ID: 1169787142

View in Genome Browser
Species Human (GRCh38)
Location 20:9371022-9371044
Sequence GTCCCTCTGGTTCCCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169787142_1169787146 -4 Left 1169787142 20:9371022-9371044 CCAGCTCTGGGAACCAGAGGGAC 0: 1
1: 0
2: 1
3: 26
4: 251
Right 1169787146 20:9371041-9371063 GGACACTGGAGGAACTAGTTTGG 0: 1
1: 0
2: 1
3: 13
4: 109
1169787142_1169787148 23 Left 1169787142 20:9371022-9371044 CCAGCTCTGGGAACCAGAGGGAC 0: 1
1: 0
2: 1
3: 26
4: 251
Right 1169787148 20:9371068-9371090 TGAAAAACATCTGCAATGAGAGG 0: 1
1: 0
2: 0
3: 24
4: 281
1169787142_1169787147 -3 Left 1169787142 20:9371022-9371044 CCAGCTCTGGGAACCAGAGGGAC 0: 1
1: 0
2: 1
3: 26
4: 251
Right 1169787147 20:9371042-9371064 GACACTGGAGGAACTAGTTTGGG 0: 1
1: 0
2: 0
3: 7
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169787142 Original CRISPR GTCCCTCTGGTTCCCAGAGC TGG (reversed) Intronic
900252044 1:1675990-1676012 GTCCCTCTCGTTACTAGAGCGGG - Intronic
900262455 1:1738848-1738870 GTCCCTCTCGTTACTAGAGCGGG - Intronic
900363933 1:2302930-2302952 GCACCTGTGGTTCCCAGGGCAGG - Intronic
903771154 1:25765296-25765318 CTGCCTCTGCTTCCCAGAGCTGG - Intronic
904554215 1:31347583-31347605 GTACCTCTGGGTCCAACAGCTGG - Intronic
904616699 1:31753878-31753900 GGCACACTGGTGCCCAGAGCTGG - Intronic
905344873 1:37304518-37304540 GTGCCTCTCTCTCCCAGAGCTGG - Intergenic
906444643 1:45884929-45884951 GTACCTCTTGTACACAGAGCTGG + Intronic
906644757 1:47466369-47466391 GTCACTCTATTCCCCAGAGCGGG + Intergenic
908395539 1:63722099-63722121 GTCCCACAGTTTCCCAGAGTAGG - Intergenic
911162257 1:94693124-94693146 CTCACTCTAGTTCCCAGAGTAGG - Intergenic
912865777 1:113254974-113254996 CTCCCTCTAGTACCCAGAGCAGG - Intergenic
914214059 1:145608295-145608317 GTCACTCTGGCACCCAGAGAGGG + Intronic
914831619 1:151174721-151174743 CTGCCTCTGGTTCCCTGTGCTGG + Intronic
915496136 1:156284089-156284111 CTCCCTCTGCTTTCCTGAGCTGG + Intronic
915722864 1:157996700-157996722 GTCCCACTTCTGCCCAGAGCAGG + Intronic
918781937 1:188710508-188710530 TTCCCTCTTGTTGCCAAAGCTGG - Intergenic
919742715 1:200990439-200990461 GCACCTCTGGATTCCAGAGCAGG + Intronic
919755200 1:201062195-201062217 GTCCCCTTGGGTCCCAGATCTGG - Intronic
920310812 1:205047236-205047258 GTCTCTGTGGTACCCTGAGCTGG - Intronic
920351240 1:205339404-205339426 GTCCCCCTGGGGGCCAGAGCAGG + Exonic
920778235 1:208962006-208962028 CTCGCTCTGTTGCCCAGAGCTGG + Intergenic
920977709 1:210801425-210801447 CTCACTCTGGAGCCCAGAGCGGG - Intronic
921358250 1:214306485-214306507 TTCCCTGTGTTTCCCACAGCAGG + Intronic
923783681 1:237047929-237047951 ATCTCTCTGGCTCTCAGAGCTGG - Intronic
924456045 1:244219642-244219664 GTTCCTCTGGTGCCCAGCCCAGG + Intergenic
1063449412 10:6141451-6141473 GTCCCTCTGGTTTTCAGACCTGG - Intergenic
1063881251 10:10535311-10535333 TGCCCTCTGGTTCCCATAGCAGG + Intergenic
1064565267 10:16633156-16633178 GACACTTTGGTTCCCACAGCTGG - Intronic
1067981946 10:51097025-51097047 GTCCCTCTGGTACCTACAGTGGG + Intronic
1069592965 10:69653088-69653110 GCCCCTCTGGTTCACAGGACTGG - Intergenic
1069841004 10:71339447-71339469 ATCCCTCTGTTCCTCAGAGCTGG + Intronic
1070794816 10:79210386-79210408 GTCCCTCTGGGGCCCAGCACAGG - Intronic
1071482191 10:86073312-86073334 GTCCCCCTGCTGCACAGAGCTGG - Intronic
1072614967 10:97043206-97043228 CTCCCTCCGGTCCTCAGAGCCGG - Intronic
1072751885 10:97986744-97986766 CTGCCCCTGGTTCCCAAAGCAGG - Intronic
1072809288 10:98446779-98446801 GTCCCTAGGGGTCCCGGAGCGGG - Intronic
1073151198 10:101312814-101312836 GGCTCTCTAGGTCCCAGAGCTGG - Intergenic
1073564366 10:104522522-104522544 CTCCCTCTGGTCCTCAGAGGAGG + Intergenic
1074368059 10:112876020-112876042 GTCACTGTGTTTCTCAGAGCCGG + Intergenic
1074440518 10:113473667-113473689 TCCCCTTTGGTTCCCAGATCTGG - Intergenic
1077252866 11:1568308-1568330 CTCCCTCTGGGTCTCAGATCTGG - Intronic
1078085576 11:8231430-8231452 GTCCCTGTGGTTCCAGGAGAAGG - Intronic
1078095891 11:8297019-8297041 GCCCCTCTGCTTCCCACAGCAGG + Intergenic
1078508134 11:11966988-11967010 GTCCCTCTGGTTGTCACAGATGG + Exonic
1079082026 11:17420393-17420415 GGCCATCTGGTTCCCATGGCTGG + Intronic
1079586204 11:22128935-22128957 GTCCCTAGGCTTCACAGAGCAGG + Intergenic
1081732204 11:45379529-45379551 TTCCTTCTGGTTCTGAGAGCTGG - Intergenic
1081889062 11:46525102-46525124 CTCCCTATGGTTGCCCGAGCTGG - Intronic
1082236345 11:49823166-49823188 GTCCCTCTGGCTCCCATGGTGGG + Intergenic
1082239796 11:49857674-49857696 GTCCCTCTGGCTCCCATGGTGGG + Intergenic
1082242356 11:49886677-49886699 GTCCCTCTGGGTCCCATGGTAGG - Intergenic
1082656846 11:55867482-55867504 GTCCCTCTGGCTCCCATGGTGGG - Intergenic
1083197722 11:61099054-61099076 GTCCCTGTGTTTCCCTGGGCTGG - Intergenic
1084013617 11:66366226-66366248 CTGCCTCTGGCTCCCAGATCTGG - Exonic
1084172192 11:67406033-67406055 GTCACTAGGGTTCCCAGAGCAGG - Intronic
1084476713 11:69393605-69393627 GTCCATCTGTCTCCCATAGCTGG - Intergenic
1087037902 11:93773064-93773086 TTCACTCTGGTTCCCAGGACTGG + Intronic
1088814324 11:113410938-113410960 GTCAGGCTGGTCCCCAGAGCCGG + Intronic
1089964928 11:122647971-122647993 GGACCTCAGGTTCTCAGAGCTGG - Intergenic
1090036324 11:123252704-123252726 TCCCCTCTGGTTCCCAGGACAGG + Intergenic
1091221888 11:133934686-133934708 GTCCGACTGCTGCCCAGAGCTGG - Intronic
1091836995 12:3593002-3593024 ATCCCTGTGGTTCCAGGAGCAGG + Intronic
1092505235 12:9092102-9092124 CTCCTTCTGCTTCCCAGTGCAGG - Intronic
1092515917 12:9212211-9212233 GTCCCACTGGGTCCCTGAGTGGG + Intergenic
1092636357 12:10454834-10454856 CTCCCTCTGTATCCCTGAGCTGG - Intergenic
1094088412 12:26620077-26620099 GTCCCTCTGTATCACAGAGCTGG + Intronic
1094617571 12:32049616-32049638 GTCCATCTGTCTGCCAGAGCTGG + Intergenic
1094664567 12:32506422-32506444 GTCACTGTGGATCCCAAAGCAGG + Intronic
1096652216 12:53067455-53067477 GCTCCCCTGGTTTCCAGAGCTGG + Intronic
1096796990 12:54084089-54084111 ATGCCTTTGGTTCCCAGATCTGG - Intergenic
1103349509 12:120274074-120274096 CTCCCTCTGTCACCCAGAGCTGG + Intergenic
1104716210 12:131018119-131018141 CTCCCTCTCGTGCACAGAGCGGG + Intronic
1105745653 13:23375266-23375288 GTCCCTCTGCTTTCCACAGGTGG - Exonic
1110350406 13:74500827-74500849 GCACCTGTGGTTCCCAGATCAGG - Intergenic
1110800147 13:79684802-79684824 GTCCCTCTGGTTCAAAAAGAGGG + Intergenic
1116241448 14:42348048-42348070 GTCCCACTGGCCCCCACAGCTGG - Intergenic
1117350618 14:54877962-54877984 GGCACTCTGGTTCTCAGACCGGG - Intronic
1117472252 14:56057706-56057728 GTCCCCGTAGTCCCCAGAGCAGG + Intergenic
1117619677 14:57572056-57572078 ATCCCTCTGTATCCTAGAGCAGG + Intronic
1117994163 14:61462852-61462874 GTCTCTCTGAAGCCCAGAGCAGG + Intronic
1118617847 14:67587160-67587182 GTCCATCCAGTTCCCACAGCTGG - Exonic
1118916535 14:70112191-70112213 GTCCCTGAGGTTGCCAGAGAAGG + Intronic
1119291224 14:73496918-73496940 CTTGCTCTGTTTCCCAGAGCTGG + Intronic
1122460032 14:101887207-101887229 GTCCCGCTGTGTGCCAGAGCAGG - Intronic
1123774786 15:23567239-23567261 GTCCCACTGGTCCTCAGAGAAGG - Exonic
1126488590 15:49211211-49211233 GTTCCACAGGTCCCCAGAGCAGG + Intronic
1128263885 15:66252146-66252168 GTCCCACTCGTTCCCGGAGTCGG - Intronic
1128942787 15:71802189-71802211 CTCCCACTGGTTACCAGGGCTGG - Intronic
1129414283 15:75366676-75366698 CTCCATCTGGTTCCCAGCTCTGG + Intronic
1129635835 15:77316459-77316481 TTCTCCCTGGTTCCCAAAGCAGG + Intronic
1129712358 15:77826757-77826779 GTCCCTGTGGGTTCCAGTGCTGG - Intergenic
1131422653 15:92320163-92320185 TTCTCTCTGCTCCCCAGAGCAGG + Intergenic
1132609877 16:810343-810365 TCCCCTCTGGTTCCCTGAGGAGG + Intronic
1139505165 16:67394955-67394977 CTCCCTCGAGTTCCCAGAGCAGG + Intronic
1141926326 16:87172646-87172668 GCCTGTCTGGTTCCAAGAGCTGG + Intronic
1142046976 16:87931753-87931775 GGCCCACTGTTTCCCAGCGCCGG - Intronic
1142355697 16:89600790-89600812 GCCCCTCTGGGTTTCAGAGCCGG - Intergenic
1142867015 17:2797364-2797386 TTGTCTCTGGTTCCCAGTGCTGG + Intronic
1143037404 17:4007308-4007330 CTCCCTCTGGTCCCCAGCACTGG - Intronic
1143472429 17:7184285-7184307 GTGCTTATGGTCCCCAGAGCTGG - Intergenic
1144651993 17:17013121-17013143 GTCCCTCAGGAACCCAGGGCAGG + Intergenic
1145061907 17:19738948-19738970 CTCCCTCTGGGCCCCAGGGCTGG - Intronic
1146413514 17:32610413-32610435 GTCCCTATTGTTGCCAAAGCAGG + Intronic
1146831063 17:36070001-36070023 CTCCCTCTGTCTCCCAGAGGTGG - Intronic
1148769990 17:50061061-50061083 GGCCCTCTGGCTCCCAGCCCAGG - Intronic
1150707797 17:67503383-67503405 CTCACTCTGGGTCACAGAGCTGG + Intronic
1151367212 17:73625426-73625448 GCCTCTCTGCTTTCCAGAGCAGG + Intronic
1151551871 17:74826905-74826927 GTCACTCTGGTTGGCAGAGCAGG + Intronic
1151969642 17:77451088-77451110 GTCCCTGTGCTTGCCAGAGGCGG - Intronic
1152645392 17:81466402-81466424 AAGCCTCTCGTTCCCAGAGCTGG + Intergenic
1152931449 17:83112133-83112155 GACCCTCTGGTTCCACAAGCTGG - Intergenic
1154099172 18:11453522-11453544 GTCTCTCTAGTTGCCATAGCAGG - Intergenic
1154251700 18:12750279-12750301 AACCCCCGGGTTCCCAGAGCAGG - Intergenic
1155471507 18:26196809-26196831 GTCTCTCTGTTGCCCAGAACTGG - Intergenic
1155495328 18:26436774-26436796 CTGCCTCATGTTCCCAGAGCAGG + Intergenic
1158489442 18:57896616-57896638 TTCTCCCTGGTTCCCAGAACAGG + Intergenic
1160192277 18:76723915-76723937 GCCCCTCTGCTTCTCAGGGCTGG - Intergenic
1160790274 19:919826-919848 GGACCGCTGGTTCCCCGAGCGGG + Intronic
1161772972 19:6241364-6241386 TGCCCTGTGGCTCCCAGAGCAGG - Intronic
1161887568 19:7008662-7008684 TTCTCCCTGTTTCCCAGAGCAGG + Intergenic
1163279546 19:16307156-16307178 GCCCCTCAGGTTCCCAGGCCGGG - Intergenic
1163497054 19:17652714-17652736 GTCCCTCCCCTCCCCAGAGCAGG + Intronic
1163515611 19:17761688-17761710 CTTCCTCTGTTGCCCAGAGCTGG + Intronic
1164214090 19:23128886-23128908 GTCCCTAGGCTTCACAGAGCAGG - Intronic
1164702498 19:30295849-30295871 GTCCCTCTTGTTGCCAGATGTGG + Intronic
1164721048 19:30431769-30431791 GGGCCTCTGGTTCCCAGGGCAGG + Intronic
1165437731 19:35805821-35805843 GTCCCTGTGGCCCCCAGAGAAGG + Intronic
924981202 2:223162-223184 TTCCCTTTGGGTCCCACAGCTGG + Intronic
925033535 2:670312-670334 ATCCCTTTGGTTCTCATAGCAGG + Intronic
926224422 2:10956784-10956806 GTCACTCTTGTGCCCAGATCTGG - Intergenic
927269860 2:21194846-21194868 GGCCTTCTGGTTTCCAGAGCTGG - Intergenic
927916206 2:26938343-26938365 GGCCCTCTGGATACCTGAGCAGG - Intronic
934847346 2:97670593-97670615 CTCCCTCTGTCACCCAGAGCTGG + Intergenic
935336882 2:102024330-102024352 GTACCTCTGGTTCCTACAACTGG - Intronic
935755213 2:106271256-106271278 GTCCCTCTGTCTGCCAGGGCAGG - Intergenic
936085816 2:109468473-109468495 GTCCCACTGGATCTCAGAGAGGG + Intronic
937203363 2:120220091-120220113 GGCACTCAGGTTCCTAGAGCTGG + Intergenic
938201191 2:129374378-129374400 GTCCCTGTGGTTGCCAAAGGTGG + Intergenic
940664406 2:156589984-156590006 GTCCCTCTACTTCCCAGAACAGG - Intronic
941929843 2:170928915-170928937 GTCCCCCTGGTGGCCAGAGGCGG - Exonic
944110694 2:196128781-196128803 GAGCCTCAGGTTCCCAAAGCAGG + Intergenic
944837924 2:203598070-203598092 GTCCTGCTGGTTGCCGGAGCTGG + Intergenic
947873265 2:233451363-233451385 GTCCCTCGGGTTCCCTCATCAGG - Intronic
948466095 2:238152241-238152263 GCCCCTCTGGTCCCCAGGGGCGG - Exonic
948671699 2:239572701-239572723 GTCCCTCTGCCTCTCAGAGGAGG - Intergenic
948766832 2:240226799-240226821 GTCCGTCTGTTCTCCAGAGCTGG - Intergenic
1168901800 20:1371135-1371157 GACCCTCTGGTTCCTATGGCAGG + Intronic
1169129819 20:3160336-3160358 CTCGCTCTGTGTCCCAGAGCTGG - Intergenic
1169787142 20:9371022-9371044 GTCCCTCTGGTTCCCAGAGCTGG - Intronic
1171848846 20:30293946-30293968 ATGCCTTTGGTTCCCAGATCTGG - Intergenic
1172219826 20:33266111-33266133 GAGTCTCTGGTTCCCAGAGTGGG + Intergenic
1172392342 20:34574454-34574476 GTCCCTCTGTTCCACAGAGCAGG - Intronic
1172446449 20:34995947-34995969 GCCCCTGTGGTTCCCAGTGCTGG + Intronic
1172501132 20:35428348-35428370 CTCCCTCTGTTTCCCAGCCCAGG + Intergenic
1172838726 20:37889127-37889149 GTCCCTGGTGTTTCCAGAGCAGG - Intergenic
1173161563 20:40656500-40656522 GTCCCTCTGGTTCACGGGGAGGG - Intergenic
1173190685 20:40873385-40873407 CTGCCTCTGTTTCCCAGAGGAGG + Intergenic
1173257934 20:41408278-41408300 GGCCCTGTGGTTCCCAGCCCAGG + Intronic
1173420390 20:42895988-42896010 CTCCCTCCAGTTCCCAGAGACGG - Intronic
1174034910 20:47662948-47662970 GTCCCACTGAGTCCCTGAGCCGG - Intronic
1176041807 20:63069636-63069658 GGCCCTGTGTCTCCCAGAGCCGG - Intergenic
1176922014 21:14699056-14699078 GTCCCTCTTGACCACAGAGCAGG - Intergenic
1176966970 21:15222231-15222253 AGCCCTCTGCTTGCCAGAGCTGG - Intergenic
1178413326 21:32383554-32383576 TTTCCTCTGGTTCCCTGTGCAGG - Exonic
1178474721 21:32927611-32927633 CTCTCTCTGTTGCCCAGAGCTGG - Intergenic
1178877327 21:36423083-36423105 GTCCCCCTGGTTCCCACAGGAGG + Intergenic
1180990587 22:19933452-19933474 GTCCTTCTTGTTGCCATAGCAGG + Intronic
1181010151 22:20035541-20035563 GGACCTCTGGGGCCCAGAGCAGG - Intronic
1181107141 22:20582196-20582218 GTCCCACTGGTCAGCAGAGCAGG + Intronic
1181133506 22:20748531-20748553 CCCCCTGTGGTCCCCAGAGCAGG - Intronic
1181527112 22:23496269-23496291 ATCCATCTGCCTCCCAGAGCAGG - Intergenic
1182559554 22:31149078-31149100 GGCCCTCTGATGCCCAGACCAGG + Intergenic
1182974626 22:34611380-34611402 GTCACTTTGTTGCCCAGAGCTGG - Intergenic
1183829976 22:40413105-40413127 GTCACTCTGTTTCCCAGTGTTGG - Intronic
1184117123 22:42428687-42428709 GTCCCTCTGGTGCCTAGAACCGG + Intronic
950433591 3:12965915-12965937 GTGTCTCTGGTGCCTAGAGCAGG + Intronic
950524047 3:13513262-13513284 TTCCCTCTGGTTCCAAGACCAGG - Intergenic
951096113 3:18633291-18633313 GTCGCTATGATTCCCAGAGGAGG + Intergenic
952314206 3:32218511-32218533 GGCTGTCTGGTACCCAGAGCAGG - Intergenic
953882804 3:46700396-46700418 GTCTCCCTGGTTCTCAGGGCAGG + Intergenic
954527349 3:51283779-51283801 GTCCCCTTTGTTCCCAGAACGGG - Intronic
954666270 3:52254369-52254391 GTTTGCCTGGTTCCCAGAGCTGG - Intergenic
954682582 3:52353693-52353715 GTGGCTGTGGTTGCCAGAGCAGG - Intronic
956157982 3:66318174-66318196 CTCGCTGGGGTTCCCAGAGCTGG + Intronic
960745774 3:120886811-120886833 CTCACTCTGTTGCCCAGAGCTGG + Intergenic
961153817 3:124662062-124662084 GCCCCTCTGGTTCACAGTCCTGG + Intronic
962542020 3:136391860-136391882 GTTCCCCTGATTCCCAGAGTTGG - Intronic
962711993 3:138095132-138095154 GTCCCTCTGTTTCCCCAAACTGG + Intronic
963921959 3:150914380-150914402 ATCACTCTGGTTCCCAGGCCTGG - Intronic
966532073 3:180992356-180992378 GTTCCTCTGGAGCACAGAGCAGG - Intergenic
966567194 3:181396539-181396561 GTCTCTCTGGTTCCATGAGTGGG + Intergenic
968664078 4:1811130-1811152 GTCACTGAGGTCCCCAGAGCAGG + Intergenic
968817415 4:2829208-2829230 GCCCATCAGGTTCCCAGAGGTGG - Intronic
969098642 4:4752651-4752673 TTGCCTCTGCTTCCCTGAGCTGG + Intergenic
969372607 4:6743340-6743362 GGCCCTAGGGTTCCCAGAGCAGG + Intergenic
969376823 4:6768551-6768573 GTGGACCTGGTTCCCAGAGCTGG + Intergenic
969562397 4:7957835-7957857 GTTGCTCTGTTGCCCAGAGCTGG + Intergenic
970601965 4:17647733-17647755 GTCCTTCTGGTGCCCAGAACAGG + Exonic
973945314 4:55949066-55949088 GGCCCTCTGGCTCCCACATCCGG - Intronic
978421726 4:108540854-108540876 GCCCCTGTGGTTTTCAGAGCAGG + Intergenic
978802971 4:112772724-112772746 GTCCCTTTGGTACCCTCAGCAGG + Intergenic
982780791 4:159488994-159489016 GAACATGTGGTTCCCAGAGCAGG + Intergenic
983401248 4:167268855-167268877 GTCCCTGTGTTTCACAGAGAAGG + Intergenic
985789203 5:1916234-1916256 CTCCTTCTGGTTCCCGGAGCAGG - Intergenic
987642759 5:20633474-20633496 GGCCCTTTGGGTCCCAGGGCAGG - Intergenic
987859418 5:23465430-23465452 ATCCCACTGGTTCCCAGAGCTGG + Intergenic
988484505 5:31657487-31657509 GTCACTGTGTTTCCCAGATCTGG - Intronic
992488323 5:77216789-77216811 TTCCCTCTGGTTTCCAGATGTGG - Intronic
994373696 5:98994790-98994812 GTCCATCTATTTCCTAGAGCTGG + Intergenic
996478859 5:123950397-123950419 ATCCCTCTGCTTCCCAGTGTAGG - Intergenic
997782954 5:136678270-136678292 GTGCCCCTGGTTCCCATAGGAGG - Intergenic
1000979873 5:167805262-167805284 GTCCCTATGGTTCTCAAAGTTGG + Intronic
1001112033 5:168904634-168904656 GTCATTCTTGTCCCCAGAGCTGG - Intronic
1002428687 5:179190892-179190914 GCCCCTGTGTTTTCCAGAGCTGG + Intronic
1002879971 6:1242568-1242590 CTCCCTCTGGTTTGCAGAGGTGG + Intergenic
1004735534 6:18402448-18402470 ATATCTCTGTTTCCCAGAGCTGG - Intronic
1005468580 6:26139782-26139804 CTCGCTCTGTTGCCCAGAGCTGG - Intergenic
1005944255 6:30584175-30584197 CTCCCTCTGCCTCCCAGAGGTGG + Exonic
1006417010 6:33910667-33910689 GTCCCTCAGCCTCCCTGAGCTGG - Intergenic
1006497998 6:34437760-34437782 GTTTCTCTGGGTCCCAGAACGGG - Intergenic
1006829101 6:36958178-36958200 GGCTGTCTGGCTCCCAGAGCTGG + Intronic
1007476509 6:42123076-42123098 GTCCCTCTGCGTCTGAGAGCTGG - Intronic
1007772362 6:44201882-44201904 GCCCCTCTGGATGCCAGAGCAGG - Intergenic
1007831636 6:44643383-44643405 TTTCCTCTGGTCCCCAGGGCAGG - Intergenic
1008433227 6:51445381-51445403 TTCCCTCTGGGTCCCAGGACAGG + Intergenic
1009345621 6:62610456-62610478 GTCCCACAGATTCCTAGAGCAGG + Intergenic
1011038195 6:83000662-83000684 GTCCCTTTGGGTCCCTGAGTTGG + Intronic
1011414427 6:87102743-87102765 CTCACTCTGTTGCCCAGAGCTGG + Intergenic
1012497679 6:99852587-99852609 CTCTCTCTGCCTCCCAGAGCTGG + Intergenic
1017118737 6:151003816-151003838 GTCCCTCTGATGCCCAGCCCAGG - Intronic
1018496977 6:164358879-164358901 ATCCCTCTGCCTCCCAGAACTGG + Intergenic
1018606002 6:165598809-165598831 GGCCCTCTAGGTCCCAGTGCTGG - Intronic
1018862746 6:167722871-167722893 CCTCCTCTGGGTCCCAGAGCCGG - Intergenic
1019743217 7:2685527-2685549 CTCACTCTGTTGCCCAGAGCTGG - Intronic
1020063550 7:5170337-5170359 GTCCCTCTGGTTCCTAGAATTGG + Intergenic
1023164336 7:37328351-37328373 CTCCCTATGTTGCCCAGAGCTGG - Intronic
1024026634 7:45414697-45414719 CTCACTATGGTTTCCAGAGCCGG - Intergenic
1025739012 7:64181868-64181890 GTCCCTCTGGGTCGAAGCGCGGG + Intronic
1026930579 7:74220970-74220992 GACACTCTGTGTCCCAGAGCAGG - Intronic
1032441462 7:131945753-131945775 GTCCCTTTGCTTCCCGGAGATGG - Intergenic
1032855153 7:135828069-135828091 GTCCCCCTGGTCCCCTGAGGGGG - Intergenic
1033102215 7:138483786-138483808 GTGCCCCTGGTTCCCACAGGAGG + Intronic
1035077345 7:156189505-156189527 CTCTCTCTGTCTCCCAGAGCTGG - Intergenic
1036514750 8:9433506-9433528 GTCCCTCTATTTCCCCGGGCTGG - Intergenic
1036655155 8:10672978-10673000 GACCCTCAGGGTCCCAGAGGAGG - Intronic
1036953803 8:13165987-13166009 GTCCCTCTGGCTCCCAGTGGTGG - Intronic
1037825589 8:22158746-22158768 CTCACGCTGGGTCCCAGAGCTGG + Intronic
1038553960 8:28493891-28493913 GCACCTCTGGTTCTCAGACCAGG + Intergenic
1039080672 8:33731429-33731451 GTCACCCTGGCTCCCAGAGGAGG + Intergenic
1039954078 8:42194163-42194185 CTGCCTCAGCTTCCCAGAGCTGG + Intronic
1041390243 8:57341378-57341400 TTTCCTCTGGTCTCCAGAGCTGG - Intergenic
1042447853 8:68909257-68909279 GTCCTTCTGTTTGACAGAGCTGG - Intergenic
1045435442 8:102158807-102158829 CTCCCTGAGGTGCCCAGAGCTGG - Intergenic
1046765621 8:118066388-118066410 CTCACTCTGTTGCCCAGAGCTGG + Intronic
1048678541 8:136812667-136812689 GTTCCTCTGGCACCCAGAGGCGG - Intergenic
1049347866 8:142148309-142148331 GTCCCTGTGGGTGACAGAGCAGG - Intergenic
1049656664 8:143802107-143802129 GACCATCTGGTTCTCAGAGAGGG - Intronic
1052975418 9:34406405-34406427 CTCCCTCTGTTTCCCTGTGCTGG + Intronic
1053786557 9:41656666-41656688 ATGCCTTTGGTTCCCAGATCTGG - Intergenic
1054158503 9:61657529-61657551 ATGCCTTTGGTTCCCAGATCTGG + Intergenic
1054175282 9:61870681-61870703 ATGCCTTTGGTTCCCAGATCTGG - Intergenic
1054450244 9:65399887-65399909 ATGCCTTTGGTTCCCAGATCTGG - Intergenic
1054478278 9:65588534-65588556 ATGCCTTTGGTTCCCAGATCTGG + Intergenic
1054662255 9:67710129-67710151 ATGCCTTTGGTTCCCAGATCTGG + Intergenic
1055817394 9:80222648-80222670 CTCCCTGTGGTTCTCAGAACTGG + Intergenic
1056110216 9:83387943-83387965 GTAACACTGGTTCCCAGACCTGG - Intronic
1061259581 9:129472555-129472577 ATCCATCTGCCTCCCAGAGCAGG + Intergenic
1062093759 9:134692253-134692275 GCCACTCTGGTACCCAGAGGTGG - Intronic
1062538079 9:137029524-137029546 CTCCCTCTGGTGGCCAGTGCTGG - Intronic
1062583346 9:137237807-137237829 GCACCCCTGGCTCCCAGAGCAGG - Intergenic
1062710478 9:137972579-137972601 GGCCCTCTGGTCTACAGAGCAGG - Intronic
1186084997 X:5977920-5977942 GTCAGTCTTGTTCCCTGAGCAGG + Intronic
1186342339 X:8657918-8657940 CTCCCAGTGGTTCCCAGTGCAGG - Intronic
1189344744 X:40232468-40232490 GTCCCTCGGGTACACAGAGCAGG + Intergenic
1191718078 X:64206372-64206394 GGCCCTCTGCTGCCCAGAGTGGG + Intergenic
1196817538 X:119677208-119677230 GGCCCTCTGCTTTCCAGGGCTGG - Intronic
1197040049 X:121925934-121925956 CTCACTCTGTTGCCCAGAGCTGG - Intergenic
1198409266 X:136349296-136349318 GTCATTCTTGTTCCCAGAACTGG - Exonic