ID: 1169785687

View in Genome Browser
Species Human (GRCh38)
Location 20:9357221-9357243
Sequence CTGTGAGAATAATCAATGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169785687_1169785690 -10 Left 1169785687 20:9357221-9357243 CCCGTCATTGATTATTCTCACAG 0: 1
1: 0
2: 3
3: 17
4: 122
Right 1169785690 20:9357234-9357256 ATTCTCACAGCTCAGATATAGGG 0: 1
1: 0
2: 0
3: 6
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169785687 Original CRISPR CTGTGAGAATAATCAATGAC GGG (reversed) Intronic
901240733 1:7691682-7691704 CTGTGTGAAAAGTCAATGGCAGG + Intronic
901948145 1:12720154-12720176 ATTTGAGAAAAATCAATGAGAGG + Intronic
902648341 1:17819690-17819712 GTGTGGGAATATTCAATGAAAGG - Intronic
903629202 1:24753881-24753903 CTGTTAGAAAAAACAAAGACGGG - Intronic
903990123 1:27261574-27261596 CTGTGAGATAAATGGATGACTGG + Intronic
904981936 1:34511337-34511359 CCATGAGAAAAATCAATGAGTGG + Intergenic
911941261 1:104050945-104050967 CTGGGAGAATAATTGATGACTGG - Intergenic
916716738 1:167452726-167452748 CTCTGGGAGTAAACAATGACAGG + Intronic
917544547 1:175949717-175949739 CTATGAGAACAAATAATGACAGG + Intronic
918775041 1:188617187-188617209 GTGTGATAATAATAAATTACTGG + Intergenic
919545044 1:198905376-198905398 ATAAGAGAATAAGCAATGACGGG + Intergenic
921662252 1:217818126-217818148 CTGTAAGAATAATAAAATACTGG - Intronic
924046968 1:240041753-240041775 CTGTGAGGAAAATTAATGTCTGG + Intronic
924879686 1:248146524-248146546 GAGTGAGAATATTCAATGTCTGG + Intergenic
1066329880 10:34409436-34409458 CTGTGTGAATCATTGATGACAGG - Intronic
1067147701 10:43705486-43705508 CTGAGAGAATAATCAACCACAGG + Intergenic
1069250178 10:66257306-66257328 CTGTGAGAAAAATGGAGGACTGG - Intronic
1070499269 10:77055216-77055238 CATTGAGAATAAACAATGGCAGG + Intronic
1071125377 10:82328690-82328712 CTGTGAGAATAAGAGATGACTGG - Intronic
1071255357 10:83867453-83867475 CTGTGAGGATAAAACATGACTGG + Intergenic
1076611570 10:131729177-131729199 CTGTGAGAAGTACCAATAACCGG - Intergenic
1080063811 11:27985986-27986008 CTGTGAGAATGATAAAGGCCAGG - Intergenic
1087132136 11:94677630-94677652 CTGAGATAATAATCAAAGCCAGG - Intergenic
1092621671 12:10278294-10278316 CTGTGAAAATAATCCATGTCAGG + Intergenic
1095973437 12:47922019-47922041 CAGTGAGCATAAGGAATGACTGG + Intronic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1098843981 12:75512632-75512654 CTGTGAGTTTTATAAATGACAGG + Intergenic
1100643711 12:96507314-96507336 CTGTGGGAATAATCACTGTTGGG + Intronic
1102858575 12:116316020-116316042 CTGTGATAAGAATATATGACTGG + Intergenic
1104295429 12:127507560-127507582 CTGTGAGTAGGAACAATGACGGG + Intergenic
1104722975 12:131056329-131056351 CAGTGAGAATGATCAATGCAAGG + Intronic
1105041635 12:132965875-132965897 CTGTAAAAATAATGAACGACAGG - Intergenic
1105329209 13:19399227-19399249 CTAGGAGAATAATCAAAAACAGG + Intergenic
1107312662 13:39096040-39096062 CTGTGAGAGTAATCACTGACAGG + Intergenic
1108532707 13:51342503-51342525 CTGCCAGAATATGCAATGACAGG - Intronic
1108787562 13:53923776-53923798 GTGTGAGAATATACAATGATTGG + Intergenic
1108974425 13:56420303-56420325 TTGTTAGAGTAATCAATGTCTGG - Intergenic
1109623286 13:64939925-64939947 CTGTGAAAGTAAACAATGCCAGG + Intergenic
1126342659 15:47660004-47660026 CTATGAGATTAAACAATGATTGG - Intronic
1128397575 15:67243917-67243939 CTTTGAAAATAATCTATGAATGG + Intronic
1130852610 15:87810512-87810534 CTTTGAGAATAGACAATGAAGGG - Intergenic
1137924162 16:52523588-52523610 CTGTGGGAATAAAGACTGACAGG + Intronic
1138825237 16:60311186-60311208 CTCTGATAATAAGGAATGACTGG + Intergenic
1143798255 17:9355997-9356019 CTGTGAAAAAAAGCAATGAATGG - Intronic
1145257743 17:21336714-21336736 CTGTGAGATGATGCAATGACTGG - Intergenic
1145318894 17:21751309-21751331 CTGTGAGATGATGCAATGACTGG + Intergenic
1146360249 17:32169143-32169165 CTGGGAAAATAATGAATGTCTGG - Intronic
1146512730 17:33464106-33464128 CTGGGAAAATGAGCAATGACAGG - Intronic
1154065522 18:11103624-11103646 CTGTGACCATAATCAGTGACAGG + Intronic
1155174824 18:23292769-23292791 CATTGGGAAGAATCAATGACAGG + Intronic
1156054891 18:32989859-32989881 CTATATGAATAATCAATGGCAGG - Intronic
1156796412 18:41051633-41051655 TTGAGAGAATAATCATTGACTGG + Intergenic
1159168194 18:64728391-64728413 CTGTGAGAAGAAATAATTACAGG - Intergenic
1159783135 18:72682344-72682366 CTGTGAAACTAATCAAAGAGTGG - Intergenic
1168169471 19:54576177-54576199 CTGGGACAATAATGAATGAGGGG + Intronic
926615036 2:14988483-14988505 CTGTGAGAAAAATCAATTTCAGG + Intergenic
928832201 2:35500513-35500535 CTGTGAGAAGAATCAAGCAAAGG + Intergenic
932884436 2:75535990-75536012 CTGAGAAAATAATCAAAGAAAGG - Intronic
935979409 2:108612151-108612173 CTGTGAGACTAATAAAAGAAAGG - Intronic
937409458 2:121660365-121660387 CTGTGAGAAAAATCAAGAATAGG - Intergenic
939472061 2:142635246-142635268 CTTTGAGAATAATTAATATCTGG + Intergenic
940331708 2:152482114-152482136 CTATGTAAATAGTCAATGACAGG + Intronic
940389563 2:153116665-153116687 CCTTGAGAATAATCAAAGCCTGG - Intergenic
942954813 2:181761710-181761732 CAGTCAGAATAACCAATGAAAGG + Intergenic
943362326 2:186934896-186934918 CTGTGAGCATATTTAATTACTGG + Intergenic
944355846 2:198786940-198786962 GTGTGAGAATGTACAATGACAGG - Intergenic
944682762 2:202091930-202091952 CTGAGAGTAAAACCAATGACTGG - Intronic
947707337 2:232286943-232286965 CTATGAAAACAACCAATGACAGG - Intronic
948270788 2:236671823-236671845 ATGGGAGACGAATCAATGACAGG - Intergenic
948719789 2:239892229-239892251 CAGAGAGAAAAATCGATGACGGG - Intergenic
1169785687 20:9357221-9357243 CTGTGAGAATAATCAATGACGGG - Intronic
1170251080 20:14283467-14283489 CTTGGAGAATAAACATTGACAGG - Intronic
1170416231 20:16145606-16145628 CAGTGGGAGTAATGAATGACAGG - Intergenic
1175460289 20:59147270-59147292 CTGTGACATTAATTAATGCCAGG - Intergenic
1177561817 21:22765363-22765385 CAGTGAGGATAAGCCATGACAGG - Intergenic
1178110797 21:29368290-29368312 CTGTGATAATAATAAATTAAAGG + Intronic
1180838746 22:18947937-18947959 CTTTCAAAATAATCCATGACTGG - Intergenic
1181867586 22:25871215-25871237 CTGTGTGAATCTTCAGTGACTGG + Intronic
1184815613 22:46866890-46866912 CTGTTAGCATAATAAAGGACTGG - Intronic
951187661 3:19733109-19733131 CTGTCAAAATAATCATTTACAGG + Intergenic
952528982 3:34243776-34243798 CTTTGAGAAAAATCATTGAGCGG - Intergenic
953574292 3:44100710-44100732 CTTTGAGACGAATCACTGACGGG - Intergenic
956010335 3:64823995-64824017 CTGTGAAATTAATAAATGTCAGG - Intergenic
956241398 3:67134724-67134746 GTGTGAGAAGAATGAAGGACAGG + Intergenic
957040204 3:75330423-75330445 CTGAGAGCATTATCAATGAGTGG - Intergenic
958040245 3:88218863-88218885 CTGTGAAAATTATCACTGTCTGG - Intergenic
958474808 3:94567917-94567939 GTGTGAGAATAAACAAACACAGG + Intergenic
960789277 3:121409860-121409882 CTGAAAGAATAATCAATACCAGG - Intronic
961044999 3:123702003-123702025 CTGAGAGCATTATCAATGAGTGG - Intronic
965507958 3:169536847-169536869 ATGTTAGAAAAATCAATTACAGG - Intronic
967903729 3:194484529-194484551 CAGTGAGAATAAGCAGTGATGGG + Intronic
970386430 4:15561472-15561494 CTTTGAAAACATTCAATGACTGG - Intronic
972872911 4:43322875-43322897 ATGTGACAGTCATCAATGACTGG + Intergenic
974090863 4:57309973-57309995 TTCTGAGAATGATCAATAACTGG + Intergenic
974317574 4:60302244-60302266 CTGGGAGAATAAGCATTAACTGG + Intergenic
974338269 4:60579915-60579937 CTCTGACAATAACCATTGACAGG + Intergenic
974795260 4:66740911-66740933 TTGTCAGATTAATCAATGACAGG - Intergenic
976471314 4:85432112-85432134 CTCTGAGAATGATGAATGACTGG - Intergenic
980483017 4:133414095-133414117 CAGTGGGAATAATCAATAAATGG - Intergenic
982724977 4:158896681-158896703 ATGTAAGAATAATCTATGACAGG - Intronic
984977777 4:185244927-185244949 CCATGAGACTAATCAAGGACTGG + Intronic
985031268 4:185792987-185793009 TTGTGTGAATAGTCAATGAGAGG + Intronic
988136748 5:27182239-27182261 CATTGAGAAAAATCAATAACTGG + Intergenic
990228308 5:53682087-53682109 CTGAGAGAAGAATAAATTACAGG + Intronic
993393200 5:87347376-87347398 TAGTAAGAATAAACAATGACAGG - Intronic
994200216 5:96965922-96965944 CTGTGAAAAAGATCAAGGACAGG - Intronic
996544713 5:124665866-124665888 CTGGGAGAATAACCACTGGCAGG - Intronic
999303307 5:150504229-150504251 CTGGGAAAATAAGCAATGCCCGG - Intronic
1002625954 5:180529590-180529612 CTGAGAAAATATTCAATGAATGG - Intronic
1009415873 6:63415880-63415902 ATGTAAGAATAATAAATGCCCGG - Intergenic
1010163430 6:72886770-72886792 CTGAGAGAAAAATTACTGACAGG + Intronic
1011198155 6:84803713-84803735 CTGTGAGTTTTATCAATCACAGG - Intergenic
1011563703 6:88650301-88650323 CTGTGAGAATAATCAAGAAAAGG - Intronic
1014241599 6:119023781-119023803 TTGTGAGAAAAATCAATGACAGG - Intronic
1014456879 6:121645935-121645957 CTGTGAGAATAAGCACAGAAAGG + Intergenic
1016862271 6:148732599-148732621 CCTTGAGAATATTCATTGACAGG - Intergenic
1017126701 6:151071391-151071413 CTGTGAGAAAAATCACTAATGGG + Intronic
1017155992 6:151323142-151323164 CTCTAAGAATGATCAAGGACAGG - Intronic
1024431892 7:49298035-49298057 CTGGGAGAATAAACAATCATAGG + Intergenic
1028659628 7:93254566-93254588 CTGAGAGAATACTCCATTACAGG - Intronic
1028714872 7:93953884-93953906 GTGTGAAAATAACCAATAACAGG - Intergenic
1031001449 7:116420097-116420119 CTGTAAGAAAAATCAAAGACTGG - Intronic
1031054793 7:116981517-116981539 CAATGAGAATAATCAATAATGGG - Intronic
1031762403 7:125730238-125730260 TTGTGAGAAAAATCACTGGCTGG - Intergenic
1032680492 7:134177790-134177812 GTGTGAGAATAATGACAGACTGG - Intronic
1032825733 7:135566022-135566044 ATTAGAGAATAATCAATGAATGG - Intronic
1034512445 7:151547332-151547354 CTGTCACACTAATCAATGCCTGG + Intergenic
1034688814 7:152997745-152997767 CTGTGAGATTAAACAACCACTGG + Intergenic
1036793522 8:11739547-11739569 CTGTGAGAATTATCTATGCAGGG - Intronic
1038046777 8:23772234-23772256 CTGTGAGAAGAGTCAGTGAGTGG + Intergenic
1045201335 8:99984893-99984915 CCAGGAGAATAATCAATGATGGG - Intronic
1046661891 8:116956842-116956864 CTGTCAGAATTACAAATGACTGG + Intronic
1047763762 8:127973266-127973288 CTGGGAGACGAATCAATGACAGG + Intergenic
1050221601 9:3397155-3397177 CTGTTAGAGTAAACAATGGCAGG - Intronic
1052460536 9:28757310-28757332 CTGTGAGAAGAATCAATGAGAGG - Intergenic
1054863322 9:69975013-69975035 CTAAGAGAATAAAGAATGACTGG - Intergenic
1185834738 X:3334739-3334761 CTCTGAGAAGAATCATTGAATGG - Intronic
1186297135 X:8162128-8162150 CTGTGAGAATGGTCTATGACTGG - Intergenic
1186354865 X:8780480-8780502 CTGTGAGAATGGTCTATGACTGG + Intergenic
1186377011 X:9014813-9014835 CTGTGAGAATGGTCTATGACTGG + Intergenic
1186863295 X:13694485-13694507 CTGTGATAAAAATCAAGTACTGG - Intronic
1194935749 X:99946333-99946355 CTGTGACAACAATTAATCACAGG - Intergenic
1199192501 X:144987047-144987069 CTGTGAGAATGATGCATGAATGG - Intergenic