGAATGGCAGAGATAGG - Intronic
1193694199 X:84686937-84686959 TTTGACAGAATGCCAGAGAGAGG - Intergenic
1194284410 X:91991488-91991510 GTGAAGAGAAAGCCAGACATTGG - Intronic
1194391870 X:93329003-93329025 CTGGAGAGTCTGCCTGAGAATGG - Intergenic
1194844155 X:98782727-98782749 GTAGAGAGAATGGGAGAGAAGGG + Intergenic
1195676661 X:107511986-107512008 GTGGAGAGAATTCCAGAAGGTGG - Intergenic
1195825395 X:108994556-108994578 GTAGAGAGAATGTGAAAGAAAGG - Intergenic
1196123187 X:112071904-112071926 GAGGAGAGAATGCCCAAAAAGGG - Intronic
1196595007 X:117534999-117535021 GAGCAAAGAATTCCAGAGAAAGG - Intergenic
1196746915 X:119079438-119079460 ATGAAGAGAAAGACAGAGAAAGG + Exonic
1197820586 X:130537276-130537298 GTGGTGAGGATGCCAGATGATGG - Intergenic
1199799307 X:151233801-151233823 GTGGAGAGAATGACTGGGACGGG + Intergenic
1200379942 X:155825298-155825320 GTGAAGAGAAACCCACAGAATGG + Intergenic
1200601979 Y:5216047-5216069 GTGAAGAGAAAGCCAGACATTGG - Intronic
1201123691 Y:10893806-10893828 GTGGAGAGAATGGAATGGAATGG - Intergenic
1201162630 Y:11178386-11178408 CTGGAGAGAGTGCAAGAGGAAGG + Intergenic
1202183614 Y:22160185-22160207 CTGGAGAGGACACCAGAGAAAGG - Intergenic
1202207745 Y:22426216-22426238 CTGGAGAGGACACCAGAGAAAGG + Intergenic