ID: 1169786823

View in Genome Browser
Species Human (GRCh38)
Location 20:9368466-9368488
Sequence CCCTGCCCACAACTACTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169786823_1169786830 18 Left 1169786823 20:9368466-9368488 CCAGACAGTAGTTGTGGGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1169786830 20:9368507-9368529 CAAAACGGCTGTGTTAAAGAAGG 0: 1
1: 0
2: 1
3: 7
4: 116
1169786823_1169786827 3 Left 1169786823 20:9368466-9368488 CCAGACAGTAGTTGTGGGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1169786827 20:9368492-9368514 GGAAGAGATCCCAAACAAAACGG 0: 1
1: 0
2: 2
3: 21
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169786823 Original CRISPR CCCTGCCCACAACTACTGTC TGG (reversed) Intronic
905479088 1:38248894-38248916 ACCTGCCCACATCTCCTGTCGGG + Intergenic
906038789 1:42770095-42770117 CCCTGGCCTCAACTACTCTGAGG - Intronic
907525652 1:55052544-55052566 CCCTTCCCACAACTGATGGCAGG - Intronic
907997259 1:59645256-59645278 TCGTGCCAACACCTACTGTCTGG - Intronic
908794667 1:67819156-67819178 CCCTGCCCCCAACTAAAGCCTGG - Intronic
918001596 1:180502423-180502445 CCCTGCCCACTTCTACTCCCTGG + Exonic
918686209 1:187418902-187418924 TCCTGCCCTCCACTACAGTCTGG + Intergenic
918854618 1:189735049-189735071 CTTTGCCCACAAATACTGTTGGG + Intergenic
921961193 1:221036092-221036114 CCCTCCCCTCAAGTACTGTTTGG - Intergenic
1062910612 10:1209425-1209447 CCATGCCCACACCTACAGCCTGG + Intronic
1065966423 10:30774712-30774734 CCCTCCCCACAACTCCTTGCGGG + Intergenic
1068953032 10:62796327-62796349 CCCTGCCCACCAGGAATGTCAGG - Intergenic
1070355203 10:75632991-75633013 CCCTCCCCACATCTTCTGCCAGG - Intronic
1074028724 10:109663619-109663641 CCCTTGCCACATCTGCTGTCTGG + Intergenic
1076684989 10:132194502-132194524 CCCTGCCTCCAGCTCCTGTCAGG - Intronic
1078450995 11:11440644-11440666 CCCTGCTCTCATCTACTGCCAGG + Intronic
1079239289 11:18711156-18711178 CACTGACAACAACTAGTGTCTGG + Intronic
1083307206 11:61767386-61767408 CCCTGGCCACTGCTACCGTCAGG + Intronic
1086594400 11:88553862-88553884 CCCTACCCAAAACTCCTGTGAGG - Intronic
1087126010 11:94626289-94626311 CCCTGCATACAACTTCTGCCTGG + Intergenic
1088497085 11:110442149-110442171 CCCTGCAAAAAACTACTGCCTGG - Intronic
1089012953 11:115145458-115145480 TCCTGCCCACCACAGCTGTCCGG + Intergenic
1094057399 12:26281075-26281097 CCCTGCACACCACTCATGTCTGG - Intronic
1094491415 12:30963249-30963271 CCCTGCCCCCAACTACAGGCAGG + Intronic
1098062072 12:66573563-66573585 CCCTGCCACCTACTACTGTGTGG - Intronic
1102148033 12:110669390-110669412 CCATGCCCACAACTGCCTTCAGG + Intronic
1103099451 12:118159811-118159833 CCCTCCCCGCAACTAATATCAGG - Intronic
1107964579 13:45587573-45587595 CTCTGCCCAAAACAACTGTGAGG - Intronic
1113325489 13:109277559-109277581 CCCTGCCCCTAACAACTGGCAGG - Intergenic
1122585777 14:102805550-102805572 CGCTGCCCAAGACTACTGTTGGG + Intronic
1132406487 15:101544322-101544344 CCCTGCCCACGAAGACCGTCTGG + Intergenic
1133382698 16:5344627-5344649 CCCTGCCACAAACTACTGTCAGG - Intergenic
1133583790 16:7171930-7171952 CCGTGCCCACATCTCCTCTCTGG - Intronic
1134036750 16:11037014-11037036 CCCGCCCCACGACTGCTGTCAGG - Intronic
1138436068 16:57000782-57000804 CCCCGCCCACAAATGCTGGCAGG - Intronic
1138874137 16:60928623-60928645 CCCTCCCTCCAACAACTGTCAGG - Intergenic
1139519186 16:67470532-67470554 CTCTGCCCACAAGTCCTGCCAGG - Intronic
1139876284 16:70148610-70148632 CCCTTCCCACAACCACTGTGGGG + Intronic
1140341419 16:74167885-74167907 CCCTCCCCACACCTCCTGACAGG + Intergenic
1141424895 16:83938492-83938514 GCCTGCCCACACCTGCTCTCAGG + Intronic
1144368523 17:14568436-14568458 CCCTGCCCACTTCTACTTTCTGG + Intergenic
1145860824 17:28208470-28208492 ACTTGCCCTCATCTACTGTCTGG + Intergenic
1146006919 17:29166284-29166306 CCCTGCCCCCACCTACCCTCCGG - Exonic
1146907266 17:36625897-36625919 CCCTCCCCACAGCCACTTTCTGG + Intergenic
1149987253 17:61356640-61356662 CCCTGCCTACAACTAACCTCTGG - Intronic
1152230698 17:79112739-79112761 CCCTGGCCACACCAACTGCCAGG + Intronic
1152552352 17:81035854-81035876 CCCTTCCCACAACTCCTGCCCGG + Intronic
1156553259 18:38040726-38040748 ACCTGCCCACACCCACTCTCTGG - Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1159104276 18:63987613-63987635 CTCTGCCCACCACCACTGCCAGG + Exonic
1164080372 19:21857120-21857142 CACTGCCCACAGCCACTGGCTGG + Intergenic
1165306068 19:35003692-35003714 CCCTGCTCACCAGTGCTGTCTGG + Intronic
1168408243 19:56121536-56121558 CCCAGCCCGCACCTCCTGTCCGG - Intergenic
926062564 2:9813496-9813518 CTCTGCCCACATCTCCTCTCTGG + Intergenic
927282381 2:21320659-21320681 CCCTCCCCAAAACTCCTTTCTGG - Intergenic
928214531 2:29350348-29350370 CACTGGCCACAACAAATGTCTGG - Intronic
928377560 2:30787930-30787952 CCCTGCCCACACCCTCTCTCTGG - Intronic
928983121 2:37156585-37156607 CCCGCCCCACAACTGCTGCCTGG + Intronic
934900780 2:98158362-98158384 CCCAGCCCACAACAGCTGGCAGG + Intronic
936012718 2:108935392-108935414 CCCCGCCCAGACCTGCTGTCTGG + Intronic
937101986 2:119278738-119278760 CCTTGCCCCCAACTCCTGACAGG - Intergenic
937552840 2:123115677-123115699 CCTCCCCCACAACTACTGTGTGG - Intergenic
944290505 2:197999019-197999041 CCATGGCCACAACTCCTGTTGGG - Intronic
946511455 2:220361325-220361347 CCCTGCCCACAACCCATGACAGG - Intergenic
949008976 2:241667860-241667882 CCCTGCTCACATCTCCTGCCAGG + Intronic
1169623675 20:7538722-7538744 CCCTGCCCAAAGCTAGTGTCTGG + Intergenic
1169786823 20:9368466-9368488 CCCTGCCCACAACTACTGTCTGG - Intronic
1170306047 20:14938799-14938821 CCCTGACCACAAATTCTGTTTGG - Intronic
1172871124 20:38136144-38136166 CCCTGGGCACACCCACTGTCCGG - Intronic
1176138459 20:63535179-63535201 CCCTGACCACAGCTGCTCTCAGG + Intronic
1176246935 20:64101990-64102012 CCCAGCCCACCTCTGCTGTCGGG + Intergenic
1179496193 21:41772651-41772673 CCCTGCCCACCTCTACTGGCCGG + Intergenic
1179627210 21:42655437-42655459 CCCTGCCCACAATAACAGCCTGG - Intronic
1180110048 21:45643374-45643396 CCCCGCCCACTACTAGTGACCGG + Intergenic
1184409766 22:44319719-44319741 CCCTTCCCACCACTCCGGTCTGG + Intergenic
1184438440 22:44494638-44494660 CCCTGTCCACAACTGCAGCCGGG - Exonic
952294896 3:32052796-32052818 CCTTGCCCCCAACTCCTGACAGG - Intronic
953801883 3:46030997-46031019 CCTTGCCCAGAACCACTGTGGGG + Intergenic
954639522 3:52089708-52089730 CCCTCCCAACAAATTCTGTCTGG + Intronic
960528260 3:118734917-118734939 CCCTGCCCACAGCTGCAGTCAGG + Intergenic
960583942 3:119303573-119303595 CCCTTCCCACCACTACTGGAGGG + Intronic
960811270 3:121629635-121629657 CACTGCCCACAACTGCTTTGTGG + Exonic
962255623 3:133868198-133868220 ACCTGCCCTCAACAACTGCCCGG + Intronic
967447958 3:189589033-189589055 CCCTTCCCAGAACTATTGGCAGG + Intergenic
970758686 4:19456473-19456495 CCCTGGCGTCCACTACTGTCTGG + Intergenic
972881936 4:43435492-43435514 CCCTGCCAACAACTGACGTCAGG - Intergenic
973344026 4:49035037-49035059 CACTCCCCAGAAGTACTGTCTGG + Intronic
976741685 4:88363406-88363428 CCCTGCCTACCACTTGTGTCTGG + Intergenic
977754266 4:100648063-100648085 CCATCCAAACAACTACTGTCTGG - Intronic
978928442 4:114280266-114280288 ACCTGCCTACACCTACTGTGTGG + Intergenic
980892592 4:138831127-138831149 CCCTACCGACACCTACTGTCAGG + Intergenic
981610195 4:146585512-146585534 CTCTGCCCACATCTCCTATCAGG + Intergenic
985474592 5:72590-72612 CCCACCCCACAGCTGCTGTCTGG + Intergenic
985843672 5:2328902-2328924 CTCTGCCCACAGTGACTGTCGGG - Intergenic
991356618 5:65775513-65775535 CCCTGCACATAACTACAGCCTGG + Intronic
995532827 5:113108026-113108048 TGCTGCCCACCACTACTGTAAGG + Intronic
999637154 5:153634827-153634849 CCCTGCCCTCAACTGATTTCTGG - Intronic
1006756736 6:36422901-36422923 CCCTGCCCACCATTGCTGTGCGG - Intronic
1006812510 6:36829124-36829146 CCTTGCCCACCACTGCTGACTGG + Intronic
1019430338 7:996206-996228 CCCTCCCCACAACAACAGCCCGG + Intergenic
1020087727 7:5320552-5320574 CCGGCCCCACATCTACTGTCTGG - Exonic
1021807434 7:24371289-24371311 CTCAGCCCAGAAGTACTGTCAGG + Intergenic
1022096994 7:27147391-27147413 CCCTGCCCGCTGCTGCTGTCGGG + Exonic
1024554465 7:50591691-50591713 CCATGTCCACAACCACTGTGAGG + Exonic
1025206587 7:56996613-56996635 CCAGCCCCACATCTACTGTCTGG + Intergenic
1025665351 7:63580314-63580336 CCAGCCCCACATCTACTGTCTGG - Intergenic
1030885490 7:114931471-114931493 CCCTGCCCACAAATATTTTTCGG + Intronic
1031837536 7:126696380-126696402 CCCTGCCCCCTACTCCTGACAGG + Intronic
1039779489 8:40770250-40770272 CCCTGCCCACAACTTCCAGCAGG + Intronic
1041012839 8:53560414-53560436 CCCTGACCACAACCACTGCTAGG + Intergenic
1044345361 8:91098288-91098310 CCCAGCCCACATGTACTGCCTGG - Intergenic
1045193467 8:99906249-99906271 CCCAGCCCACAGCTACTATCTGG - Intergenic
1049082967 8:140457342-140457364 CCCGGCCCACACCTGCTGCCCGG - Intronic
1057354173 9:94321291-94321313 CCCTGCCCTCAGCTGCTGCCTGG - Intronic
1059479463 9:114577230-114577252 CCCTGCCCAGAACTGCTCTATGG + Intergenic
1060929088 9:127477199-127477221 CCCACCCCACACCTCCTGTCAGG - Intronic
1203779661 EBV:94286-94308 CACGGCCCACAACTTATGTCTGG + Intergenic
1190455988 X:50628219-50628241 CTCTGCCCACATCTGCTGGCAGG + Intronic
1191986652 X:66988233-66988255 CCCTGCACAAAACACCTGTCTGG + Intergenic
1193808018 X:86016659-86016681 CCCTGCAGAAAACTTCTGTCTGG - Intronic
1197276161 X:124481936-124481958 TCCTGCTCACAAATACTATCTGG - Exonic
1201591812 Y:15623642-15623664 CCTTGCCCCCAACCACTGACAGG - Intergenic